Dataset for CDS E1B19K of organism Human adenovirus 11 34

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

W6EIX6_E1B19K-01      atgga-----------------------------ggtttgggc-------
W6EIX6_E1B19K-02      atggatcccgcagactcatttcagcaggggatacgttttggatttcatag
                      *****                             * *****         

W6EIX6_E1B19K-01      ------cattttggaagacc-------ttagaaagactaggcaactgtta
W6EIX6_E1B19K-02      ccacagcattgtggagaacatggaaggttcgcaagatgaggacaatctta
                            **** ****  **        ** * ****  ***  * * ***

W6EIX6_E1B19K-01      gaggacg------------cttcggacggag-----------------tc
W6EIX6_E1B19K-02      ggttactggccagtgcagcctttgggtgtagcgggaatcctgaggcatcc
                      *   **             *** **  * **                  *

W6EIX6_E1B19K-01      tccggt--ttttggagattctgg---------------------------
W6EIX6_E1B19K-02      accggtcatgccagcggttctggaggaggaacagcaagaggacaacccga
                       *****  *    * * ******                           

W6EIX6_E1B19K-01      -------------ttcgctagtgaattagctagggtagtt----------
W6EIX6_E1B19K-02      gagccggcctggaccctccagtggaggaggcggagtagctgacttgtctc
                                     * * **** *  **   * **** *          

W6EIX6_E1B19K-01      --------------------------ttta--------ggataaaacagg
W6EIX6_E1B19K-02      ctgaactgcaacgggtgcttactggatctacgtccactggacgggatagg
                                                * **        ***    * ***

W6EIX6_E1B19K-01      actataaagaagaatttgaaaagt--------tgttgctagatt------
W6EIX6_E1B19K-02      ggcgttaagagggagagggcatgtagtggtactgatgctagatctgagtt
                          * **** * *   *  * **        ** ********       

W6EIX6_E1B19K-01      -----------------gcccaggactttttgaagctcttaatttgg-gt
W6EIX6_E1B19K-02      ggctttaagtttaatgagtcgcagacgtcctgaaacc----atttggtgg
                                       * *   *** *  **** *     ****** * 

W6EIX6_E1B19K-01      catcaagttca--------------------------ctttaaagaaaaa
W6EIX6_E1B19K-02      catgaggtccagaaagagggaagggatgaagtttctgtattgcaggaaaa
                      *** * ** **                            **  ** ****

W6EIX6_E1B19K-01      gtttt---------------------------------------------
W6EIX6_E1B19K-02      atattcactggaacaggtgaaaacatgttggttggagcctgaggatgatt
                       * **                                             

W6EIX6_E1B19K-01      ------------------------------------------------at
W6EIX6_E1B19K-02      gggaggtggccattaaaaattatgccaagatagctttgaggcctgataaa

W6EIX6_E1B19K-01      cagttttaga---------------------------cttttca------
W6EIX6_E1B19K-02      cagtataagattactagacggattaatatccggaatgcttgttacatatc
                      **** * ***                           *** * *      

W6EIX6_E1B19K-01      ----------------------------accccaggtagaactgccgct-
W6EIX6_E1B19K-02      tggaaatggggctgaggtggtaatagatactccagacaagacagttatta
                                                  ** ****  *  ** *    * 

W6EIX6_E1B19K-01      --------------------------------------------gctgtg
W6EIX6_E1B19K-02      gatgctgcatgatggatatgtggcctggagtagtcggtatggaagcagta
                                                                  ** ** 

W6EIX6_E1B19K-01      gcttttcttacttttatatt------agata-----aatggatc------
W6EIX6_E1B19K-02      acttttgtaaatgttaagtttaggggagatggttataatggaatagtgtt
                       ***** * * * ***  **      ****      ******        

W6EIX6_E1B19K-01      -----ccg----cagactca-------------------------tttca
W6EIX6_E1B19K-02      tatggccaataccaaacttatattgcatggttgtagcttttttggtttca
                           **     ** *** *                         *****

W6EIX6_E1B19K-01      gca------------------------------------gggga------
W6EIX6_E1B19K-02      acaatacctgtgtagatgcctggggacaggttagtgtacggggatgtagt
                       **                                    *****      

W6EIX6_E1B19K-01      -----tacgttttggatttcatagccacagc------------------a
W6EIX6_E1B19K-02      ttctgtgcgtgttggatt-----gccacagctggcagaaccaagagtcaa
                           * *** *******     ********                  *

W6EIX6_E1B19K-01      ttg----tggag---------------------aacatgg----------
W6EIX6_E1B19K-02      ttgtctctgaagaaatgcatattccaaagatgtaacctgggcattctgaa
                      ***    ** **                     *** ***          

W6EIX6_E1B19K-01      -------------aaggttcgcaa--------------------gatg--
W6EIX6_E1B19K-02      tgaaggcgaagcaagggtccgccactgcgcttctacagatactggatgtt
                                   * *** *** *                    ****  

W6EIX6_E1B19K-01      ------------aggacaat------------------------------
W6EIX6_E1B19K-02      ttattttaattaagggcaatgccagcgtaaagcataacatgatttgcggt
                                  *** ****                              

W6EIX6_E1B19K-01      ----------------ctta------------------------------
W6EIX6_E1B19K-02      gcttccgatgagaggccttatcaaatgctcacttgtgccggtgggcattg

W6EIX6_E1B19K-01      ---------ggttactg---------------------------------
W6EIX6_E1B19K-02      taatatgctggctactgtgcatattgtttcccatcaacgcaaaaaatggc
                               ** *****                                 

W6EIX6_E1B19K-01      --------------------------------------------------
W6EIX6_E1B19K-02      ctgtttttgatcacaatgtgttgacgaagtgtaccatgcatgcaggtggg

W6EIX6_E1B19K-01      ----------------------gccagtgca-------------------
W6EIX6_E1B19K-02      cgtagaggaatgtttatgccttaccagtgtaacatgaatcatgtgaaagt
                                             ****** *                   

W6EIX6_E1B19K-01      ----------------gcctt--------tgggtgtagcggga-------
W6EIX6_E1B19K-02      gttgttggaaccagatgccttttccagaatgagcctaacaggaatctttg
                                      *****        ** *  ** * ***       

W6EIX6_E1B19K-01      -----------------------atcctgaggcat------------cca
W6EIX6_E1B19K-02      acatgaacatgcaaatctggaagatcctgaggtatgatgatacgagatcg
                                             ********* **             * 

W6EIX6_E1B19K-01      ccggt-catgccagcggttctggagg-aggaa----------cagcaaga
W6EIX6_E1B19K-02      agggtgcgcgcatgcgaatgcggaggcaagcatgccaggttccagccggt
                        *** *  **  ***  *  ***** * * *          ****  * 

W6EIX6_E1B19K-01      g---------------gacaacccgaga------------------gccg
W6EIX6_E1B19K-02      gtgtgtagatgtgactgaagatctgagaccggatcatttggttattgccc
                      *               **  * * ****                  *** 

W6EIX6_E1B19K-01      gc-ctggacc---------ctccagtggag--gaggcggagtag
W6EIX6_E1B19K-02      gcactggagcagagttcggatccagtggagaagaaactgactaa
                      ** ***** *          **********  **  * ** ** 

© 1998-2023Legal notice