Dataset for CDS BAD of organism Salmo trutta

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A674DKC6_BAD-01      tccctctcctctctctctctgcctctcctcctttccctctcctctctctc
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
                                                                         

A0A674DKC6_BAD-01      cctctcctctctctctccctctcctctctcccccctcctctccctctcct
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
                                                                         

A0A674DKC6_BAD-01      ctctcctctctcgccctctccgccttcctctgcctctctctctctctgcc
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
                                                                         

A0A674DKC6_BAD-01      tctccctcctcctctcctctcctctgcctctctccctcctcgctctcttg
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
                                                                         

A0A674DKC6_BAD-01      cctctcgctctcctctctctcctctcctctctctcctccctctcctctct
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
                                                                         

A0A674DKC6_BAD-01      ctctctctctgcctctcctccttccctctcctctctctcccctctcctct
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
                                                                         

A0A674DKC6_BAD-01      ctctctctccctctcctctccctctcctctctctctccctctcctctctc
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
                                                                         

A0A674DKC6_BAD-01      tctcctctcccctctcctcctctcttctctctctctctgcctctcctcct
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
                                                                         

A0A674DKC6_BAD-01      ttccctctcctctctctccccctctcctctctctctccctctcctctccc
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
                                                                         

A0A674DKC6_BAD-01      tctcctctctctcctccctctcctctctctctccctctcctctctctctc
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
                                                                         

A0A674DKC6_BAD-01      cctctcctctctctctccctctcctctctctgcctctcctcctttccctc
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
                                                                         

A0A674DKC6_BAD-01      tccctctctctctccctctcctctctctctttctctgcctcttttctctc
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
                                                                         

A0A674DKC6_BAD-01      tctttgcctcttttctctctctctgcctcacctcctgtctctctctctct
A0A673ZHY7_BAD-01      ----------------------atggaccac-------------------
A0A674AVP9_BAD-01      ----------------------atggaccac-------------------
                                              **   ***                   

A0A674DKC6_BAD-01      ctcctcacgtctctttcccccctttccgctctctatctcgctcccctctc
A0A673ZHY7_BAD-01      --------------------------------------------------
A0A674AVP9_BAD-01      --------------------------------------------------
                                                                         

A0A674DKC6_BAD-01      tctccacccctcttcccctccatctcactgctttcttgtttcccctcctc
A0A673ZHY7_BAD-01      -------------------acacatgattg--------------------
A0A674AVP9_BAD-01      -------------------acacatgattg--------------------
                                           **  * * **                    

A0A674DKC6_BAD-01      acttcctcttcctctgtagatgtcagcatggctcagatgtttactatatc
A0A673ZHY7_BAD-01      --------------tgtggatgacaacccagaaaccatgaatg------a
A0A674AVP9_BAD-01      --------------tgtggatg----------------------------
                                     *** ****                            

A0A674DKC6_BAD-01      agacagtgagtcagagccctcagaggaggtaggagaaaccgaaaaggacc
A0A673ZHY7_BAD-01      acaagatgagtctgaccactcag----------------------gaacc
A0A674AVP9_BAD-01      --aatgtgagtctgatcactcag----------------------gaacc
                         *   ****** ** * *****                      * ***

A0A674DKC6_BAD-01      aatcgtctgccggaaaggggatgactggcggtccaataggccacaccctc
A0A673ZHY7_BAD-01      acacactacccaga---------atttcagctccattatgtctccactag
A0A674AVP9_BAD-01      acacacaactcaga---------atttcagctcc---atgtctcaactac
                       *  *      * **         * *   * ***   * * * *  *   

A0A674DKC6_BAD-01      actgtgcctgagatga-gactggcaggagagggtcggttgaggatgaact
A0A673ZHY7_BAD-01      gacgagcatcagaccacgac---caggtgag---cgagtccggctctact
A0A674AVP9_BAD-01      aatgagcaacagaccaagac---caggtgag---cgagtccggctctact
                          * **   ***  * ***   **** ***   **  *  ** *  ***

A0A674DKC6_BAD-01      cagagtcccagg------cccag---------------------gagctc
A0A673ZHY7_BAD-01      ccgagtcccaggtgtgctcccaggttggcagaagggaagacacagagttt
A0A674AVP9_BAD-01      cagagtcccaggtgtgctcccaggttggcaaaagggaagacacagagttt
                       * **********      *****                     *** * 

A0A674DKC6_BAD-01      cagggtaggggg---ccaggggtggaaggcgtgcccacagacggagcatc
A0A673ZHY7_BAD-01      caggatgtgatgactcctactgaggagggcggtggc---gatggggctcc
A0A674AVP9_BAD-01      caggatgtgatgactcctactgaggagggtgggggt---gatggggcttc
                       **** *  *  *   **    * *** ** *        ** ** **  *

A0A674DKC6_BAD-01      tttccggggtcgctcccagtcggccccccctgccctctgggcagccaaga
A0A673ZHY7_BAD-01      tttccgaagccgatcacagtctgctcctccgacactgtgggctgcaaaga
A0A674AVP9_BAD-01      attccgaggccgatcacagtctgctcctcctgcactgtgggctgcaaaga
                        *****  * ** ** ***** ** ** **  * ** ***** ** ****

A0A674DKC6_BAD-01      gatatgggcggcagctccgacgcatgagtgatgagtttgatacgtggctg
A0A673ZHY7_BAD-01      aatatggccgccagctgaggaggatgagtgatgaatttgacacctggctc
A0A674AVP9_BAD-01      aatatggctgccagctgaggaggatgagtgatgaatttgacacctggctc
                        ******  * *****  *  * *********** ***** ** ***** 

A0A674DKC6_BAD-01      gataaaggggagatgaggcgggtgaagagtgcgggagcagccaaacagat
A0A673ZHY7_BAD-01      gacaaaggggaacccaagagagggataagcccaggaggggtcaagcagg-
A0A674AVP9_BAD-01      gacaaaggggtgcccaagagagggattattccaagaggaggcaagcaga-
                       ** *******     * * * * **  *   *  ***  * *** ***  

A0A674DKC6_BAD-01      gaccaagtccccc--agctggtgggcctacctgttcagtcataaggagac
A0A673ZHY7_BAD-01      ----aggtctcccgaggatggttctctttcctctggagtccaaaaaaggc
A0A674AVP9_BAD-01      ----aagtctcccgaggatggttctctttcctctggagtccaaaggaggc
                           * *** ***   * ****   * * *** *  ****  **  ** *

A0A674DKC6_BAD-01      ag-agacagaacatacccctaccatcccaccacgatcatctgagtag
A0A673ZHY7_BAD-01      tgaaggcagg-------------------------------gagtga
A0A674AVP9_BAD-01      ggaaggcagg-------------------------------gagtga
                        * ** ***                                ****  

© 1998-2020Legal notice