Dataset for CDS classical BH3-containing proteins of organism Malurus cyaneus samueli

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5THT3_BMF-01       atggatcg------------------------------------------
A0A8C5TVU9_BCL2L11      --------------------------------------------------
A0A8C5UI47_BCL2L11      atggggcggggggcggggggtcgggccggccccggcgcgctcggccgctc
                                                                          

A0A8C5THT3_BMF-01       -----tcccagctacctggaagaggact-------------attctagcc
A0A8C5TVU9_BCL2L11      -----------------acatacaaatc----------------------
A0A8C5UI47_BCL2L11      accgcgctccgctccccgcaggcagcccgatggccaagcagcccccgagg
                                           *                              

A0A8C5THT3_BMF-01       tggatgggctggacgatgacgtg----------------tttcactctga
A0A8C5TVU9_BCL2L11      -------------caactgtgag---------------------------
A0A8C5UI47_BCL2L11      tgaaggcgcgacgcgacggcgagggcgggcggctgccggcggcggagggc
                                     * *    * *                           

A0A8C5THT3_BMF-01       tgactttggacttgcaggtcagcctggtgagatgactg------------
A0A8C5TVU9_BCL2L11      --------------------------------------------------
A0A8C5UI47_BCL2L11      cgggcccgggcgcgcagctgcgcccggcgcccccgccgcctgcccgggcc
                                                                          

A0A8C5THT3_BMF-01       -----------------------------------------caactggct
A0A8C5TVU9_BCL2L11      --------------------------------------------------
A0A8C5UI47_BCL2L11      gggccggcccggtgtcgccgccgccgcggcgcggggcccgccgaccggcc
                                                                          

A0A8C5THT3_BMF-01       ttttcacacagaaccagtcctacagctgccttctggggaggtttcaacta
A0A8C5TVU9_BCL2L11      ------------------------------ttttatggag----------
A0A8C5UI47_BCL2L11      ccttcgccacccgctcgccgctcttcatcttcgtgcggaggtcgccgctg
                                                      *  *  ****          

A0A8C5THT3_BMF-01       ttccccctcacacactg-ctgtggtcccggtatcaggca-----------
A0A8C5TVU9_BCL2L11      ------------tacagtctgtacaatttgtt------------------
A0A8C5UI47_BCL2L11      ctgccgcgctcctccagtgggtacttctcgttcgaagccgagcgcagccc
                                      * *   **       **                   

A0A8C5THT3_BMF-01       -----tcctgagcagcaggacaaggcaactcaaacactcagcccatcctc
A0A8C5TVU9_BCL2L11      cttgcccttggttc------caatgct--------------cccacttt-
A0A8C5UI47_BCL2L11      cgcgcccctgggctgc--gacaaggccacgcagacccccagcccgccct-
                              * **          *** **               ***    * 

A0A8C5THT3_BMF-01       ttccagtcaggatgttatgttgccttgtggagtcactgaagagccacgga
A0A8C5TVU9_BCL2L11      -----gtc-----------------------------------ccatgca
A0A8C5UI47_BCL2L11      -----gccaggcgctca-----------gccactgcctcagcgccatg--
                             * *                                   *** *  

A0A8C5THT3_BMF-01       gactcttctatgggagtgctggttaccgtttacatgtccctccagctggc
A0A8C5TVU9_BCL2L11      g-cttcccggtggcagtccca----------------ctctccagccg--
A0A8C5UI47_BCL2L11      g-cttcccggtggcagtccca----------------ctctccagccg--
                        * **   *  *** *** *                  * ******* *  

A0A8C5THT3_BMF-01       tttgtgttggatccgcacctccaagaggaacctcaggaaggtcagcggga
A0A8C5TVU9_BCL2L11      ----------------------------------aagaggtgcagccgga
A0A8C5UI47_BCL2L11      ----------------------------------aagaggtgcagccgga
                                                          * ** *  **** ***

A0A8C5THT3_BMF-01       agcacgtgcagaggtgcagattgcacggaagttgcagtgcattgccgacc
A0A8C5TVU9_BCL2L11      aatctg------------gattgcccaggagctgagacgcatcggggacg
A0A8C5UI47_BCL2L11      aatctg------------gattgcccaggagct----------------g
                        *    *            ****** * * ** *                 

A0A8C5THT3_BMF-01       agttccaccggctccacatacagaggcatcagcagaacagaaatcaagtg
A0A8C5TVU9_BCL2L11      agtt-caatgcctc---------------------------------cta
A0A8C5UI47_BCL2L11      agct-cactgcttt---------------------------------gtt
                        ** * **  *  *                                   * 

A0A8C5THT3_BMF-01       tggt-------ggcagctttttctcttc----------------ctacac
A0A8C5TVU9_BCL2L11      ttgtccacgcagggtaactttcctctct----------------tcactc
A0A8C5UI47_BCL2L11      tggt--------------ttttctctcttttttgttttgttttgtttttc
                        * **              *** ****                       *

A0A8C5THT3_BMF-01       aacttggccttaaa--------------cgcggaggtgaa----------
A0A8C5TVU9_BCL2L11      tccatttctctcaa--------------------agggaa----------
A0A8C5UI47_BCL2L11      tccctctttttcagggtttcttggatttccaggtggggaacccccaggtg
                          * *     * *                      * ***          

A0A8C5THT3_BMF-01       -----------------------caggaaccacactgggcagagg-----
A0A8C5TVU9_BCL2L11      ------------------------------------------aggc----
A0A8C5UI47_BCL2L11      gtgatcctgcgcctgctgcgttacatcatccgcctcatctggaggctcca
                                                                  ***     

A0A8C5THT3_BMF-01       -tga
A0A8C5TVU9_BCL2L11      -tga
A0A8C5UI47_BCL2L11      gtga
                         ***

© 1998-2022Legal notice