Dataset for CDS E1B19K of organism Human adenovirus B serotype 7

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q6RK98_E1B19K-03        atgagtggaagcgcttcttttga---------------------------
Q5EY83_E1B19K-01        atggaggtttgggctatcttggaagacctcagacagactaggctactact
A0A5J6CTQ0_E1B19K-      atggaggtttgggctatcttggaagacctcagacagactaggctactgct
A0A220VZ73_E1B19K-      atggaggtttgggctatcttggaagacctcagacagactaggctactgct
I1V161_E1B19K-01        atggaggtttgggctatcttggaagacctcagacagactaggctactgct
P03248_E1B19K-02        atggaggtttgggctatcttggaagacctcagacagactaggctactgct
Q6RK98_E1B19K-01        atggaggtttgggctatcttggaagacctcagacagactaggctactgct
Q5EY83_E1B19K-02        --------------------------------------------------
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        --------------------------------------------------
I1V161_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-02        --------------------------------------------------
                                                                          

Q6RK98_E1B19K-03        ------------ggggggagtatttagccctt------------------
Q5EY83_E1B19K-01        agaaaacgcctcggacggagtctctggcctttggagattctggttcggtg
A0A5J6CTQ0_E1B19K-      agaaaacgcctcggacggagtctctggcctttggagattctggttcggtg
A0A220VZ73_E1B19K-      agaaaacgcctcggacggagtctctggcctttggagattctgcttcggtg
I1V161_E1B19K-01        agaaaacgcctcggacggagtctctggcctttggagattctggttcggtg
P03248_E1B19K-02        agaaaacgcctcggacggagtctctggcctttggagattctggttcggtg
Q6RK98_E1B19K-01        agaaaacgcctcggacggagtctctggcctttggagattctggttcggtg
Q5EY83_E1B19K-02        --------------------------------------------------
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        --------------------------------------------------
I1V161_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-02        --------------------------------------------------
                                                                          

Q6RK98_E1B19K-03        -----------------atctgacgggcaggctcccaccatgggcaggag
Q5EY83_E1B19K-01        gtgatctagctaggctagtgtttaggataaaacaggactacagggaagaa
A0A5J6CTQ0_E1B19K-      gtgatctagctaggctagtgtttaggataaaacaggactacagggaagaa
A0A220VZ73_E1B19K-      gtgatctagctaggctagtgtttaggataaaacaggactacagcgtagaa
I1V161_E1B19K-01        gtgatctagctaggctagtgtttaggataaaacaggactacagcgtagaa
P03248_E1B19K-02        gtgatctagctaggctagtgtttaggataaaacaggactacagcgtagaa
Q6RK98_E1B19K-01        gtgatctagctaggctagtgtttaggataaaacaggactacagcgtagaa
Q5EY83_E1B19K-02        --------------------------------------------------
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        --------------------------------------------------
I1V161_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-02        --------------------------------------------------
                                                                          

Q6RK98_E1B19K-03        ttcgtcagaatgtca----------tgggatccactgtggatgggagacc
Q5EY83_E1B19K-01        tttgaaaagttattggacgacattccaggactttttgaagctcttaactt
A0A5J6CTQ0_E1B19K-      tttgaaaagttattggacgacagtccaggactttttgaagctcttaactt
A0A220VZ73_E1B19K-      tttgaaaagttattggacgacagtccaggactttttgaagctcttaactt
I1V161_E1B19K-01        tttgaaaagttattggacgacagtccaggactttttgaagctcttaactt
P03248_E1B19K-02        tttgaaaagttattggacgacagtccaggactttttgaagctcttaactt
Q6RK98_E1B19K-01        tttgaaaagttattggacgacagtccaggactttttgaagctcttaactt
Q5EY83_E1B19K-02        --------------------------------------------------
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        --------------------------------------------------
I1V161_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-02        --------------------------------------------------
                                                                          

Q6RK98_E1B19K-03        cgtccagcccgccaattcctcaacgctgacctatgccactttgagttcgt
Q5EY83_E1B19K-01        gggccatcaggctcattttaaggagaaggttttatcagttttagattttt
A0A5J6CTQ0_E1B19K-      gggtcatcaggctcattttaaggagaaggttttatcagttttagattttt
A0A220VZ73_E1B19K-      gggtcatcaggctcattttaaggagaaggttttatcagttttagattttt
I1V161_E1B19K-01        gggtcatcaggctcattttaaggagaaggttttatcagttttagattttt
P03248_E1B19K-02        gggtcatcaggctcattttaaggagaaggttttatcagttttagattttt
Q6RK98_E1B19K-01        gggtcatcaggctcattttaaggagaaggttttatcagttttagattttt
Q5EY83_E1B19K-02        --------------------------------------------------
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        --------------------------------------------------
I1V161_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-02        --------------------------------------------------
                                                                          

Q6RK98_E1B19K-03        caccattggatgcagctgcagccgccgccgct------------------
Q5EY83_E1B19K-01        ctactcctggtagaactgctgctgctgtagcttttcttacttttatattg
A0A5J6CTQ0_E1B19K-      ctactcctggtagaactgctgctgctgtagcttttcttacttttatattg
A0A220VZ73_E1B19K-      ctactcctggtagaactgctgctgctgtagcttttcttacttttatattg
I1V161_E1B19K-01        ctactcctggtagaactgctgctgctgtagcttttcttacttttatattg
P03248_E1B19K-02        ctactcctggtagaactgctgctgctgtagcttttcttacttttatattg
Q6RK98_E1B19K-01        ctactcctggtagaactgctgctgctgtagcttttcttacttttatattg
Q5EY83_E1B19K-02        --------------------------------------------------
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        --------------------------------------------------
I1V161_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-02        --------------------------------------------------
                                                                          

Q6RK98_E1B19K-03        ----actgctgccgccaacactatccttggaatgggcta-----------
Q5EY83_E1B19K-01        gataaatggatccgccaa-actcacttcagcaagggatacgttttggatt
A0A5J6CTQ0_E1B19K-      gataaatggatccgccaa-actcacttcagcaagggatacgttttggatt
A0A220VZ73_E1B19K-      gataaatggatccgccaa-actcacttcagcaagggatacgttttggatt
I1V161_E1B19K-01        gataaatggatccgccaa-actcacttcagcaagggatacgttttggatt
P03248_E1B19K-02        gataaatggatccgccaa-actcacttcagcaagggatacgttttggatt
Q6RK98_E1B19K-01        gataaatggatccgccaa-actcacttcagcaagggatacgttttggatt
Q5EY83_E1B19K-02        -----atggatccgccaa-actcacttcagcaagggatacgttttggatt
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        -----atggatccgccaa-actcacttcagcaagggatacgttttggatt
I1V161_E1B19K-02        -----atggatccgccaa-actcacttcagcaagggatacgttttggatt
Q6RK98_E1B19K-02        -----atggatccgccaa-actcacttcagcaagggatacgttttggatt
                                                                          

Q6RK98_E1B19K-03        ttacggaagcatcgttgccaattccagttcctctaataacccttcaaccc
Q5EY83_E1B19K-01        tcatagcagcagctttgtggagaaca-------tggaaggctcgca----
A0A5J6CTQ0_E1B19K-      tcatagcagcagctttgtggagaaca-------tggaaggctcgca----
A0A220VZ73_E1B19K-      tcatagcagcagctttgtggagaaca-------tggaaggctcgca----
I1V161_E1B19K-01        tcatagcagcagctttgtggagaaca-------tggaaggctcgca----
P03248_E1B19K-02        tcatagcagcagctttgtggagaaca-------tggaaggctcgca----
Q6RK98_E1B19K-01        tcatagcagcagctttgtggagaaca-------tggaaggctcgca----
Q5EY83_E1B19K-02        tcatagcagcagctttgtggagaaca-------tggaaggctcgca----
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        tcatagcagcagctttgtggagaaca-------tggaaggctcgca----
I1V161_E1B19K-02        tcatagcagcagctttgtggagaaca-------tggaaggctcgca----
Q6RK98_E1B19K-02        tcatagcagcagctttgtggagaaca-------tggaaggctcgca----
                                                                          

Q6RK98_E1B19K-03        tggctgaggacaagc------tacttgt--------tctgttggctcagc
Q5EY83_E1B19K-01        -ggatgaggacaatcttagattactggccagtgcagcctctgggagtagc
A0A5J6CTQ0_E1B19K-      -ggatgaggacaatcttagattactggccagtgcagcctctgggagtagc
A0A220VZ73_E1B19K-      -ggatgaggacaatcttaaattactggccagtgcagcctctaggagtagc
I1V161_E1B19K-01        -ggatgaggacaatcttaaattactggccagtgcagcctctaggagtagc
P03248_E1B19K-02        -ggatgaggacaatcttagattactggccagtgcagcctctaggagtagc
Q6RK98_E1B19K-01        -ggatgaggacaatcttagattactggccagtgcagcctctaggagtagc
Q5EY83_E1B19K-02        -ggatgaggacaatcttagattactggccagtgcagcctctgggagtagc
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        -ggatgaggacaatcttagattactggccagtgcagcctctaggagtagc
I1V161_E1B19K-02        -ggatgaggacaatcttaaattactggccagtgcagcctctaggagtagc
Q6RK98_E1B19K-02        -ggatgaggacaatcttagattactggccagtgcagcctctaggagtagc
                                                                          

Q6RK98_E1B19K-03        tcgaggcctta---acccaacgcttaggcgaactgtctaagcaggtggcc
Q5EY83_E1B19K-01        agggatactgagacacccaccgaccatgccagcggt-tctgcaggaggag
A0A5J6CTQ0_E1B19K-      agggatactgagacacccaccgaccatgccagcggt-tctgcaggaggag
A0A220VZ73_E1B19K-      agggatactgagacacccaccgaccatgccagcggt-tctgcaggaggag
I1V161_E1B19K-01        agggatactgagacacccaccgaccatgccagcggt-tctgcaggaggag
P03248_E1B19K-02        agggatactgagacacccacctaccatgccagcggt-tctgcaggaggag
Q6RK98_E1B19K-01        agggatactgagacacccaccgaccatgccagcggt-tctgcaggaggag
Q5EY83_E1B19K-02        agggatactgagacacccaccgaccatgccagcggt-tctgcaggaggag
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        agggatactgagacacccacctaccatgccagcggt-tctgcaggaggag
I1V161_E1B19K-02        agggatactgagacacccaccgaccatgccagcggt-tctgcaggaggag
Q6RK98_E1B19K-02        agggatactgagacacccaccgaccatgccagcggt-tctgcaggaggag
                                                                          

Q6RK98_E1B19K-03        cagttg----------cgtgag-caaactgagtctgctgttgctacagca
Q5EY83_E1B19K-01        cagcaggaggacaatccgagagccggcctggaccctccggtggaggagta
A0A5J6CTQ0_E1B19K-      cagcaggaggacaatccgagagccggcctggaccctccggtggaggagta
A0A220VZ73_E1B19K-      cagcaggaggacaatccgagagccggcctggaccctccggtggaggagta
I1V161_E1B19K-01        cagcaggaggacaatccgagagccggcctggaccctccggtggaggagta
P03248_E1B19K-02        cagcaggaggacaatccgagagccggcctggaccctccggtggaggagta
Q6RK98_E1B19K-01        cagcaggaggacaatccgagagccggcctggaccctccggtggaggagta
Q5EY83_E1B19K-02        cagcaggaggacaatccgagagccggcctggaccctccggtggaggagta
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        cagcaggaggacaatccgagagccggcctggaccctccggtggaggagta
I1V161_E1B19K-02        cagcaggaggacaatccgagagccggcctggaccctccggtggaggagta
Q6RK98_E1B19K-02        cagcaggaggacaatccgagagccggcctggaccctccggtggaggagta
                                                                          

Q6RK98_E1B19K-03        a-------------------------------------------------
Q5EY83_E1B19K-01        g-------------------------------------------------
A0A5J6CTQ0_E1B19K-      g-------------------------------------------------
A0A220VZ73_E1B19K-      g-------------------------------------------------
I1V161_E1B19K-01        g-------------------------------------------------
P03248_E1B19K-02        g-------------------------------------------------
Q6RK98_E1B19K-01        g-------------------------------------------------
Q5EY83_E1B19K-02        gctgacctgtttcctgaactgcgacgggtgcttactaggtctacgaccag
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        gctgacctgtttcctgaactgcgacgggtgcttactaggtctacgaccag
I1V161_E1B19K-02        gctgacctgtttcctgaactgcgacgggtgcttactaggtctacgaccag
Q6RK98_E1B19K-02        gctgacctgtttcctgaactgcgacgggtgcttactaggtctacgaccag
                                                                          

Q6RK98_E1B19K-03        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-02        tggacagaacaggggaattaagagggagaggaatcctagtgggaataatt
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        tggacagaacagaggcattaagagggagaggaatcctagtgggaataatt
I1V161_E1B19K-02        tggacagaacagaggcattaagagggagaggaatcctagtgggaataatt
Q6RK98_E1B19K-02        tggacagaacagaggcattaagagggagaggaatcctagtgggaataatt
                                                                          

Q6RK98_E1B19K-03        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-02        caagaaccgagttggctttaagtttaatgagccgcaggcgtcctgaaact
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        caagaaccgagttggctttaagtttaatgagccgcaggcgtcctgaaact
I1V161_E1B19K-02        caagaaccgagttggctttaagtttaatgagccgcaggcgtcctgaaact
Q6RK98_E1B19K-02        caagaaccgagttggctttaagtttaatgagccgcaggcgtcctgaaact
                                                                          

Q6RK98_E1B19K-03        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-02        gtttggtggcatgaggttcagagcgaaggcagggatgaagtttcaatatt
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        gtttggtggcatgaggttcagagcgaaggcagggatgaagtttcaatatt
I1V161_E1B19K-02        gtttggtggcatgaggttcagagcgaaggcagggatgaagtttcaatatt
Q6RK98_E1B19K-02        gtttggtggcatgaggttcagagcgaaggcagggatgaagtttcaatatt
                                                                          

Q6RK98_E1B19K-03        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-02        gcaggagaaatattcactagaacaacttaagacctgttggttggaacctg
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        gcaggagaaatattcactagaacaacttaagacctgttggttggaacctg
I1V161_E1B19K-02        gcaggagaaatattcactagaacaacttaagacctgttggttggaacctg
Q6RK98_E1B19K-02        gcaggagaaatattcactagaacaacttaagacctgttggttggaacctg
                                                                          

Q6RK98_E1B19K-03        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-02        aggatgattgggaggtggccattaggaattatgctaagatatctctgagg
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        aggatgattgggaggtggccattaggaattatgctaagatatctctgagg
I1V161_E1B19K-02        aggatgattgggaggtggccattaggaattatgctaagatatctctgagg
Q6RK98_E1B19K-02        aggatgattgggaggtggccattaggaattatgctaagatatctctgagg
                                                                          

Q6RK98_E1B19K-03        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-02        cctgataaacaatatagaattactaagaagattaatattagaaatgcatg
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        cctgataaacaatatagaattactaagaagattaatattagaaatgcatg
I1V161_E1B19K-02        cctgataaacaatatagaattactaagaagattaatattagaaatgcatg
Q6RK98_E1B19K-02        cctgataaacaatatagaattactaagaagattaatattagaaatgcatg
                                                                          

Q6RK98_E1B19K-03        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-02        ctacatatcagggaatggggcagaggttataatagatacacaagataaag
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        ctacatatcagggaatggggcagaggttataatagatacacaagataaag
I1V161_E1B19K-02        ctacatatcagggaatggggcagaggttataatagatacacaagataaag
Q6RK98_E1B19K-02        ctacatatcagggaatggggcagaggttataatagatacacaagataaag
                                                                          

Q6RK98_E1B19K-03        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-02        cagcttttagatgttgtatgatgggtatgtggccaggggttgtcggcatg
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        cagcttttagatgttgtatgatgggtatgtggccaggggttgtcggcatg
I1V161_E1B19K-02        cagcttttagatgttgtatgatgggtatgtggccaggggttgtcggcatg
Q6RK98_E1B19K-02        cagcttttagatgttgtatgatgggtatgtggccaggggttgtcggcatg
                                                                          

Q6RK98_E1B19K-03        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-02        gaagcaataacacttatgaatattaggtttagaggggatgggtataatgg
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        gaagcagtaacacttatgaatattaggtttagaggggatgggtataatgg
I1V161_E1B19K-02        gaagcagtaacacttatgaatattaggtttagaggggatgggtataatgg
Q6RK98_E1B19K-02        gaagcagtaacacttatgaatattaggtttagaggggatgggtataatgg
                                                                          

Q6RK98_E1B19K-03        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-02        cattgtatttatggctaacactaagctgattctacatggttgtagctttt
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        cattgtatttatggctaacactaagctgattctgcatggttgtcgctttt
I1V161_E1B19K-02        cattgtatttatggctaacactaagctgattctacatggttgtagctttt
Q6RK98_E1B19K-02        cattgtatttatggctaacactaagctgattctacatggttgtagctttt
                                                                          

Q6RK98_E1B19K-03        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-02        ttgggtttaataatacgtgtgtagaagcttgggggcaagttagtgtgagg
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        ttgggtttaataatacgtgtgaagaagctt--------------------
I1V161_E1B19K-02        ttgggtttaataatacgtgtgtagaagcttgggggcaagttagtgtgagg
Q6RK98_E1B19K-02        ttgggtttaataatacgtgtgtagaagcttgggggcaagttagtgtgagg
                                                                          

Q6RK98_E1B19K-03        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-02        ggttgtagtttttatgcatgctggattgcaacatcaggtagggtgaagag
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        --------------------------------------------------
I1V161_E1B19K-02        ggttgtagtttttatgcatgctggattgcaacatcaggtagggtcaagag
Q6RK98_E1B19K-02        ggttgtagtttttatgcatgctggattgcaacatcaggtagggtcaagag
                                                                          

Q6RK98_E1B19K-03        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-02        tcagttgtctgtgaagaaatgcatgtttgagagatgtaatcttggcatac
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        --------------------------------------------------
I1V161_E1B19K-02        tcagttgtctgtgaagaaatgcatgtttgagagatgtaatcttggcatac
Q6RK98_E1B19K-02        tcagttgtctgtgaagaaatgcatgtttgagagatgtaatcttggcatac
                                                                          

Q6RK98_E1B19K-03        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-02        tgaatgaaggtgaagcaagggtccgccactgcgcagctacagaaactgcc
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        --------------------------------------------------
I1V161_E1B19K-02        tgaatgaaggtgaagcaaggatccgccactgcgcagctacagaaactggc
Q6RK98_E1B19K-02        tgaatgaaggtgaagcaaggatccgccactgcgcagctacagaaactggc
                                                                          

Q6RK98_E1B19K-03        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-02        tgcttcattctaataaagggaaatgccagtgtgaagcataatatgatctg
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        --------------------------------------------------
I1V161_E1B19K-02        tgcttcattctaataaagggaaatgccagtgtgaagcataatatgatctg
Q6RK98_E1B19K-02        tgcttcattctaataaagggaaatgccagtgtgaagcataatatgatctg
                                                                          

Q6RK98_E1B19K-03        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-02        tggacattcggatgagaggccttatcagatgctaacctgcgctggtggac
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        --------------------------------------------------
I1V161_E1B19K-02        tggacattcggatgagaggccttatcagatgctgacctgcgctggtggac
Q6RK98_E1B19K-02        tggacattcggatgagaggccttatcagatgctgacctgcgctggtggac
                                                                          

Q6RK98_E1B19K-03        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-02        attgcaatattcttgctaccgtgcatatcgtttcacatgcacgcaagaaa
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        --------------------------------------------------
I1V161_E1B19K-02        attgcaatattcttgctactgtgcatatcgtttcacatgcacgcaagaaa
Q6RK98_E1B19K-02        attgcaatattcttgctactgtgcatatcgtttcacatgcacgcaagaaa
                                                                          

Q6RK98_E1B19K-03        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-02        tggcctgtatttgaacataatgtgattaccaagtgcaccatgcatatagg
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        --------------------------------------------------
I1V161_E1B19K-02        tggcctgtatttgaacataatgtgattaccaagtgcaccatgcacatagg
Q6RK98_E1B19K-02        tggcctgtatttgaacataatgtgattaccaagtgcaccatgcacatagg
                                                                          

Q6RK98_E1B19K-03        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-02        tggtcgcaggggaatgtttatgccttaccagtgtaacatgaatcatgtga
Q5EY83_E1B19K-03        --------------------------------------------------
P03248_E1B19K-03        --------------------------------------------------
I1V161_E1B19K-02        tggtcgcaggggaatgtttatgccttaccagtgtaacatgaatcatgtga
Q6RK98_E1B19K-02        tggtcgcaggggaatgtttatgccttaccagtgtaacatgaatcatgtga
                                                                          

Q6RK98_E1B19K-03        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-02        aggtaatgttggaaccagatgccttttccagagtgagcgtaacaggaatc
Q5EY83_E1B19K-03        -----atgttggaaccagatgccttttccagagtgagcgtaacaggaatc
P03248_E1B19K-03        --------------------------------------------------
I1V161_E1B19K-02        aggtaatgttggaaccagatgccttttccagagtgagcttaacaggaatc
Q6RK98_E1B19K-02        aggtaatgttggaaccagatgccttttccagagtgagcttaacaggaatc
                                                                          

Q6RK98_E1B19K-03        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-02        tttgatatgaatattcaactatggaagatcctgagatatgatgacactaa
Q5EY83_E1B19K-03        tttgatatgaatattcaactatggaagatcctgagatatgatgacactaa
P03248_E1B19K-03        --------------------------------------------------
I1V161_E1B19K-02        tttgatatgaatattcaactatggaagatcctgagatatgatgacactaa
Q6RK98_E1B19K-02        tttgatatgaatattcaactatggaagatcctgagatatgatgacactaa
                                                                          

Q6RK98_E1B19K-03        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-02        accaagggtgcgcgcatgcgaatgcggaggcaagcatgctagattccagc
Q5EY83_E1B19K-03        accaagggtgcgcgcatgcgaatgcggaggcaagcatgctagattccagc
P03248_E1B19K-03        --------------------------------------------------
I1V161_E1B19K-02        accgagggtgcgcgcatgcgaatgcggaggcaagcatgctagattccagc
Q6RK98_E1B19K-02        accgagggtgcgcgcatgcgaatgcggaggcaagcatgctagattccagc
                                                                          

Q6RK98_E1B19K-03        --------------------------------------------------
Q5EY83_E1B19K-01        --------------------------------------------------
A0A5J6CTQ0_E1B19K-      --------------------------------------------------
A0A220VZ73_E1B19K-      --------------------------------------------------
I1V161_E1B19K-01        --------------------------------------------------
P03248_E1B19K-02        --------------------------------------------------
Q6RK98_E1B19K-01        --------------------------------------------------
Q5EY83_E1B19K-02        cggtgtgcgtggatgtgactgaagacctgaggcccgatcatttggtgctt
Q5EY83_E1B19K-03        cggtgtgcgtggatgtgactgaagacctgaggcccgatcatttggtgctt
P03248_E1B19K-03        --------------------------------------------------
I1V161_E1B19K-02        cggtgtgcgtggatgtgactgaagacctgagacccgatcatttggtgctt
Q6RK98_E1B19K-02        cggtgtgcgtggatgtgactgaagacctgagacccgatcatttggtgctt
                                                                          

Q6RK98_E1B19K-03        -------------------------------------agtctaaataa
Q5EY83_E1B19K-01        ------------------------------------------------
A0A5J6CTQ0_E1B19K-      ------------------------------------------------
A0A220VZ73_E1B19K-      ------------------------------------------------
I1V161_E1B19K-01        ------------------------------------------------
P03248_E1B19K-02        ------------------------------------------------
Q6RK98_E1B19K-01        ------------------------------------------------
Q5EY83_E1B19K-02        gcctgcactggagcggagttcggttctagtggtgaagaaactgactaa
Q5EY83_E1B19K-03        gcctgcactggagcggagttcggttctagtggtgaagaaactgactaa
P03248_E1B19K-03        ------------------------------------------------
I1V161_E1B19K-02        gcctgcactggagcggagttcggttccagtggtgaagaaactgactaa
Q6RK98_E1B19K-02        gcctgcactggagcggagttcggttccagtggtgaagaaactgactaa
                                                                        

© 1998-2022Legal notice