Dataset for CDS BAD of organism Salmo trutta

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A673ZHY7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Salmo trutta GN=BAD (length=471 residues).
atggaccacacacatgattgtgtggatgacaacccagaaaccatgaatgaacaagatgagtctgaccactcaggaaccac
acactacccagaatttcagctccattatgtctccactaggacgagcatcagaccacgaccaggtgagcgagtccggctct
actccgagtcccaggtgtgctcccaggttggcagaagggaagacacagagtttcaggatgtgatgactcctactgaggag
ggcggtggcgatggggctcctttccgaagccgatcacagtctgctcctccgacactgtgggctgcaaagaaatatggccg
ccagctgaggaggatgagtgatgaatttgacacctggctcgacaaaggggaacccaagagagggataagcccaggagggg
tcaagcaggaggtctcccgaggatggttctctttcctctggagtccaaaaaaggctgaaggcagggagtga
>gnl|bcl2dbcds|A0A674AVP9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Salmo trutta GN=BAD (length=444 residues).
atggaccacacacatgattgtgtggatgaatgtgagtctgatcactcaggaaccacacacaactcagaatttcagctcca
tgtctcaactacaatgagcaacagaccaagaccaggtgagcgagtccggctctactcagagtcccaggtgtgctcccagg
ttggcaaaagggaagacacagagtttcaggatgtgatgactcctactgaggagggtgggggtgatggggcttcattccga
ggccgatcacagtctgctcctcctgcactgtgggctgcaaagaaatatggctgccagctgaggaggatgagtgatgaatt
tgacacctggctcgacaaaggggtgcccaagagagggattattccaagaggaggcaagcagaaagtctcccgaggatggt
tctctttcctctggagtccaaaggaggcggaaggcagggagtga
>gnl|bcl2dbcds|A0A674DKC6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Salmo trutta GN=BAD (length=1263 residues).
tccctctcctctctctctctgcctctcctcctttccctctcctctctctccctctcctctctctctccctctcctctctc
ccccctcctctccctctcctctctcctctctcgccctctccgccttcctctgcctctctctctctctgcctctccctcct
cctctcctctcctctgcctctctccctcctcgctctcttgcctctcgctctcctctctctcctctcctctctctcctccc
tctcctctctctctctctctgcctctcctccttccctctcctctctctcccctctcctctctctctctccctctcctctc
cctctcctctctctctccctctcctctctctctcctctcccctctcctcctctcttctctctctctctgcctctcctcct
ttccctctcctctctctccccctctcctctctctctccctctcctctccctctcctctctctcctccctctcctctctct
ctccctctcctctctctctccctctcctctctctctccctctcctctctctgcctctcctcctttccctctccctctctc
tctccctctcctctctctctttctctgcctcttttctctctctttgcctcttttctctctctctgcctcacctcctgtct
ctctctctctctcctcacgtctctttcccccctttccgctctctatctcgctcccctctctctccacccctcttcccctc
catctcactgctttcttgtttcccctcctcacttcctcttcctctgtagatgtcagcatggctcagatgtttactatatc
agacagtgagtcagagccctcagaggaggtaggagaaaccgaaaaggaccaatcgtctgccggaaaggggatgactggcg
gtccaataggccacaccctcactgtgcctgagatgagactggcaggagagggtcggttgaggatgaactcagagtcccag
gcccaggagctccagggtagggggccaggggtggaaggcgtgcccacagacggagcatctttccggggtcgctcccagtc
ggccccccctgccctctgggcagccaagagatatgggcggcagctccgacgcatgagtgatgagtttgatacgtggctgg
ataaaggggagatgaggcgggtgaagagtgcgggagcagccaaacagatgaccaagtcccccagctggtgggcctacctg
ttcagtcataaggagacagagacagaacatacccctaccatcccaccacgatcatctgagtag
© 1998-2020Legal notice