Dataset for CDS BAD of organism Labrus bergylta

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3Q3FKT9_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Labrus bergylta GN=BAD (length=666 residues).
atgaagtgtaacaacaagtgttatcattttataagacttgtttttgtcaaaaagcagtcggttatctgcgcaggttacgg
cactgtgaatacctttggaccggcttacagcagggacagcacagagaataagatatcctgcttgggtgtgttagatgtca
cgatggctgcgaagttcactatttcagacagtgagtccgggtcagaagaggaggtaaaagaggaagagaacgaccaatca
tcagctgtggaagagccgcatgttccccaacgacacagcttaaccctaccagagctcagactggcagggactggtcggat
caggttgaactcagagtcccacgcttacaccgtctccagggacgaagagctccaggccaggggggaagaagaggctggca
cccccacggaaggagcgccattcaggggacgatcaaaatcggctccccctgccttgtgggcagctaaaaaatacggccgg
cagctccggaggatgagcgacgagtttgacatcctgcttgacaaaggggagatgaaaaaagtaagaagccctgggccagc
caaacagatgcaccactccaagagttggtggagctacctcttcagccaccaggagacagagggagagaacaaccaccacg
aaaaccacacccaccgcaatgagtaa
>gnl|bcl2dbcds|A0A3Q3FKT9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Labrus bergylta GN=BAD (length=588 residues).
atgacactaacagcaagtgatgtcacgatggctgcgaagttcactatttcagacagtgagtccgggtcagaagaggaggt
aaaagaggaagagaacgaccaatcatcagctgtggaagagccgcatgttccccaacgacacagcttaaccctaccagagc
tcagactggcagggactggtcggatcaggttgaactcagagtcccacgcttacaccgtctccagggacgaagagctccag
gccaggggggaagaagaggctggcacccccacggaaggagcgccattcaggggacgatcaaaatcggctccccctgcctt
gtgggcagctaaaaaatacggccggcagctccggaggatgagcgacgagtttgacatcctgcttgacaaaggggtgagaa
ttaaaggggggggggggggtagcaggggtggctgtggattagtggtggagtcggtcgtctctcaaccgaaaagtcaggag
ttcaatacccagctcctgcagccacatgtccgatgtgtccttgggtccttgaatgtgtataaatgggattacctaatact
gatcatcactttacacagcagcctctag
© 1998-2020Legal notice