Dataset for CDS adenoviridae of organism Human adenovirus sp

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A1Y1BYF1_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus sp GN=E1B19K (length=549 residues).
atggatgtgtggactatccttgcagactttagcaagacacgccggcttgtagaggatagttcagacgggtgctccgggtt
ctggagacactggtttggaactcctctatctcgactggtgtacacagttaagaaggattataacgaggaatttgaaaatc
tttttgctgattgctctggcctgctagattctctgaatctcggccaccagtcccttttccaggaaagggtactccacagc
cttgatttttccagcccagggcgcactacagccggggttgcttttgtggtttttctggttgacaaatggagccagaacac
ccaactgagcaggggctacattctggacttcgcagccatgcacctgtggagggcatgggtgaggcagcggggacagagaa
tcttgaactactggcttatacagccagcagctccgggtcttcttcgtctacacagacaaacatccatgttggaggaagaa
atgaggcaggccatggacgagaacccgaggagcggcctggaccctccgtcggaagaggagctgaattga
>gnl|bcl2dbcds|A0A513TZR1_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus sp GN=E1B19K (length=546 residues).
atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctctaacagtacctcttggtt
ttggaggtttctgtggggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaatttgaagagc
ttttgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcgcttttccaagagaaggtcatcaagact
ttggatttttccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaaggataaatggagcgaagaaac
ccatctgagcggggggtacctgctggattttctggccatgcatttgtggagagcggtggtgagacacaagaatcgcatgc
tactgttgtcttccgtccgcccggcaataataccgacggaggagcagcagcagcagcagcagcagcagcaggaggaagcc
aggcggcggcggcggcaggagcagagcccatggaacccgagagccggcctggaccctcgggaatga
>gnl|bcl2dbcds|A0A516UYI9_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus sp GN=E1B19K (length=528 residues).
atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctctaacagtacctcttggtt
ttggaggtttctgtggggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaatttgaagagc
ttttgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcgcttttccaagagaaggtcatcaagact
ttggatttttccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaaggataaatggagcgaagaaac
ccatctgagcggggggtacctgctggattttctggccatgcatctgtggagagcggtggtgagacacaagaatcgcctgc
tactgttgtcttccgtccgcccggcaataataccgacggaggagcaacagcaggaggaagccaggcggcggcggcggcag
gagcagagcccatggaacccgagagccggcctggaccctcgggaatga
>gnl|bcl2dbcds|A0A516UYM9_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus sp GN=E1B19K (length=546 residues).
atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctctaacagtacctcttggtt
ttggaggtttctgtggggctcctcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaatttgaagagc
ttttgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcgcttttccaagagaaggtcatcaagact
ttggatttttccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaaggataaatggagcgaagaaac
ccatctgagcggggggtacctgctggattttctggccatgcatctgtggagagcggtggtgagacacaagaatcgcctgc
tactgttgtcttccgtccgcccggcaataataccgacggaagagcagcagcagcagcagcagcagcagcaggaggaagcc
aggcggcggcggcggcaggagcagagcccatggaacccgagagccggcctggaccctcgggaatga
>gnl|bcl2dbcds|A0A5P8KYF0_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus sp GN=E1B19K (length=537 residues).
atggaggtttgggctatcttggaagacctcagacagactaggctactgctagaaaacgcctcggacggagtctctggcct
ttggagattctggttcggtggtgatctagctaggctagtgtttaggataaaacaggactacagcgtagaatttgaaaagt
tattggacgacagtccaggactttttgaagctcttaacttgggtcatcaggctcattttaaggagaaggttttatcagtt
ttagatttttctactcctggtagaactgctgctgctgtagcttttcttacttttatattggataaatggatccgccaaac
tcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctcgcaggatgaggacaa
tcttaaattactggccagtgcagcctctaggagtagcagggatactgagacacccaccgaccatgccagcggttctgcag
gaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtag
>gnl|bcl2dbcds|A0A5P8KYF0_E1B19K-02 E1B19K gene OS=[Viruses] Human adenovirus sp GN=E1B19K (length=1479 residues).
atggatccgccaaactcacttcagcaagggatacgttttggatttcatagcagcagctttgtggagaacatggaaggctc
gcaggatgaggacaatcttaaattactggccagtgcagcctctaggagtagcagggatactgagacacccaccgaccatg
ccagcggttctgcaggaggagcagcaggaggacaatccgagagccggcctggaccctccggtggaggagtagctgacctg
tttcctgaactgcgacgggtgcttactaggtctacgaccagtggacagaacagaggcattaagagggagaggaatcctag
tgggaataattcaagaaccgagttggctttaagtttaatgagccgcaggcgtcctgaaactgtttggtggcatgaggttc
agagcgaaggcagggatgaagtttcaatattgcaggagaaatattcactagaacaacttaagacctgttggttggaacct
gaggatgattgggaggtggccattaggaattatgctaagatatctctgaggcctgataaacaatatagaattactaagaa
gattaatattagaaatgcatgctacatatcagggaatggggcagaggttataatagatacacaagataaagcagctttta
gatgttgtatgatgggtatgtggccaggggttgtcggcatggaagcagtaacacttatgaatattaggtttagaggggat
gggtataatggcattgtatttatggctaacactaagctgattctacatggttgtagcttttttgggtttaataatacgtg
tgtagaagcttgggggcaagttagtgtgaggggttgtagtttttatgcatgctggattgcaacatcaggtagggtcaaga
gtcagttgtctgtgaagaaatgcatgtttgagagatgtaatcttggcatactgaatgaaggtgaagcaaggatccgccac
tgcgcagctacagaaactggctgcttcattctaataaagggaaatgccagtgtgaagcataatatgatctgtggacattc
ggatgagaggccttatcagatgctgacctgcgctggtggacattgcaatattcttgctactgtgcatatcgtttcacatg
cacgcaagaaatggcctgtatttgaacataatgtgattaccaagtgcaccatgcacataggtggtcgcaggggaatgttt
atgccttaccagtgtaacatgaatcatgtgaaggtaatgttggaaccagatgccttttccagagtgagcttaacaggaat
ctttgatatgaatattcaactatggaagatcctgagatatgatgacactaaaccgagggtgcgcgcatgcgaatgcggag
gcaagcatgctagattccagccggtgtgcgtggatgtgactgaagacctgagacccgatcatttggtgcttgcctgcact
ggagcggagttcggttccagtggtgaagaaactgactaa
© 1998-2022Legal notice