Dataset for CDS E1B19K of organism Human adenovirus B serotype 7

[Download (right click)] [Alignment] [Repertoires]

12 sequence(s)

>gnl|bcl2dbcds|A0A220VZ73_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus B serotype 7 GN=E1B19K (length=537 residues).
atggaggtttgggctatcttggaagacctcagacagactaggctactgctagaaaacgcctcggacggagtctctggcct
ttggagattctgcttcggtggtgatctagctaggctagtgtttaggataaaacaggactacagcgtagaatttgaaaagt
tattggacgacagtccaggactttttgaagctcttaacttgggtcatcaggctcattttaaggagaaggttttatcagtt
ttagatttttctactcctggtagaactgctgctgctgtagcttttcttacttttatattggataaatggatccgccaaac
tcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
tcttaaattactggccagtgcagcctctaggagtagcagggatactgagacacccaccgaccatgccagcggttctgcag
gaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtag
>gnl|bcl2dbcds|A0A5J6CTQ0_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus B serotype 7 GN=E1B19K (length=537 residues).
atggaggtttgggctatcttggaagacctcagacagactaggctactgctagaaaacgcctcggacggagtctctggcct
ttggagattctggttcggtggtgatctagctaggctagtgtttaggataaaacaggactacagggaagaatttgaaaagt
tattggacgacagtccaggactttttgaagctcttaacttgggtcatcaggctcattttaaggagaaggttttatcagtt
ttagatttttctactcctggtagaactgctgctgctgtagcttttcttacttttatattggataaatggatccgccaaac
tcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
tcttagattactggccagtgcagcctctgggagtagcagggatactgagacacccaccgaccatgccagcggttctgcag
gaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtag
>gnl|bcl2dbcds|I1V161_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus B serotype 7 GN=E1B19K (length=537 residues).
atggaggtttgggctatcttggaagacctcagacagactaggctactgctagaaaacgcctcggacggagtctctggcct
ttggagattctggttcggtggtgatctagctaggctagtgtttaggataaaacaggactacagcgtagaatttgaaaagt
tattggacgacagtccaggactttttgaagctcttaacttgggtcatcaggctcattttaaggagaaggttttatcagtt
ttagatttttctactcctggtagaactgctgctgctgtagcttttcttacttttatattggataaatggatccgccaaac
tcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
tcttaaattactggccagtgcagcctctaggagtagcagggatactgagacacccaccgaccatgccagcggttctgcag
gaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtag
>gnl|bcl2dbcds|I1V161_E1B19K-02 E1B19K gene OS=[Viruses] Human adenovirus B serotype 7 GN=E1B19K (length=1479 residues).
atggatccgccaaactcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctc
gcaggatgaggacaatcttaaattactggccagtgcagcctctaggagtagcagggatactgagacacccaccgaccatg
ccagcggttctgcaggaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtagctgacctg
tttcctgaactgcgacgggtgcttactaggtctacgaccagtggacagaacagaggcattaagagggagaggaatcctag
tgggaataattcaagaaccgagttggctttaagtttaatgagccgcaggcgtcctgaaactgtttggtggcatgaggttc
agagcgaaggcagggatgaagtttcaatattgcaggagaaatattcactagaacaacttaagacctgttggttggaacct
gaggatgattgggaggtggccattaggaattatgctaagatatctctgaggcctgataaacaatatagaattactaagaa
gattaatattagaaatgcatgctacatatcagggaatggggcagaggttataatagatacacaagataaagcagctttta
gatgttgtatgatgggtatgtggccaggggttgtcggcatggaagcagtaacacttatgaatattaggtttagaggggat
gggtataatggcattgtatttatggctaacactaagctgattctacatggttgtagcttttttgggtttaataatacgtg
tgtagaagcttgggggcaagttagtgtgaggggttgtagtttttatgcatgctggattgcaacatcaggtagggtcaaga
gtcagttgtctgtgaagaaatgcatgtttgagagatgtaatcttggcatactgaatgaaggtgaagcaaggatccgccac
tgcgcagctacagaaactggctgcttcattctaataaagggaaatgccagtgtgaagcataatatgatctgtggacattc
ggatgagaggccttatcagatgctgacctgcgctggtggacattgcaatattcttgctactgtgcatatcgtttcacatg
cacgcaagaaatggcctgtatttgaacataatgtgattaccaagtgcaccatgcacataggtggtcgcaggggaatgttt
atgccttaccagtgtaacatgaatcatgtgaaggtaatgttggaaccagatgccttttccagagtgagcttaacaggaat
ctttgatatgaatattcaactatggaagatcctgagatatgatgacactaaaccgagggtgcgcgcatgcgaatgcggag
gcaagcatgctagattccagccggtgtgcgtggatgtgactgaagacctgagacccgatcatttggtgcttgcctgcact
ggagcggagttcggttccagtggtgaagaaactgactaa
>gnl|bcl2dbcds|P03248_E1B19K-02 E1B19K gene OS=[Viruses] Human adenovirus B serotype 7 GN=E1B19K (length=537 residues).
atggaggtttgggctatcttggaagacctcagacagactaggctactgctagaaaacgcctcggacggagtctctggcct
ttggagattctggttcggtggtgatctagctaggctagtgtttaggataaaacaggactacagcgtagaatttgaaaagt
tattggacgacagtccaggactttttgaagctcttaacttgggtcatcaggctcattttaaggagaaggttttatcagtt
ttagatttttctactcctggtagaactgctgctgctgtagcttttcttacttttatattggataaatggatccgccaaac
tcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
tcttagattactggccagtgcagcctctaggagtagcagggatactgagacacccacctaccatgccagcggttctgcag
gaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtag
>gnl|bcl2dbcds|P03248_E1B19K-03 E1B19K gene OS=[Viruses] Human adenovirus B serotype 7 GN=E1B19K (length=811 residues).
atggatccgccaaactcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctc
gcaggatgaggacaatcttagattactggccagtgcagcctctaggagtagcagggatactgagacacccacctaccatg
ccagcggttctgcaggaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtagctgacctg
tttcctgaactgcgacgggtgcttactaggtctacgaccagtggacagaacagaggcattaagagggagaggaatcctag
tgggaataattcaagaaccgagttggctttaagtttaatgagccgcaggcgtcctgaaactgtttggtggcatgaggttc
agagcgaaggcagggatgaagtttcaatattgcaggagaaatattcactagaacaacttaagacctgttggttggaacct
gaggatgattgggaggtggccattaggaattatgctaagatatctctgaggcctgataaacaatatagaattactaagaa
gattaatattagaaatgcatgctacatatcagggaatggggcagaggttataatagatacacaagataaagcagctttta
gatgttgtatgatgggtatgtggccaggggttgtcggcatggaagcagtaacacttatgaatattaggtttagaggggat
gggtataatggcattgtatttatggctaacactaagctgattctgcatggttgtcgcttttttgggtttaataatacgtg
tgaagaagctt
>gnl|bcl2dbcds|Q5EY83_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus B serotype 7 GN=E1B19K (length=537 residues).
atggaggtttgggctatcttggaagacctcagacagactaggctactactagaaaacgcctcggacggagtctctggcct
ttggagattctggttcggtggtgatctagctaggctagtgtttaggataaaacaggactacagggaagaatttgaaaagt
tattggacgacattccaggactttttgaagctcttaacttgggccatcaggctcattttaaggagaaggttttatcagtt
ttagatttttctactcctggtagaactgctgctgctgtagcttttcttacttttatattggataaatggatccgccaaac
tcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
tcttagattactggccagtgcagcctctgggagtagcagggatactgagacacccaccgaccatgccagcggttctgcag
gaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtag
>gnl|bcl2dbcds|Q5EY83_E1B19K-02 E1B19K gene OS=[Viruses] Human adenovirus B serotype 7 GN=E1B19K (length=1479 residues).
atggatccgccaaactcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctc
gcaggatgaggacaatcttagattactggccagtgcagcctctgggagtagcagggatactgagacacccaccgaccatg
ccagcggttctgcaggaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtagctgacctg
tttcctgaactgcgacgggtgcttactaggtctacgaccagtggacagaacaggggaattaagagggagaggaatcctag
tgggaataattcaagaaccgagttggctttaagtttaatgagccgcaggcgtcctgaaactgtttggtggcatgaggttc
agagcgaaggcagggatgaagtttcaatattgcaggagaaatattcactagaacaacttaagacctgttggttggaacct
gaggatgattgggaggtggccattaggaattatgctaagatatctctgaggcctgataaacaatatagaattactaagaa
gattaatattagaaatgcatgctacatatcagggaatggggcagaggttataatagatacacaagataaagcagctttta
gatgttgtatgatgggtatgtggccaggggttgtcggcatggaagcaataacacttatgaatattaggtttagaggggat
gggtataatggcattgtatttatggctaacactaagctgattctacatggttgtagcttttttgggtttaataatacgtg
tgtagaagcttgggggcaagttagtgtgaggggttgtagtttttatgcatgctggattgcaacatcaggtagggtgaaga
gtcagttgtctgtgaagaaatgcatgtttgagagatgtaatcttggcatactgaatgaaggtgaagcaagggtccgccac
tgcgcagctacagaaactgcctgcttcattctaataaagggaaatgccagtgtgaagcataatatgatctgtggacattc
ggatgagaggccttatcagatgctaacctgcgctggtggacattgcaatattcttgctaccgtgcatatcgtttcacatg
cacgcaagaaatggcctgtatttgaacataatgtgattaccaagtgcaccatgcatataggtggtcgcaggggaatgttt
atgccttaccagtgtaacatgaatcatgtgaaggtaatgttggaaccagatgccttttccagagtgagcgtaacaggaat
ctttgatatgaatattcaactatggaagatcctgagatatgatgacactaaaccaagggtgcgcgcatgcgaatgcggag
gcaagcatgctagattccagccggtgtgcgtggatgtgactgaagacctgaggcccgatcatttggtgcttgcctgcact
ggagcggagttcggttctagtggtgaagaaactgactaa
>gnl|bcl2dbcds|Q5EY83_E1B19K-03 E1B19K gene OS=[Viruses] Human adenovirus B serotype 7 GN=E1B19K (length=243 residues).
atgttggaaccagatgccttttccagagtgagcgtaacaggaatctttgatatgaatattcaactatggaagatcctgag
atatgatgacactaaaccaagggtgcgcgcatgcgaatgcggaggcaagcatgctagattccagccggtgtgcgtggatg
tgactgaagacctgaggcccgatcatttggtgcttgcctgcactggagcggagttcggttctagtggtgaagaaactgac
taa
>gnl|bcl2dbcds|Q6RK98_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus B serotype 7 GN=E1B19K (length=537 residues).
atggaggtttgggctatcttggaagacctcagacagactaggctactgctagaaaacgcctcggacggagtctctggcct
ttggagattctggttcggtggtgatctagctaggctagtgtttaggataaaacaggactacagcgtagaatttgaaaagt
tattggacgacagtccaggactttttgaagctcttaacttgggtcatcaggctcattttaaggagaaggttttatcagtt
ttagatttttctactcctggtagaactgctgctgctgtagcttttcttacttttatattggataaatggatccgccaaac
tcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
tcttagattactggccagtgcagcctctaggagtagcagggatactgagacacccaccgaccatgccagcggttctgcag
gaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtag
>gnl|bcl2dbcds|Q6RK98_E1B19K-02 E1B19K gene OS=[Viruses] Human adenovirus B serotype 7 GN=E1B19K (length=1479 residues).
atggatccgccaaactcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctc
gcaggatgaggacaatcttagattactggccagtgcagcctctaggagtagcagggatactgagacacccaccgaccatg
ccagcggttctgcaggaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtagctgacctg
tttcctgaactgcgacgggtgcttactaggtctacgaccagtggacagaacagaggcattaagagggagaggaatcctag
tgggaataattcaagaaccgagttggctttaagtttaatgagccgcaggcgtcctgaaactgtttggtggcatgaggttc
agagcgaaggcagggatgaagtttcaatattgcaggagaaatattcactagaacaacttaagacctgttggttggaacct
gaggatgattgggaggtggccattaggaattatgctaagatatctctgaggcctgataaacaatatagaattactaagaa
gattaatattagaaatgcatgctacatatcagggaatggggcagaggttataatagatacacaagataaagcagctttta
gatgttgtatgatgggtatgtggccaggggttgtcggcatggaagcagtaacacttatgaatattaggtttagaggggat
gggtataatggcattgtatttatggctaacactaagctgattctacatggttgtagcttttttgggtttaataatacgtg
tgtagaagcttgggggcaagttagtgtgaggggttgtagtttttatgcatgctggattgcaacatcaggtagggtcaaga
gtcagttgtctgtgaagaaatgcatgtttgagagatgtaatcttggcatactgaatgaaggtgaagcaaggatccgccac
tgcgcagctacagaaactggctgcttcattctaataaagggaaatgccagtgtgaagcataatatgatctgtggacattc
ggatgagaggccttatcagatgctgacctgcgctggtggacattgcaatattcttgctactgtgcatatcgtttcacatg
cacgcaagaaatggcctgtatttgaacataatgtgattaccaagtgcaccatgcacataggtggtcgcaggggaatgttt
atgccttaccagtgtaacatgaatcatgtgaaggtaatgttggaaccagatgccttttccagagtgagcttaacaggaat
ctttgatatgaatattcaactatggaagatcctgagatatgatgacactaaaccgagggtgcgcgcatgcgaatgcggag
gcaagcatgctagattccagccggtgtgcgtggatgtgactgaagacctgagacccgatcatttggtgcttgcctgcact
ggagcggagttcggttccagtggtgaagaaactgactaa
>gnl|bcl2dbcds|Q6RK98_E1B19K-03 E1B19K gene OS=[Viruses] Human adenovirus B serotype 7 GN=E1B19K (length=417 residues).
atgagtggaagcgcttcttttgaggggggagtatttagcccttatctgacgggcaggctcccaccatgggcaggagttcg
tcagaatgtcatgggatccactgtggatgggagacccgtccagcccgccaattcctcaacgctgacctatgccactttga
gttcgtcaccattggatgcagctgcagccgccgccgctactgctgccgccaacactatccttggaatgggctattacgga
agcatcgttgccaattccagttcctctaataacccttcaaccctggctgaggacaagctacttgttctgttggctcagct
cgaggccttaacccaacgcttaggcgaactgtctaagcaggtggcccagttgcgtgagcaaactgagtctgctgttgcta
cagcaaagtctaaataa
© 1998-2022Legal notice