Dataset for CDS E1B19K of organism Human adenovirus 11 34

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|W6EIX6_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus 11+34 GN=E1B19K (length=543 residues).
atggaggtttgggccattttggaagaccttagaaagactaggcaactgttagaggacgcttcggacggagtctccggttt
ttggagattctggttcgctagtgaattagctagggtagtttttaggataaaacaggactataaagaagaatttgaaaagt
tgttgctagattgcccaggactttttgaagctcttaatttgggtcatcaagttcactttaaagaaaaagttttatcagtt
ttagacttttcaaccccaggtagaactgccgctgctgtggcttttcttacttttatattagataaatggatcccgcagac
tcatttcagcaggggatacgttttggatttcatagccacagcattgtggagaacatggaaggttcgcaagatgaggacaa
tcttaggttactggccagtgcagcctttgggtgtagcgggaatcctgaggcatccaccggtcatgccagcggttctggag
gaggaacagcaagaggacaacccgagagccggcctggaccctccagtggaggaggcggagtag
>gnl|bcl2dbcds|W6EIX6_E1B19K-02 E1B19K gene OS=[Viruses] Human adenovirus 11+34 GN=E1B19K (length=1485 residues).
atggatcccgcagactcatttcagcaggggatacgttttggatttcatagccacagcattgtggagaacatggaaggttc
gcaagatgaggacaatcttaggttactggccagtgcagcctttgggtgtagcgggaatcctgaggcatccaccggtcatg
ccagcggttctggaggaggaacagcaagaggacaacccgagagccggcctggaccctccagtggaggaggcggagtagct
gacttgtctcctgaactgcaacgggtgcttactggatctacgtccactggacgggataggggcgttaagagggagagggc
atgtagtggtactgatgctagatctgagttggctttaagtttaatgagtcgcagacgtcctgaaaccatttggtggcatg
aggtccagaaagagggaagggatgaagtttctgtattgcaggaaaaatattcactggaacaggtgaaaacatgttggttg
gagcctgaggatgattgggaggtggccattaaaaattatgccaagatagctttgaggcctgataaacagtataagattac
tagacggattaatatccggaatgcttgttacatatctggaaatggggctgaggtggtaatagatactccagacaagacag
ttattagatgctgcatgatggatatgtggcctggagtagtcggtatggaagcagtaacttttgtaaatgttaagtttagg
ggagatggttataatggaatagtgtttatggccaataccaaacttatattgcatggttgtagcttttttggtttcaacaa
tacctgtgtagatgcctggggacaggttagtgtacggggatgtagtttctgtgcgtgttggattgccacagctggcagaa
ccaagagtcaattgtctctgaagaaatgcatattccaaagatgtaacctgggcattctgaatgaaggcgaagcaagggtc
cgccactgcgcttctacagatactggatgttttattttaattaagggcaatgccagcgtaaagcataacatgatttgcgg
tgcttccgatgagaggccttatcaaatgctcacttgtgccggtgggcattgtaatatgctggctactgtgcatattgttt
cccatcaacgcaaaaaatggcctgtttttgatcacaatgtgttgacgaagtgtaccatgcatgcaggtgggcgtagagga
atgtttatgccttaccagtgtaacatgaatcatgtgaaagtgttgttggaaccagatgccttttccagaatgagcctaac
aggaatctttgacatgaacatgcaaatctggaagatcctgaggtatgatgatacgagatcgagggtgcgcgcatgcgaat
gcggaggcaagcatgccaggttccagccggtgtgtgtagatgtgactgaagatctgagaccggatcatttggttattgcc
cgcactggagcagagttcggatccagtggagaagaaactgactaa
© 1998-2022Legal notice