Dataset for CDS BAD of organism Labrus bergylta

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q3FKT9_BAD-03      atgaagtgtaacaacaagtgttatcattttataagacttgtttttgtcaa
A0A3Q3FKT9_BAD-01      atgacac-taacagcaagt-------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------

A0A3Q3FKT9_BAD-03      aaagcagtcggttatctgcgcaggttacggcactgtgaatacctttggac
A0A3Q3FKT9_BAD-01      --------------------------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------

A0A3Q3FKT9_BAD-03      cggcttacagcagggacagcacagagaataagatatcctgcttgggtgtg
A0A3Q3FKT9_BAD-01      --------------------------------------------------
A0A3Q3FKT9_BAD-02      --------------------------------------------------

A0A3Q3FKT9_BAD-03      ttagatgtcacgatggctgcgaagttcactatttcagacagtgagtccgg
A0A3Q3FKT9_BAD-01      ---gatgtcacgatggctgcgaagttcactatttcagacagtgagtccgg
A0A3Q3FKT9_BAD-02      ------------atggctgcgaagttcactatttcagacagtgagtccgg

A0A3Q3FKT9_BAD-03      gtcagaagaggaggtaaaagaggaagagaacgaccaatcatcagctgtgg
A0A3Q3FKT9_BAD-01      gtcagaagaggaggtaaaagaggaagagaacgaccaatcatcagctgtgg
A0A3Q3FKT9_BAD-02      gtcagaagaggaggtaaaagaggaagagaacgaccaatcatcagctgtgg

A0A3Q3FKT9_BAD-03      aagagccgcatgttccccaacgacacagcttaaccctaccagagctcaga
A0A3Q3FKT9_BAD-01      aagagccgcatgttccccaacgacacagcttaaccctaccagagctcaga
A0A3Q3FKT9_BAD-02      aagagccgcatgttccccaacgacacagcttaaccctaccagagctcaga

A0A3Q3FKT9_BAD-03      ctggcagggactggtcggatcaggttgaactcagagtcccacgcttacac
A0A3Q3FKT9_BAD-01      ctggcagggactggtcggatcaggttgaactcagagtcccacgcttacac
A0A3Q3FKT9_BAD-02      ctggcagggactggtcggatcaggttgaactcagagtcccacgcttacac

A0A3Q3FKT9_BAD-03      cgtctccagggacgaagagctccaggccaggggggaagaagaggctggca
A0A3Q3FKT9_BAD-01      cgtctccagggacgaagagctccaggccaggggggaagaagaggctggca
A0A3Q3FKT9_BAD-02      cgtctccagggacgaagagctccaggccaggggggaagaagaggctggca

A0A3Q3FKT9_BAD-03      cccccacggaaggagcgccattcaggggacgatcaaaatcggctccccct
A0A3Q3FKT9_BAD-01      cccccacggaaggagcgccattcaggggacgatcaaaatcggctccccct
A0A3Q3FKT9_BAD-02      cccccacggaaggagcgccattcaggggacgatcaaaatcggctccccct

A0A3Q3FKT9_BAD-03      gccttgtgggcagctaaaaaatacggccggcagctccggaggatgagcga
A0A3Q3FKT9_BAD-01      gccttgtgggcagctaaaaaatacggccggcagctccggaggatgagcga
A0A3Q3FKT9_BAD-02      gccttgtgggcagctaaaaaatacggccggcagctccggaggatgagcga

A0A3Q3FKT9_BAD-03      cgagtttgacatcctgcttgacaaaggggagatgaaaaaagtaaga----
A0A3Q3FKT9_BAD-01      cgagtttgacatcctgcttgacaaaggggtgagaattaaagggggggggg
A0A3Q3FKT9_BAD-02      cgagtttgacatcctgcttgacaaaggggtgagaattaaagggggggggg
                       ***************************** **  *  ****   *     

A0A3Q3FKT9_BAD-03      --------------agccctgggccagccaaacagatg--caccactc--
A0A3Q3FKT9_BAD-01      ggggtagcaggggtggctgtggattagtggtggagtcggtcgtctctcaa
A0A3Q3FKT9_BAD-02      ggggtagcaggggtggctgtggattagtggtggagtcggtcgtctctcaa
                                      **  ***   **      **  *  *  * ***  

A0A3Q3FKT9_BAD-03      ---------caagagttggtggagctacctcttcagcca-----------
A0A3Q3FKT9_BAD-01      ccgaaaagtcaggagttcaatacccagctcctgcagccacatgtccgatg
A0A3Q3FKT9_BAD-02      ccgaaaagtcaggagttcaatacccagctcctgcagccacatgtccgatg
                                ** *****       *  *  ** ******           

A0A3Q3FKT9_BAD-03      ------------ccaggagacagagggagagaacaacc--accacgaaaa
A0A3Q3FKT9_BAD-01      tgtccttgggtccttgaatgtgtataaatgggattacctaatactgatca
A0A3Q3FKT9_BAD-02      tgtccttgggtccttgaatgtgtataaatgggattacctaatactgatca
                                   *  * *     *   *  * *  ***  *    **  *

A0A3Q3FKT9_BAD-03      ccacacc-caccgcaatgagtaa
A0A3Q3FKT9_BAD-01      tcactttacacagcagcctctag
A0A3Q3FKT9_BAD-02      tcactttacacagcagcctctag
                        ***    *** ***     ** 

© 1998-2022Legal notice