Dataset for CDS adenoviridae of organism Human adenovirus sp

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A1Y1BYF1_E1B19K-      atgga-----------------------------tgtgtggact------
A0A513TZR1_E1B19K-      atgga-----------------------------ggcttgggag------
A0A516UYI9_E1B19K-      atgga-----------------------------ggcttgggag------
A0A516UYM9_E1B19K-      atgga-----------------------------ggcttgggag------
A0A7U3S1T6_E1B19K-      atgga-----------------------------ggtttgggcc------
A0A7U3S224_E1B19K-      atgga-----------------------------ggtttgggcc------
A0A5P8KYF0_E1B19K-      atgga-----------------------------ggtttgggct------
A0A5P8KYF0_E1B19K-      atggatccgccaaactcacttcagcaagggatacgttttggatttcatag
                        *****                                 ***         

A0A1Y1BYF1_E1B19K-      ----------------atccttgcagac----------------------
A0A513TZR1_E1B19K-      ----------------tgtttggaagat----------------------
A0A516UYI9_E1B19K-      ----------------tgtttggaagat----------------------
A0A516UYM9_E1B19K-      ----------------tgtttggaagat----------------------
A0A7U3S1T6_E1B19K-      ----------------attttggaagac----------------------
A0A7U3S224_E1B19K-      ----------------attttggaagac----------------------
A0A5P8KYF0_E1B19K-      ----------------atcttggaagac----------------------
A0A5P8KYF0_E1B19K-      cagcagctttgtggagaacatggaaggctcgcaggatgaggacaatctta
                                            * * **                        

A0A1Y1BYF1_E1B19K-      ---------------------------------------tttagcaa---
A0A513TZR1_E1B19K-      ------------------------------------------------tt
A0A516UYI9_E1B19K-      ------------------------------------------------tt
A0A516UYM9_E1B19K-      ------------------------------------------------tt
A0A7U3S1T6_E1B19K-      ---------------------------------------cttagaaa---
A0A7U3S224_E1B19K-      ---------------------------------------cttagaaa---
A0A5P8KYF0_E1B19K-      ---------------------------------------ctcagaca---
A0A5P8KYF0_E1B19K-      aattactggccagtgcagcctctaggagtagcagggatactgagacaccc

A0A1Y1BYF1_E1B19K-      ---gacacgccgg------cttgtagagga--------------------
A0A513TZR1_E1B19K-      ttctgctgtgcgt---aacttgctggaaca--------------------
A0A516UYI9_E1B19K-      ttctgctgtgcgt---aacttgctggaaca--------------------
A0A516UYM9_E1B19K-      ttctgctgtgcgt---aacttgctggaaca--------------------
A0A7U3S1T6_E1B19K-      ---gactaggcaa------ctgttagagaa--------------------
A0A7U3S224_E1B19K-      ---gactaggcaa------ctgttagagaa--------------------
A0A5P8KYF0_E1B19K-      ---gactaggcta------ctgctagaaaa--------------------
A0A5P8KYF0_E1B19K-      accgaccatgccagcggttctgcaggaggagcagcaggaggacaatccga
                             *    *         *    **  *                    

A0A1Y1BYF1_E1B19K-      ----tagttcagac-----------gggtgctccgggttct---------
A0A513TZR1_E1B19K-      ----gagctctaac-----------agtacctcttggtttt---------
A0A516UYI9_E1B19K-      ----gagctctaac-----------agtacctcttggtttt---------
A0A516UYM9_E1B19K-      ----gagctctaac-----------agtacctcttggtttt---------
A0A7U3S1T6_E1B19K-      ----cgcttcggac-----------ggagtctccggttttt---------
A0A7U3S224_E1B19K-      ----cgcttcggac-----------ggagtctccggttttt---------
A0A5P8KYF0_E1B19K-      ----cgcctcggac-----------ggagtctctggccttt---------
A0A5P8KYF0_E1B19K-      gagccggcctggaccctccggtggaggagtagctgacctgtttcctgaac
                                    **            *     *     * *         

A0A1Y1BYF1_E1B19K-      --------------------------------------------------
A0A513TZR1_E1B19K-      --------------------------------------------------
A0A516UYI9_E1B19K-      --------------------------------------------------
A0A516UYM9_E1B19K-      --------------------------------------------------
A0A7U3S1T6_E1B19K-      --------------------------------------------------
A0A7U3S224_E1B19K-      --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
A0A5P8KYF0_E1B19K-      tgcgacgggtgcttactaggtctacgaccagtggacagaacagaggcatt

A0A1Y1BYF1_E1B19K-      -----ggaga----------------------------------------
A0A513TZR1_E1B19K-      -----ggagg----------------------------------------
A0A516UYI9_E1B19K-      -----ggagg----------------------------------------
A0A516UYM9_E1B19K-      -----ggagg----------------------------------------
A0A7U3S1T6_E1B19K-      -----ggaga----------------------------------------
A0A7U3S224_E1B19K-      -----ggaga----------------------------------------
A0A5P8KYF0_E1B19K-      -----ggaga----------------------------------------
A0A5P8KYF0_E1B19K-      aagagggagaggaatcctagtgggaataattcaagaaccgagttggcttt

A0A1Y1BYF1_E1B19K-      ---------------------cactg-----gtttggaact----cctct
A0A513TZR1_E1B19K-      -------------------------------tttctgtggg----gctcc
A0A516UYI9_E1B19K-      -------------------------------tttctgtggg----gctcc
A0A516UYM9_E1B19K-      -------------------------------tttctgtggg----gctcc
A0A7U3S1T6_E1B19K-      ---------------------ttctg-----gttcgctagt----gaaat
A0A7U3S224_E1B19K-      ---------------------ttctg-----gttcgctagt----gaatt
A0A5P8KYF0_E1B19K-      ---------------------ttctg-----gttcggtggt----gatct
A0A5P8KYF0_E1B19K-      aagtttaatgagccgcaggcgtcctgaaactgtttggtggcatgaggttc

A0A1Y1BYF1_E1B19K-      a--------tctcgactggtgtac---------acag-----------tt
A0A513TZR1_E1B19K-      t---cccaggcaaagttagtctgc---------agaa-----------tt
A0A516UYI9_E1B19K-      t---cccaggcaaagttagtctgc---------agaa-----------tt
A0A516UYM9_E1B19K-      t---cccaggcaaagttagtctgc---------agaa-----------tt
A0A7U3S1T6_E1B19K-      a--------gctagggtagttttt---------agga-----------ta
A0A7U3S224_E1B19K-      a--------gctagggtagttttt---------agga-----------ta
A0A5P8KYF0_E1B19K-      a--------gctaggctagtgttt---------agga-----------ta
A0A5P8KYF0_E1B19K-      agagcgaaggcagggatgaagtttcaatattgcaggagaaatattcacta
                                  *     *    *           *              * 

A0A1Y1BYF1_E1B19K-      aaga------aggattataacgaggaatttgaaaatctttttgctgattg
A0A513TZR1_E1B19K-      aagg------aggattacaagtgggaatttgaagagcttttgaaatcctg
A0A516UYI9_E1B19K-      aagg------aggattacaagtgggaatttgaagagcttttgaaatcctg
A0A516UYM9_E1B19K-      aagg------aggattacaagtgggaatttgaagagcttttgaaatcctg
A0A7U3S1T6_E1B19K-      aaac------aggactataaagaagaatttgaaaagttgttggtagattg
A0A7U3S224_E1B19K-      aaac------aggactataaagaagaatttgaaaagttgttggtagattg
A0A5P8KYF0_E1B19K-      aaac------aggactacagcgtagaatttgaaaagttattggacgacag
A0A5P8KYF0_E1B19K-      gaacaacttaagacctgttggttggaacctgagga-tgattgggaggtgg
                         *        **   *        ***  ***  *    **        *

A0A1Y1BYF1_E1B19K-      ct--ctggcctg-------------ctagattctc---------------
A0A513TZR1_E1B19K-      tg--gtgagctg-------------tttgattctt---------------
A0A516UYI9_E1B19K-      tg--gtgagctg-------------tttgattctt---------------
A0A516UYM9_E1B19K-      tg--gtgagctg-------------tttgattctt---------------
A0A7U3S1T6_E1B19K-      cc--caggactt-------------tttgaagctc---------------
A0A7U3S224_E1B19K-      cc--caggactt-------------tttgaagctc---------------
A0A5P8KYF0_E1B19K-      tc--caggactt-------------tttgaagctc---------------
A0A5P8KYF0_E1B19K-      ccattaggaattatgctaagatatctctgaggcctgataaacaatataga
                              *   *                 **  *                 

A0A1Y1BYF1_E1B19K-      -------------tgaatctcggccac-cagtcc-cttttccagga----
A0A513TZR1_E1B19K-      -------------tgaatctgggtcac-caggcg-cttttccaaga----
A0A516UYI9_E1B19K-      -------------tgaatctgggtcac-caggcg-cttttccaaga----
A0A516UYM9_E1B19K-      -------------tgaatctgggtcac-caggcg-cttttccaaga----
A0A7U3S1T6_E1B19K-      -------------ttaatttgggtcat-caagtt-cactttaaaga----
A0A7U3S224_E1B19K-      -------------ttaatttgggtcat-caagtt-cactttaaaga----
A0A5P8KYF0_E1B19K-      -------------ttaacttgggtcat-caggct-cattttaagga----
A0A5P8KYF0_E1B19K-      attactaagaagattaatattagaaatgcatgctacatatcagggaatgg
                                     * **  *  *  *  **     *   *    **    

A0A1Y1BYF1_E1B19K-      ---aaggg------------------------------------------
A0A513TZR1_E1B19K-      ---gaagg------------------------------------------
A0A516UYI9_E1B19K-      ---gaagg------------------------------------------
A0A516UYM9_E1B19K-      ---gaagg------------------------------------------
A0A7U3S1T6_E1B19K-      ---aaaagtt----------------------------------------
A0A7U3S224_E1B19K-      ---aaaagtt----------------------------------------
A0A5P8KYF0_E1B19K-      ---gaaggtt----------------------------------------
A0A5P8KYF0_E1B19K-      ggcagaggttataatagatacacaagataaagcagcttttagatgttgta

A0A1Y1BYF1_E1B19K-      ---------------------------------------------tactc
A0A513TZR1_E1B19K-      ---------------------------------------------tcatc
A0A516UYI9_E1B19K-      ---------------------------------------------tcatc
A0A516UYM9_E1B19K-      ---------------------------------------------tcatc
A0A7U3S1T6_E1B19K-      ---------------------------------------------ttatc
A0A7U3S224_E1B19K-      ---------------------------------------------ttatc
A0A5P8KYF0_E1B19K-      ---------------------------------------------ttatc
A0A5P8KYF0_E1B19K-      tgatgggtatgtggccaggggttgtcggcatggaagcagtaacacttatg
                                                                     *  * 

A0A1Y1BYF1_E1B19K-      cacagccttgattt----------------------ttccagcccagg-g
A0A513TZR1_E1B19K-      aagactttggattt----------------------ttccacaccggg-g
A0A516UYI9_E1B19K-      aagactttggattt----------------------ttccacaccggg-g
A0A516UYM9_E1B19K-      aagactttggattt----------------------ttccacaccggg-g
A0A7U3S1T6_E1B19K-      a--gttttagactt----------------------ttcgaccccagg-t
A0A7U3S224_E1B19K-      a--gttttagactt----------------------ttcgaccccagg-t
A0A5P8KYF0_E1B19K-      a--gttttagattt----------------------ttctactcctgg-t
A0A5P8KYF0_E1B19K-      a--atattaggtttagaggggatgggtataatggcattgtatttatggct
                               * *  **                      **  *     **  

A0A1Y1BYF1_E1B19K-      cgcact--acagcc--------ggggttgcttttgt--------------
A0A513TZR1_E1B19K-      cgcgct--gcggct--------gctgttgctttttt--------------
A0A516UYI9_E1B19K-      cgcgct--gcggct--------gctgttgctttttt--------------
A0A516UYM9_E1B19K-      cgcgct--gcggct--------gctgttgctttttt--------------
A0A7U3S1T6_E1B19K-      agaact--gctgct--------gctgtggcttttct--------------
A0A7U3S224_E1B19K-      agaact--gctgct--------gctgtggcttttct--------------
A0A5P8KYF0_E1B19K-      agaact--gctgct--------gctgtagcttttct--------------
A0A5P8KYF0_E1B19K-      aacactaagctgattctacatggttgtagcttttttgggtttaataatac
                            **   * *          *  ** ****** *              

A0A1Y1BYF1_E1B19K-      ---------------------------------------ggttttt----
A0A513TZR1_E1B19K-      ---------------------------------------gagtttt----
A0A516UYI9_E1B19K-      ---------------------------------------gagtttt----
A0A516UYM9_E1B19K-      ---------------------------------------gagtttt----
A0A7U3S1T6_E1B19K-      ---------------------------------------tactttt----
A0A7U3S224_E1B19K-      ---------------------------------------tactttt----
A0A5P8KYF0_E1B19K-      ---------------------------------------tactttt----
A0A5P8KYF0_E1B19K-      gtgtgtagaagcttgggggcaagttagtgtgaggggttgtagtttttatg

A0A1Y1BYF1_E1B19K-      --------------------------------------------------
A0A513TZR1_E1B19K-      --------------------------------------------------
A0A516UYI9_E1B19K-      --------------------------------------------------
A0A516UYM9_E1B19K-      --------------------------------------------------
A0A7U3S1T6_E1B19K-      --------------------------------------------------
A0A7U3S224_E1B19K-      --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
A0A5P8KYF0_E1B19K-      catgctggattgcaacatcaggtagggtcaagagtcagttgtctgtgaag

A0A1Y1BYF1_E1B19K-      ------------------------------ctggttgacaaat-------
A0A513TZR1_E1B19K-      ------------------------------ataaaggataaat-------
A0A516UYI9_E1B19K-      ------------------------------ataaaggataaat-------
A0A516UYM9_E1B19K-      ------------------------------ataaaggataaat-------
A0A7U3S1T6_E1B19K-      ------------------------------atattagataaat-------
A0A7U3S224_E1B19K-      ------------------------------atattagataaat-------
A0A5P8KYF0_E1B19K-      ------------------------------atattggataaat-------
A0A5P8KYF0_E1B19K-      aaatgcatgtttgagagatgtaatcttggcatactgaatgaaggtgaagc
                                                       *     *  **        

A0A1Y1BYF1_E1B19K-      --ggagccaga---------------acac--------ccaactgagcag
A0A513TZR1_E1B19K-      --ggagcgaag---------------aaac--------ccatctgagcgg
A0A516UYI9_E1B19K-      --ggagcgaag---------------aaac--------ccatctgagcgg
A0A516UYM9_E1B19K-      --ggagcgaag---------------aaac--------ccatctgagcgg
A0A7U3S1T6_E1B19K-      --ggatcccgc---------------agac--------tcatttcagcag
A0A7U3S224_E1B19K-      --ggatcccgc---------------agac--------tcatttcagcag
A0A5P8KYF0_E1B19K-      --ggatccgcc---------------aaac--------tcacttcagcaa
A0A5P8KYF0_E1B19K-      aaggatccgccactgcgcagctacagaaactggctgcttcattctaataa
                          *** *                   * **         **    *    

A0A1Y1BYF1_E1B19K-      ggg---------------------ctaca--ttctggac-ttcgcagcca
A0A513TZR1_E1B19K-      ggg---------------------gtacc--tgctggat-tttctggcca
A0A516UYI9_E1B19K-      ggg---------------------gtacc--tgctggat-tttctggcca
A0A516UYM9_E1B19K-      ggg---------------------gtacc--tgctggat-tttctggcca
A0A7U3S1T6_E1B19K-      ggg---------------------atacg--ttttggat-ttcgtagcca
A0A7U3S224_E1B19K-      ggg---------------------atacg--ttttggat-ttcgtagcca
A0A5P8KYF0_E1B19K-      ggg---------------------atacg--ttttggat-ttcatagcag
A0A5P8KYF0_E1B19K-      agggaaatgccagtgtgaagcataatatgatctgtggacattcggatgag
                         **                      **       ****  **        

A0A1Y1BYF1_E1B19K-      tgcacctg------------------tggagggcatgggtg---------
A0A513TZR1_E1B19K-      tgcatttg------------------tggagagcggtggtg---------
A0A516UYI9_E1B19K-      tgcatctg------------------tggagagcggtggtg---------
A0A516UYM9_E1B19K-      tgcatctg------------------tggagagcggtggtg---------
A0A7U3S1T6_E1B19K-      cagcattg------------------tggagaacatggaag---------
A0A7U3S224_E1B19K-      cagcattg------------------tggagaacatggaag---------
A0A5P8KYF0_E1B19K-      cagctttg------------------tggagaacatggaag---------
A0A5P8KYF0_E1B19K-      aggccttatcagatgctgacctgcgctggtggacattgcaatattcttgc
                              *                   *** *  *   *            

A0A1Y1BYF1_E1B19K-      ----------------------aggcagcggg-------------gacag
A0A513TZR1_E1B19K-      ----------------------agacacaaga------------------
A0A516UYI9_E1B19K-      ----------------------agacacaaga------------------
A0A516UYM9_E1B19K-      ----------------------agacacaaga------------------
A0A7U3S1T6_E1B19K-      ----------------------gttcgcaaga-------------tgagg
A0A7U3S224_E1B19K-      ----------------------gttcgcaaga-------------tgagg
A0A5P8KYF0_E1B19K-      ----------------------gctcgcagga-------------tgagg
A0A5P8KYF0_E1B19K-      tactgtgcatatcgtttcacatgcacgcaagaaatggcctgtatttgaac
                                                 *    *                   

A0A1Y1BYF1_E1B19K-      agaatcttgaacta------------------------------------
A0A513TZR1_E1B19K-      ----------atcg------------------------------------
A0A516UYI9_E1B19K-      ----------atcg------------------------------------
A0A516UYM9_E1B19K-      ----------atcg------------------------------------
A0A7U3S1T6_E1B19K-      acaatcttaggtta------------------------------------
A0A7U3S224_E1B19K-      acaatcttaggtta------------------------------------
A0A5P8KYF0_E1B19K-      acaatcttaaatta------------------------------------
A0A5P8KYF0_E1B19K-      ataatgt--gattaccaagtgcaccatgcacataggtggtcgcaggggaa

A0A1Y1BYF1_E1B19K-      ---------ctggcttatacagccagcag---------------------
A0A513TZR1_E1B19K-      ---------catgctactgttgt---------------------------
A0A516UYI9_E1B19K-      ---------cctgctactgttgt---------------------------
A0A516UYM9_E1B19K-      ---------cctgctactgttgt---------------------------
A0A7U3S1T6_E1B19K-      ---------ctggccagtgcagc---------------------------
A0A7U3S224_E1B19K-      ---------ctggccagtgcagc---------------------------
A0A5P8KYF0_E1B19K-      ---------ctggccagtgcagc---------------------------
A0A5P8KYF0_E1B19K-      tgtttatgccttaccagtgtaacatgaatcatgtgaaggtaatgttggaa
                                 *   *   *                                

A0A1Y1BYF1_E1B19K-      -----------ctccgggtcttcttcgtc---------------------
A0A513TZR1_E1B19K-      -----------cttccg--tccgcccggcaat------------------
A0A516UYI9_E1B19K-      -----------cttccg--tccgcccggcaat------------------
A0A516UYM9_E1B19K-      -----------cttccg--tccgcccggcaat------------------
A0A7U3S1T6_E1B19K-      -----------ctttgg---gtg--tagcggg------------------
A0A7U3S224_E1B19K-      -----------ctttgg---gtg--tagcggg------------------
A0A5P8KYF0_E1B19K-      -----------ctctag---gag--tagcagg------------------
A0A5P8KYF0_E1B19K-      ccagatgccttttccagagtgagcttaacaggaatctttgatatgaatat
                                    *   *           *                     

A0A1Y1BYF1_E1B19K-      ------------tacacagacaaa-----------------------cat
A0A513TZR1_E1B19K-      ------------aataccgacgga----ggagcagcagcagcagcagcag
A0A516UYI9_E1B19K-      ------------aataccgacgga----gg------------------ag
A0A516UYM9_E1B19K-      ------------aataccgacgga----agagcagcagcagcagcagcag
A0A7U3S1T6_E1B19K-      ------------aatcctgaggca---------tccaccggtcatgccag
A0A7U3S224_E1B19K-      ------------aatcctgaggca---------tccaccggtcatgccag
A0A5P8KYF0_E1B19K-      ------------gatactgagaca---------cccaccgaccatgccag
A0A5P8KYF0_E1B19K-      tcaactatggaagatcctgagatatgatgacactaaaccgagggtgc--g
                                     *  * **   *                          

A0A1Y1BYF1_E1B19K-      ccatgttggaggaagaaatgaggc----------aggccatgg-------
A0A513TZR1_E1B19K-      cag--cagcaggaggaagccaggcggcggcgg--cggcaggag------c
A0A516UYI9_E1B19K-      caa--cagcaggaggaagccaggcggcggcgg--cggcaggag------c
A0A516UYM9_E1B19K-      cag--cagcaggaggaagccaggcggcggcgg--cggcaggag------c
A0A7U3S1T6_E1B19K-      cggttctggaggaggaa-----------------cagcaagag-------
A0A7U3S224_E1B19K-      cggttctggaggaggaa-----------------cagcaagag-------
A0A5P8KYF0_E1B19K-      cggttctgcaggaggag-----------------cagcaggag-------
A0A5P8KYF0_E1B19K-      cgcatgcgaatgcggaggcaagcatgctagattccagccggtgtgcgtgg
                        *      * * *  **                    **    *       

A0A1Y1BYF1_E1B19K-      ------acgagaacccgaggagcg--------------gcctggacc---
A0A513TZR1_E1B19K-      agagcccatggaacccgagagccg--------------gcctggacc---
A0A516UYI9_E1B19K-      agagcccatggaacccgagagccg--------------gcctggacc---
A0A516UYM9_E1B19K-      agagcccatggaacccgagagccg--------------gcctggacc---
A0A7U3S1T6_E1B19K-      --------gacaacccgagagccg--------------gcctggacc---
A0A7U3S224_E1B19K-      --------gacaacccgagagccg--------------gcctggacc---
A0A5P8KYF0_E1B19K-      --------gacaatccgagagccg--------------gcctggacc---
A0A5P8KYF0_E1B19K-      atgtgactgaagacctgagacccgatcatttggtgcttgcctgcactgga
                                    * * ***   **              ***** **    

A0A1Y1BYF1_E1B19K-      -----------ctccgtcggaagaggagctgaattga
A0A513TZR1_E1B19K-      -----------ctcggg--------------aatga-
A0A516UYI9_E1B19K-      -----------ctcggg--------------aatga-
A0A516UYM9_E1B19K-      -----------ctcggg--------------aatga-
A0A7U3S1T6_E1B19K-      -----------ctccagtggaggag--gcggagtag-
A0A7U3S224_E1B19K-      -----------ctccagtggaggag--gcggagtag-
A0A5P8KYF0_E1B19K-      -----------ctccggtggaggag--------tag-
A0A5P8KYF0_E1B19K-      gcggagttcggttccagtggtgaagaaactgactaa-
                                    **                   *   

© 1998-2023Legal notice