Dataset for CDS classical BH3-containing proteins of organism all

[Download (right click)] [Alignment] [Repertoires]

567 sequence(s)

>gnl|bcl2dbcds|A0A3Q1ELG4_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BCL2L11 (length=543 residues).
agctccagcgctgcttcacccgcggctccacatgcagacactacagagggcggcggagcggatccagaacccgtcggtgc
agctggagtctcggcgaaaacatcccgttcgaactccaccggaggagagccggactccccgtcctggtccagagccagcc
taggcgtgtttcagaccaggtcgatatttcacctccctcgccgctcctccagtggttatttctccgccgatggttccgac
tcggtgccgagctccccgctctcaccgaagcggctgacggctgacaaaaccacgcaaactccgagcccgagcggccaggt
gatcagacacgcactggagcgcatggccggtgaggcgcacagaggaggaccggagacgcagcggcagcagcacggtgagc
tgaatgactgcaggagctgcggacaaaggaaaaccagtttgacattctctgcagtagtttttgctctcgccattgtctgt
ccttgtcttctgtcatttttgttcactgtttgctttcgtttctgcaacaaacgagttaaataa
>gnl|bcl2dbcds|A0A3Q1FVH7_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BMF (length=480 residues).
atggacgatgaggaggatgatgtgtttgagccagacacccactgctggcgcacaacattcagggagataaagtgtgaaga
ccggggcacacagactcctggtcctgccctacaaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtaacgcaggttttcgactgcacttcccagcacactttgagcttattgcgaggcaacaaggaagtgaa
atggagcaaaatgggatggagcagctgccccggcagcaacctatggcacacagcgtggaggcttgcattggacagaaact
ccagctgataggagaccagtttcaccgggaacacctacaactgtatcatcgaaaccaaaggaaccaggggccgctgtggt
ggcgcctggtcgcagccattctcagccttctgtttgacggggggttcattgctggaggaggtggtgcaggacggaggtga
>gnl|bcl2dbcds|A0A3Q1FVH7_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BMF (length=480 residues).
atggacgatgaggaggatgatgtgtttgagccagacacccactgctggcgcacaacattcagggagataaagtgtgaaga
ccggggcacacagactcctggtcctgccctacaaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtaacgcaggttttcgactgcacttcccagcacactttgagcttattgcgaggcaacaaggaagtgaa
atggagcaaaatgggatggagcagctgccccggcagcaacctatggcacacagcgtggaggcttgcattggacagaaact
ccagctgataggagaccagtttcaccgggaacacctacaactgtatcatcgaaaccaaaggaaccaggggccgctgtggt
ggcgcctggtcgcagccattctcagccttctgtttgacggggggttcattgctggaggaggtggtgcaggacggaggtga
>gnl|bcl2dbcds|A0A3Q1GWH9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BAD (length=498 residues).
atggctgcaaaattctcaatttcagacggcgactcagagccagaggaagtggagggagaaaacaaccattcaccagcaac
agaagccatgcctgtcttcgcccgccgcaacatggccttacctgaactcagaaccccagcatctggtcggatcaggctga
actcggagtcccacgcctccacgctctccagagatgaggagctccaggcaaagggggaagaggaagccggcacgcccaca
gagggagctccgttcagggcacggtctaagtcggctccccctgcgctgtgggccgccaagaagtacggccagcagctccg
aaggatgagcgacgagtttgacagcctgctagacaaaggggagatgaagagagtgaggagcgcagggacggccagacaga
tgcaccactctaaaagctggtggagctacctctttagtcaccaggagatggagggagagaacaaccaccatgaaagccac
acacatcgcaatgagtag
>gnl|bcl2dbcds|G1LDR8_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagcccaggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgccgatatgcgcccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgcatat
tacccaaggagggtctttctgaataattaccaagcagccgaagcccacccccaaatgattatcttgcgactgttacgtta
catcgtccgcctggtgtggagattgcagtga
>gnl|bcl2dbcds|G1LIZ7_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=PMAIP1 (length=162 residues).
atgcctgggaagaaagcgcgtaagagcgcgcaggcgagtcctgcgcggacccggggtcagcccgaagtggagtgcgccat
tcaactcaggagatttggagacaaactgaatttccggcagaaacttctgaatctgatatccaaactcttccgctcaggaa
cc
>gnl|bcl2dbcds|G1LNV7_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BBC3 (length=456 residues).
ggaagcggggcaagaggggacccgatttcaagaccacaggcacaggtgtggaaactgaggccccgatgtgtgactggagg
gaagcacagactgcggggcggctcagaagggggtggggcaggaaggcatctcccgaatcccagccccccaggtcctcagc
cctcactctcgccggcagagcagcacctggaatcgccggtgcccagtgccccgggggccctggcgggaggccccacccag
gcagccccgggagtccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggcggatggcggacgacct
caacgcgctgtacgagcggcggagacaagaggagcggcagcgacaccgcccctcaccctggagggtcctgtacaatctca
tcatgggactcctgccattacccaggggccgcggagccccggagatggagcccaat
>gnl|bcl2dbcds|G1MI17_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BAD (length=633 residues).
gtggggaccccagagaatccctcatctgctcccacacatggcccaggcaaaaggaagtcgggaactgatcggcgggagac
gaggaagggacccaggacgaccgcgcttgcccccacagcccagagcatgttccagatcccagagtttgagcccagtgagc
aggaagactccagccctgcagataggggcctgggccccagccccacaggggaccagcccccaggccctggcaagcaccgg
cagacagccccaggcctcctaggggaagctgctcacccccaggggcagccggccagcagcaaccaccatggaggcgctgg
ggctgtggagccccggagtcgccacagctcgtaccccgcggggaccgaagaggatgaagggttggaggaggaagagctca
gccctttccgggggcgctcgagctcagcgccccccaacctctgtgctgcactgcgctatggccgcgagctccggaggatg
agcgacgagttccagggctccttcaagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcgacaaagccc
cagctggacgcgcgtcatccagtcctggtgggatcggaacttggggagaggaggctccgccccctcccaatga
>gnl|bcl2dbcds|A0A3Q0QNQ2_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Amphilophus citrinellus GN=BAD (length=432 residues).
atgcccgaaccacctcgactggttctttttgatgtagaagaaggacagtcacccttcagagaaggctcatttctactgct
tgtatctgtgatctcrttcttttggtcactacccaaagctttctccagggatgaggagctcgtcgtcagaggggaggacg
agatctgtactcccacagagggagatccattcaggcgaaggtcaaagtccgcaccccctgctctgtgggctgccaagaag
tacggccagcagcttcgaaggatgagtgatgagtttgacagcctactagataaagggatgaagaaggccaagaatgctgg
gaccaccagaaagatgcaccactctaaaacctggtggagctatctctttagtcaccaggagagtgatggagagaacagcc
atcatgaaaaccacacacaacgcactgagtaa
>gnl|bcl2dbcds|A0A3Q0QNQ2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Amphilophus citrinellus GN=BAD (length=489 residues).
ttcatccattttcttccgtttatccagggtcgggggcagcagcctagccacctcctgcagctgatctggggaacaccaag
gcattcccaggccataggacatgaccagaacacttcacccatgaggcatcctactgccaggaggatcaggatgaactcag
agtcccacacttcctcagtctccagggatgaggagctcgtcgtcagaggggaggacgagatctgtactcccacagaggga
gatccattcaggcgaaggtcaaagtccgcaccccctgctctgtgggctgccaagaagtacggccagcagcttcgaaggat
gagtgatgagtttgacagcctactagataaagggatgaagaaggccaagaatgctgggaccaccagaaagatgcaccact
ctaaaacctggtggagctatctctttagtcaccaggagagtgatggagagaacagccatcatgaaaaccacacacaacgc
actgagtaa
>gnl|bcl2dbcds|A0A3Q1CI15_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Amphiprion ocellaris GN=BCL2L11 (length=549 residues).
cctacaaagtccggtcctgacgcagcagcgcgctgcttcaccagcggctccagatgcagagactcagagaggctaccgcc
aaatccgtcccatggctcgccggactccccgtcctggtccagagcgcaggccagcctaggcgtgtttcagaccaggtcga
tttttcacctccctcgccgctcctccagtggctatttctccgccgatggtgccgactcggtgccgagctccccgctctca
ccgaagcgactgacggctgacaaagccacgcagactccgagcccgagcggccaggtgatcaaacacgcgctggagcgcat
gaccgatgaggcgcacggaggaggaccgggaacgcagcagcacggtgagctcaggctgacatacacgagggaaatcagtt
gcacattcaatctctgcaatagtttttgcacgctgttttctgtcactgttttctgtcatcttcagtcgctgtttgcgtct
acgctacaaaacgtcttgattaggtttattaacccaaactacttcagtacattttggaacagatgttaa
>gnl|bcl2dbcds|A0A3Q1CPU7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Amphiprion ocellaris GN=BAD (length=504 residues).
atggctgcaaaattcactatttcagacagcgagtcagagccatcagaggaggtagaagagggagaaaacaaccattcacc
agcaacacaagccatgcctgttttcgcccgccgcaacatggccttacctgaactcagaactccagcatctggtcggctca
ggctgaactcggagtcccacgcctccacgctctccagagatgaggagctccaggcgaggggggaagaggaagccggcacg
cccacagacggagctccgttcagggcacggtccaagtcggctccccctgcactgtgggccgccaagaagtacggccagca
gcttcgaaggatgagcgatgagtttgacagcctgctagataaaggggagatgaagagggtgaggagtgcagggacagcca
gacagatgcaccactctaaaagctggtggagctacctctttagtcaccaggagatggagggagagaacaaccaccatgaa
agccacacacatcgcaatgagtag
>gnl|bcl2dbcds|A0A3Q1D1K3_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Amphiprion ocellaris GN=BMF (length=492 residues).
atggacgatgaggaggatgatgtttttgagccagacccccactgctggcgcacaacattcagggagataaagtgtgaaga
ccggggcacacagactcctggtcctgccctgcaaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtaacgcaggttttcgactgcacttcccagcacgctttgagcttattgggaatcaccaagcgaggcaa
caaggaagtgaaatggagcaaaatgggatggagcagctgccccggcagcaacctgtggcacgcagcatggaggcttgcat
tggacagaaactccagctgataggagaccagtttcaccgggaacacctacaactgtatcatcgaaaccaaaggaaccagg
ggccgctgtggtggcgcctggccgcagccgttctcagccttctgtttgacagggggttcattgctggaggaggtggtgca
ggacggaggtga
>gnl|bcl2dbcds|A0A3P8RKY9_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Amphiprion percula GN=BMF (length=492 residues).
atggacgatgaggaggatgatgtttttgagccagacccccactgctggcgcacaacattcagggagataaagtgtgaaga
ccggggcacacagactcctggtcctgccctgcaaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtaacgcaggttttcgactgcacttcccagcacgctttgagcttattgggaatcaccaagcaaggcaa
caaggaagtgaaatggagcaaaatgggatggagcagctgccccggcagcaacctgtggcacgtagcatggaggcttgcat
tggacagaaactccagctgataggagaccagtttcaccgggaacacctacaactgtatcatcgaaaccaaaggaaccagg
ggccgctgtggtggcgcctggccgcagccgttctcagccttctgtttgacagggggttcattgctggaggaggtggtgca
ggacggaggtga
>gnl|bcl2dbcds|A0A3P8RLE2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Amphiprion percula GN=BCL2L11 (length=594 residues).
gcgaacagaacacctagtttagtaggacctgaacagaagaagaggaacggagggaacctcagaggcggcggagcagatcc
agaacccgtcggtgcagctggggtctcggcgaaaacatcccgtttgaactccaccggaggagagccggactccccgtcct
ggtccagagcgcaggccagcctaggcgtgtttcagaccaggtcgatttttcacctccctcgccgctcctccagtggctat
ttctccgccgatggtgccgactcggtgccgagctccccgctctcaccgaagcgactgacggctgacaaagccacgcagac
tccgagcccgagcggccaggtgatcaaacacgcgctggagcgcatgaccgatgaggcgcacggaggaggaccgggaacgc
agcagcacggtgagctcaggctgacatacacgagggaaatcagttgcacattcaatctctgcaatagtttttgcacgctg
ttttctgtcactgttttctgtcatcttcagtcgctgtttgcgtctacgctacaaaacgtcttgattaggtttattaaccc
aaactacttcagtacattttggaaaagatgttaa
>gnl|bcl2dbcds|A0A3P8TWH6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Amphiprion percula GN=BAD (length=504 residues).
atggctgcaaaattcactatttcagacagcgagtcagagccatcagaggaggtagaagagggagaaaacaaccattcacc
agcaacacaagccatgcctgttttcgcccgccgcaacatggccttacctgaactcagaactccagcatctggtcggctca
ggctgaactcggagtcccacgcctccacgctctccagagatgaggagctccaggcgaggggggaagaggaagccggcacg
cccacagacggagctccgttcagggcacggtccaagtcggctccccctgcactgtgggccgccaagaagtacggccagca
gcttcgaaggatgagcgatgagtttgacagcctgctagataaaggggagatgaagagggtgaggagtgcagggacagcca
gacagatgcaccactctaaaagctggtggagctacctctttagtcaccaggagatggagggagagaacaaccaccatgaa
agccacacacatcgcaatgagtag
>gnl|bcl2dbcds|A0A3Q1ICY2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Anabas testudineus GN=BCL2L11 (length=726 residues).
atggatcctagacaaccaaaccgctccgatggctcgacagctgtaacggccacaggggagagcggaggagacccaccacc
cgtcggtgccgctggagtctcaacgccaacctcccgttcgaacgacggcggggagcggaggtttggccgccctgactcca
gtggaggaggagagcctgaatcgcagtcccggtgcagaaccaaaagtagctcgtcttccgacggcctaggcgtgtttagg
tcagtattccgcctcccccggcgctcctctagtggatatttctcctacgacagtgactcgcagccgagctccccgctctc
acctaggccagtgacgtttgacagagccacgcagactccgagccccaccggccaggtgatgaaccacgccctgcagcgct
tggccgaggcgaacggctcagacctgaggacgcatcagcagcacggaagcgatctcagctcctctagcacgcagcaacaa
aacgcagcaggggatatgcaggcagtggaagtcggacgagagctccgacgcattggagacgacttcaataaccacctcct
ggaggtggcaggcagacatagatgggtggggatccaaccaatccgattaccacatatccaccaggaccccactgtcctgc
tctgcgtgggcctcctgctctttgtgattggacggataatctactcgcaaggcagtacgaacagcgagggccactctcac
gtttag
>gnl|bcl2dbcds|A0A3Q1IPR4_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Anabas testudineus GN=BMF (length=492 residues).
atggacgatgaggaggatgatgtgtttgagccagacccccactgctggcgtaccacattcagggagataaagtgtcaaga
ccggggcacacagacacctggccctgcgctgccacagaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggcaacgcaggttttcggttgcacttcccagcacacttcgagcttgttggggatctggaagtgaggcaa
caagacagtgaggaggaacaaaacgggatggagatcccaccccggcaacaaccactgatgcaaagcgtggaagcctgtat
tggccagaaactccagctaataggagaccagtttcacagagaacacctacaactgtatcatcgaaaccaaaggaaccagg
gcccgctgtggtggcgcctggccgcagctatgctcagcctcctgtttgacaggggattaattgctggaggaggcggagca
ggacggaggtga
>gnl|bcl2dbcds|A0A3Q1K1C7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Anabas testudineus GN=BAD (length=498 residues).
atggcagcaagattcaccatttcagacagcgactcagacccatcagaggggatggaggaagaaggacacaaccagtcacc
accagggcaagagcagcaagtttttccacgccacacccttaccttaccggaactcagagctagtggtcgaatcaggctga
actcagagtctcacgcttccaccgtctacagagacgaagaactccaggccaaggcagatgaggaagctggtacgcccaca
gatggagctccattcagggcacggtccaagtctgctccaccagccctgtgggcagcaaagaaatacggccagcagctcag
aagaatgagtgacgagtttgacagcctgctagacaaaggggagatgaggaaggtgaggagcgctggcacggccagacaga
tgcaccactctaagagctggtggagctacctctttagtcaccaggagactgagggagagaacaatcaccacgaaagccac
acacaccgcactgagtag
>gnl|bcl2dbcds|A0A3Q1K1C7_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Anabas testudineus GN=BAD (length=498 residues).
atggcagcaagattcaccatttcagacagcgactcagacccatcagaggggatggaggaagaaggacacaaccagtcacc
accagggcaagagcagcaagtttttccacgccacacccttaccttaccggaactcagagctagtggtcgaatcaggctga
actcagagtctcacgcttccaccgtctacagagacgaagaactccaggccaaggcagatgaggaagctggtacgcccaca
gatggagctccattcagggcacggtccaagtctgctccaccagccctgtgggcagcaaagaaatacggccagcagctcag
aagaatgagtgacgagtttgacagcctgctagacaaaggggagatgaggaaggtgaggagcgctggcacggccagacaga
tgcaccactctaagagctggtggagctacctctttagtcaccaggagactgagggagagaacaatcaccacgaaagccac
acacaccgcactgagtag
>gnl|bcl2dbcds|A0A493SWX7_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Anas platyrhynchos platyrhynchos GN=PMAIP1 (length=156 residues).
atgccgtgcaggaccctgcgcaaacctgcacaaccctccgcagaacggcaggcggtggcggagtgcgcgctggagctgcg
ccggatcggcgacaaggcggactttcgacagcggatcctgaacctcatcacaaagctgttctgccccaaaacgtga
>gnl|bcl2dbcds|A0A493T7X1_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Anas platyrhynchos platyrhynchos GN=BMF (length=711 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaacaggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgcatc
agcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaacgtggaggcgaacaggaac
cacactgggcagaggtgagcttcacccacctgtttcaggccacatccagtctgcagggagcactgaacaaacactggttc
gggggagagacatgcacaccgccggccggatgtgaggactctgaaattcttctactcgtcttcaagtttggggttttatg
gactcctctttgctgctccctgccctgcgaggcagggagctcttgtccaacactgtcgaaggaaagccagaatgtgggtg
tgtttggtaaagcttgctgctgggtccccgcaccggtaacctctgtgcaggagaggcaggtattaggctaa
>gnl|bcl2dbcds|A0A493T7X1_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Anas platyrhynchos platyrhynchos GN=BMF (length=582 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaacaggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgtttacatgtccctccagttggctttgcattggatccacacctccaagaggagcctcaggaaggtcagc
aggaggcgcgtgctgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagagg
catcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaacgtggaggcgaacag
gaaccacactgggcagaggtga
>gnl|bcl2dbcds|U3IW89_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Anas platyrhynchos platyrhynchos GN=BCL2L11 (length=480 residues).
ggcggcgctggtaaacacggggcggggacgggacgggacgggaggggcgggcagcggcagccccgagcgcggtcgccgct
gctgtcgcgctcctccagcggctacttctccttcgaggccgagcgcagccccgcgcccatgagctgcgacaaggccacgc
agacccccagcccgccctgccaggccgtcagccactacctgagcgccatggcttccaggtggcggtctcactcgctagca
gaagaaatacagccagaaatatggattgcacaggagctgcggcgcattggagatgaattcaatgcctcctattgtccaag
aagggtaattttcttatttttactttccatttctttacacttagtgccacgtctacctccacctttcccgcgtccaggca
gtgttgcaggaggtgtttgtctcgtgggtgctgtgcagttgggaattaaagtcactttttttaccctgttttccttctag
>gnl|bcl2dbcds|H9GL49_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Anolis carolinensis GN=BMF (length=669 residues).
atggatcctcccggctacttggatgatgacttctccactttggatgggctggaggatgatgtgttccatgcagaagactg
tggacttgccagtcaacccagtgagatgacctttcctggcattttcactcagagcaaatcctacaactgtcttctgggga
ggttccagctcttcccacttacacactgttgtggccctggcagtaggcaggccaggcagcaagacaaggcaacacaaaca
ctcaacccatcctcttccagccaggatgtgatgttaccttgtggagtcacagaagaaccccagagactcttctatgggaa
tgctgggtaccgtttacacgtcagcccaattggtttctcattgaatccacacttccaggaggagccccaggagagtccac
aggaactgcgtactgaagttcagattgcacggaagttgcagtgcattgcagaccagttccacaggcttcacctacagagg
caccagcagaacagaaaccaggtctggtggcagatcttcttcttcctccataacgtggccttgaacatggaggcaaacag
acatcgtgctggccgtagttgtaccacaacctattttccttttactgagcctccggtgtgttttccattctctgaaatgc
tgccaagattctgtctagaggctatctga
>gnl|bcl2dbcds|R4G9R5_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Anolis carolinensis GN=BCL2L11 (length=351 residues).
atgctggtcgttggaagcagccagccacagctttgcttgcttcccaaacagctaaatgtcctctctgccaatgcttttgc
tatttcttgctttttataccgtgatgtgccgtggagaagaacagggaggagatggtgtgaggcagaaacttccagatggc
agtcacggccaattcctgaagatatgcagccagaaatatggattgcacaggaattacggcgcatcggagatgaattcaat
gcttcccactgtccaagaaggggtttcttggattaccaagcagtaaaccatcagatcataattttgcgcctgttacatta
cattgtccgcttcatttggagaatgcagtga
>gnl|bcl2dbcds|A0A2K5BYA0_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Aotus nancymaae GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggtcgcggccccccggccgtttgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccagcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A2K5CA89_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L11 (length=318 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtgatatttcattgtggtttagattt
atatttaccttctttgatttgtatggccaccaccacagtcaaggtacagaacaactccaccacaagtatttctcatga
>gnl|bcl2dbcds|A0A2K5CA89_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L11 (length=525 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggaggatatctcttccatctgattga
>gnl|bcl2dbcds|A0A2K5CFK7_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Aotus nancymaae GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagagcgcgcaaccgagcccctcgcgggctccagcagaccttgaagtcgagtgtgccac
tcaactcaggagatttggagacaaactaaatttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|A0A2K5CLG5_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Aotus nancymaae GN=BIK (length=468 residues).
atgtctgaagttagacccctctccagtgacatcttgatggagaccctcttgtgtgagcagttcgtgcatcccctgaccat
ggaggttgtcggtgggagtgaccctgaagaggacctggaccctgtggaggaccctttggaatgcatggagaacagtgacg
cactggtcctgcagctggcctgcatcgcggaccagatggatgtgagccttagggcccggaggctggcccagctctatgag
gtggccatgtacagcccgggtctcgctttcatcctcgaccggaccgacatcggggatgttcttagcggtatcgtggaagt
tttcgctaacttccaggaggacatagtgaggctctggagatccctgagctccgggtcctgggtgtcccgcaaacaggcag
tgctgctggcactcctggcgctgctgctggcgatgttcagcgggggtctgcacctgctgctcaagtga
>gnl|bcl2dbcds|A0A2K5E1Q4_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Aotus nancymaae GN=BMF (length=390 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccagtcagaggatggggagccagggacccaacccgg
gagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccggcttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttacgcatcagcagaaccgaaatcgcgtgtggt
ggcaggtcctcctctttctgcacaacctggctttgaatggagaagagaacaggaatggggcaggcccgag
>gnl|bcl2dbcds|A0A2K5E1Q4_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Aotus nancymaae GN=BMF (length=555 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccagtcagaggatggggagccagggacccaacccgg
gagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccggcttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttacggcaatgctggctatcggcttcctctccc
tgccagtttcccagcagtcttgccccttggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacatcagcagaaccgaaatcgcgtgtgg
tggcaggtcctcctctttctgcacaacctggctttgaatggagaagagaacaggaatggggcaggcccgaggtga
>gnl|bcl2dbcds|A0A2K5E6A6_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Aotus nancymaae GN=BAD (length=459 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacaggcccccaggctctggcaagcatccacgccaggccccaggcctcccaggggacgccagtcaccagcagggac
agccaaccagcagcagccaccatggaggtgagtactccacttgtgcctctgcttcctcatctgagaatcccagtgcaagg
atgctctcgaaagcatcagcagggatgtccgccccagccactgactcagaaaatgtaaagctggaggtgccttgctgggt
cgccacagctcctaccccgcagggacggaggaggacgaagggatggaggaggagcccagcccctttcggggccgttcgcg
ctcagcaccccccaacctctgggcagcacagcgctatggccgcgagctccggaggatga
>gnl|bcl2dbcds|A0A2K5E6A6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Aotus nancymaae GN=BAD (length=504 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacaggcccccaggctctggcaagcatccacgccaggccccaggcctcccaggggacgccagtcaccagcagggac
agccaaccagcagcagccaccatggaggcgctggggctgtggagacccgaagtcgccacagctcctaccccgcagggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgttcgcgctcagcaccccccaacctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggcacagcaacgcagatgcggcaaagctccagttggacgcaagtcatccagtcctggtgggatcggaacttgggcagg
ggaggctccgctccctcccagtga
>gnl|bcl2dbcds|A0A2K5F6X4_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Aotus nancymaae GN=BBC3 (length=393 residues).
aaatgtggcgtggggtctgcctgggcatgtccatgccaagtgcctagggcttcttcctcgacgtgggtcccctgccagat
gtgtggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctggcgg
gcggtcccacccaggcggccccgggagtccgcggggaggaggagcagtgggcccgggagatcggggcccagctgcggcgg
atggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagccgcagcaccgcccctcaccctggagggt
cctgtacaatctcatcatgggactcctgccctttcccaggggccacagagcccccgagatggagcccaattag
>gnl|bcl2dbcds|A0A3P8NFE2_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Astatotilapia calliptera GN=BMF (length=513 residues).
atggacgatgaggaggacgatgtgtttgagccaaaagccaactgttggcgcaccacattcagggagataaagtgtgaaca
tcgaggcacacagacacccggtcctgccctggtaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtaacgcaggttttcgattgcacttcccggcacgcttcgagctcgtcggggatcacagagcgagtcga
caaggaagcacggagcagcaaaacagcatggagcgcctgccccgccagcgacccgcggctcgcagcgtggaggcctgcat
tggacagaaactccagctcataggagaccagtttcactgggaacgcctgcaactggtgaaagcaagtagaatacaaacat
gctggctggaaactgctgaagcttatgcaacaccctgcaaagttcaccacagtgtgataacggtatggaaacccagaggc
ttatcacagtggcagttcttgactgttaactag
>gnl|bcl2dbcds|A0A3P8NFE2_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Astatotilapia calliptera GN=BMF (length=492 residues).
atggacgatgaggaggacgatgtgtttgagccaaaagccaactgttggcgcaccacattcagggagataaagtgtgaaca
tcgaggcacacagacacccggtcctgccctggtaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtaacgcaggttttcgattgcacttcccggcacgcttcgagctcgtcggggatcacagagcgagtcga
caaggaagcacggagcagcaaaacagcatggagcgcctgccccgccagcgacccgcggctcgcagcgtggaggcctgcat
tggacagaaactccagctcataggagaccagtttcactgggaacgcctgcaactgtatcaccgaaaccaaaggaaccagg
ggccgatgtggtggcgcctggccgcggccattctcagccttctgtttgatagggggttcatagccggaggagggggtgga
ggacggaggtga
>gnl|bcl2dbcds|A0A3P8QRJ7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Astatotilapia calliptera GN=BAD (length=477 residues).
atggctgcaaacttcaaaatttcagacagtgattcagaggcatcagaggaggtaggggaaggagaaaaccaacagtcagc
aggacaagctcaagaaagcaagccccagacactttcccttcctgtaaccaaaacgacagctgctggaaggctcagggtga
actcagagtcccacacttcctcaattgccagggatgaggagctcatggctagaggggaggatgaggtctgtactcccaca
gagggagacccattcaggcgaaggtcaaagtcagctccccctgctctgtgggctgccaagaagtacggcaggcagcttcg
acgaatgagtgacgagtttgacagcttactagataaaggggagatgaaggtcaagaagctgcaccactctaaaacctggt
ggagctatctctttagtcaccaagagactgaaggagagaacaaccatcttgaaaaccacaaccaacgcactgagtaa
>gnl|bcl2dbcds|A0A3B1IH05_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Astyanax mexicanus GN=BAD (length=540 residues).
atgtccacagcggcgagagcggcggcggggacctgcgactccactgctgtcagccagccgtccaaactcgatttcacaat
ggatcacatgttcacaatatctgatgagtcagatgcatctgaagagctaggagactcagaccagccagaggtcagtaaga
cagctgagccatcgcggtctgggcagcacatcactgttccggagaaactcagagtagagcccaggcaaaggaatttttct
atgaatgaagaggctctgcaggagtctggtgctgggagacacgaagatggagctcgagatggagattcattccgacgccg
cagccgctcagctcccccttctctgtgggcagccaagaaatatggccgacagctgaggaagatgagtgacgagtttgaca
aggggctagagcaagggatgaagagggtgaggagtgccggagcagcccgccagatgcaaaactcccccagctggtttgcc
tttctttggagtcacaaggaatcagactctgaggcgagcagcagccgtccagcagaatga
>gnl|bcl2dbcds|A0A3B1JLM2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Astyanax mexicanus GN=BAD (length=642 residues).
atgagcaatcagtatctgctaaaactgaggagagctcgttttaattgcgacgaggagggatatagccaagcacttaacag
cagaacatcgactgaaggaggggggagagatacgcttttcaggccattgtgctggaattcatctggaagcacagttttca
caatggaaaagacaccaccacacagtaaagaagatgacatcagtcccatagatgaccacgatgaatcaaggtggtcagag
gcagtcaagagtgtcgactccccacagacggacagcgggcccagcatgtacagggacacatcatcagacgagctgttgga
ggtggggggtcgagtgaggctctactcagagtcccaagtgtacaacatcaaccgctgggaggacaatgagaaccaggatg
gcgcttcagcagaggacggtggtgtcggtgacggagcaccattccgaggccgatcccagtcagctcctgctgcgctatgg
aaagccaagaaatatggacggcagttgaggaggatgagcgatgagtttgacacctggttggacaaaggggacttaagaag
aacaactggccctgggaggcataccaaccgaggatggttctctttcctctggggtaccaaagaagaggagggaagagaat
aa
>gnl|bcl2dbcds|A0A3B1JXK6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Astyanax mexicanus GN=BCL2L11 (length=612 residues).
atgtccagaccgtcaaaccgggccacccgcccacccttcttaaaggagcagggggaacgcggccagagcggcgggggcgg
cggaacattgtcccgagccgagcagtgcgagcagcctgagcccggcgatggcgacccggttaggggaccccctgcgctgc
acaatagccttctcggttaccagacccggtcgccgctgttccgaactctctccaggtcctcgagtggatatttctcgttc
gacagcgagcccagctccccgctcctgatgcacagcgcgtccactcagaccccgagtccatctagccaagtcataattca
cgcccttcagcgcatttccgaggcgcgaggcgacgctcagagtttcgagttatgtccaggacctaaccactgtccacccc
acagagcagcggctgcgggggacatgcaagcgcattggtacatcgcgcaagagttgcgacgcattggggatgaattcaac
gatctgtacttccgaggggcaggcagaaatggaggtggtgcccaacttcctgcacaaaatgaacccgccttcatactgtg
gatggggctcctgattgaacgtctccgacagttcctccacagaagaagatga
>gnl|bcl2dbcds|A0A3B1K1X5_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Astyanax mexicanus GN=BMF (length=468 residues).
atggacgatgaggaggatgatgtgttcgttacggatccagagccttggcgttccccgatcagtgtgataaagcaggagga
gcgtggcacacagactccagggcggccgccggctcggaccaatggcatgctgccctgcggaatatccgaggagccaagac
gcctcttctacggtagtgcaggactgttattactggcaccgtctgcccgttctgaacgcgtcggggacgccatgtttcgg
gaggagcatcgagccgttgagcctcggcggcggccggcgcacagcgtggaggcccgtatcggacagaagctccagatgat
cggagaccagttttatcaagagcacatgctgcaacacagaaaccaaaggaaccagcagccgctttggttgcgcttggcgt
cggcgctctacacgctcctgttcgagagggagccggcggctcacgggaggcgagaggaccggaggtga
>gnl|bcl2dbcds|L8IVA4_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Bos mutus GN=BCL2L11 (length=588 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagaccgggggcccccacctctttacagacagagcggcaaggtaatcctgaaggagaaggggaccgctgcccccaag
gcagcccacagggcccgctggccccaccggccagccctggccctttcgctaccagatccccgctcttcatcttcgtgaga
agatcctccttgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatccacacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagtttaatgcatat
tacccaagaagggtcttcgtgcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcgctacat
cgtgcgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|L8IVA4_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Bos mutus GN=BCL2L11 (length=420 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagaccgggggcccccacctctttacagacagagcggcaagacaggagcccggcacccatgagttgtgacaaatcca
cacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgta
cctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagtttaatgcatattacccaag
aagggtcttcgtgcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcgctacatcgtgcgtc
tggtgtggaggatgcagtga
>gnl|bcl2dbcds|L8IXF5_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Bos mutus GN=BMF (length=555 residues).
atggagccaccccagtgtgtggaggagctggaggatgacgtattccagcccgaggatggggagccggggacccagcccag
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggctacccagactctcagcccagcttccccgagccag
ggtgtcatgctgccttgtggggtgactgaggagccccagcgactcttttatggcaatgctggctaccggctcccccttcc
tgccagtttccctgcaggcttgccccttggtgagcaaccccctgaagggcagtggcaacatcgagcagagatacagattg
cccgaaaactccagtgcattgcagaccagttccatcggcttcatatgcagcaataccagcagaaccgaaatcgcatgtgg
tggcagatcctcctcttcctacacaacgtggctttgaatggagatgagaacaggaacggggcaggccccaggtga
>gnl|bcl2dbcds|A0A3Q1LXZ6_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Bos taurus GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cagccgcctggtgccctcggcggtgtcctgcggcctctgcgaacccggcctgcctgctgcccccgccgcccccgccctgc
tgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctgggggccccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgacccgacggtcctcagccttcactctcgcccgcggagcagcacctggaatcacc
agtgcccagcgccccgggggccctggcgggcggccccacccaagcggccccgggagtccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggcggacgacctcaacgcgctatacgagcggcggagacaagaggagcgg
cagcgacaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgccctttcccgggggccgcggagc
ccccgaggtggagcccaattag
>gnl|bcl2dbcds|A0A3Q1MV27_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Bos taurus GN=BCL2L11 (length=420 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagacctggggcccccacctctttacagacagagcggcaagacaggagcccggcacccatgagttgtgacaaatcca
cacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgta
cctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagtttaatgcatattacccaag
aagggtcttcgtgcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcgctacatcgtgcgtc
tggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A3Q1MV27_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Bos taurus GN=BCL2L11 (length=516 residues).
atgccgctcagcgtgcggagttacttgtggatttggctggggtcgccaggagccggcttgggggaccttgctcccattcg
gagaaaaaaagaccaaatggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctg
ccgagaggcctcctcagctcagacctggggcccccacctctttacagacagagcggcaagacaggagcccggcacccatg
agttgtgacaaatccacacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgag
gcagtctcaggctgtacctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagttta
atgcatattacccaagaagggtcttcgtgcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttg
cgctacatcgtgcgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A3Q1NFP6_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Bos taurus GN=PMAIP1 (length=165 residues).
atgcctggaaggagggctcgtaagagcgcccagccgagccccacgcgggtcccggcagatcctgaagttgaatgtgccat
tcagttgaggagaattggagacaaactgaatttccggcagaaacttgtgaatctgatatccaaactcctccgctcaggaa
cttga
>gnl|bcl2dbcds|F1MUT9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Bos taurus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcagagtgagcaggaagactccagccctgcagataggggcctgggccccagccccac
aggggacaggcccccaggtctcagcaagcactggctaacagccccaggcctcctgggggaagctggtcaccagcaggggc
agccggccggcagcagccaccatggaggcactggggctgtggagacccggagtcgtcacagctcctaccgcgcggggcca
gaggataatgaagagacggaggaggaggatctcggcccctttaggggccgctcgcgttcggcgccccccaacctctgggc
tgcacagcgatatggccgcgagctccggaggatgagcgacgagtttcacgtctccttcaaggggcttcctcgcccgaaga
gcgcgggcacggcaacgcaaatgcgacaaagccccagctggacgcgcttcctccagtcctggttgagccggaacttgggg
agaggaggctccgccccctcccagtga
>gnl|bcl2dbcds|Q05KI3_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Bos taurus GN=BMF (length=555 residues).
atggagccaccccagtgtgtggaggagctggaggatgacgtattccagcccgaggatggggagccggggacccagcccag
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggctacccagactctcagcccagcttccccgagccag
ggtgtcatgctgccttgtggggtgactgaggagccccagcgactcttttatggccatgctggctaccggctcccccttcc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcagtggcaacatcgagcagagatacagattg
cccgaaaactccagtgcattgcagaccagttccatcggcttcatatgcagcaataccagcagaaccgaaatcgcatgtgg
tggcagatcctcctcttcctacacaacgtggctttgaatggagatgagaacaggaacggggcaggccccaggtga
>gnl|bcl2dbcds|Q05KI3_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Bos taurus GN=BMF (length=555 residues).
atggagccaccccagtgtgtggaggagctggaggatgacgtattccagcccgaggatggggagccggggacccagcccag
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggctacccagactctcagcccagcttccccgagccag
ggtgtcatgctgccttgtggggtgactgaggagccccagcgactcttttatggccatgctggctaccggctcccccttcc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcagtggcaacatcgagcagagatacagattg
cccgaaaactccagtgcattgcagaccagttccatcggcttcatatgcagcaataccagcagaaccgaaatcgcatgtgg
tggcagatcctcctcttcctacacaacgtggctttgaatggagatgagaacaggaacggggcaggccccaggtga
>gnl|bcl2dbcds|Q3SYZ0_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Bos taurus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcagagtgagcaggaagactccagccgtgcagataggggcctgggccccagccccac
aggggacaggcccccaggtctcagcaagcactggctaacagccccaggcctcctgggggaagctggtcaccagcaggggc
agccggccggcagcagccaccatggaggcactggggctgtggagacccggagtcgtcacagctcctaccgcgcggggcca
gaggataatgaagagacggaggaggaggatctcggcccctttaggggccgctcgcgttcggcgccccccaacctctgggc
tgcacagcgatatggccgcgaactccggaggatgagcgacgagtttcacgtctccttcaaggggcttcctcgcccgaaga
gcgcgggcacggcaacggaaatgcgacaaagccccagctggacgcgcttcctccagtcctggttgagccggaacttgggg
agaggaggctccgccccctcccagtga
>gnl|bcl2dbcds|O61667_EGL1-01 Egg-laying defective 1 gene OS=[Eukaryota] Caenorhabditis elegans GN=egl-1 (length=321 residues).
atgctgatgctcacctttgcctcaacctcttcggatcttctaccaatgtccaacgtttttgacgttcaatcttccgtttt
ctacaacgaaaagaacatgttctactcctcgtctcaggacttctcctcgtgtgaagattcttctcaatttgccgacgact
cgggattttttgatgactctgagatcagcagcatcggctacgagatcggctccaagctagcagcaatgtgcgatgacttc
gatgctcagatgatgtcctactcggcccatgcttccgacagaagcctcttccatcgtcttctggactttttcgcttttta
a
>gnl|bcl2dbcds|A0A2R8M6L7_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=558 residues).
atgcccgcgcgtgtgtgtgcaccagtttcacaagctgttgacattgttactgtcttttgtttggggttacgaagtttagt
cccaccctctaccaaacaaaaattatgtctttattattttagaaaaagagaccaaatggcaaagcaaccttccgatgtaa
gttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctccccagctcagacctggggcccctacctcc
ctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgcca
ggccttcaaccactatctcagtgcaatggcttccatgaggcaatctcaggctgaacctgcaggtatgcgcccggagatat
ggatcgcccaagagttgcggcgtatcggagacgagtttaacgcttattatccaaggagggtatttttgaataattaccaa
gcagctgaagaccacccacacatggttatcttacgactgttacgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2R8M6L7_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=516 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcctccacggcagccctcagggcccgctggccccaccggccagccccggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2R8M6L7_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=705 residues).
atgttcccggcggctgcgacccgggccgcgagggccagaggggcagcgcgcggagccgtcggctgcccggcggagcgcag
cggcgggctggccggaaggcgtgggctctgtgctgcgccggggactctgaacccgagtcccgggctttgtctcctgcatt
gtcttcgtggtgacggtcaggggccgccgggtcggcgaaaggcgcgggtcggacgccgtggtgccccgtcccgggccaga
acgctgcgctctgaagggaaggctcggacaaaaagagaccaaatggcaaagcaaccttccgatgtaagttctgagtgtga
ccgagaaggtagacaattgcagcctgcggagagacctccccagctcagacctggggcccctacctccctacagacagagc
cacaagacaggagcccagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccac
tatctcagtgcaatggcttccatgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaaga
gttgcggcgtatcggagacgagtttaacgcttattatccaaggagggtatttttgaataattaccaagcagctgaagacc
acccacacatggttatcttacgactgttacgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2R8MW85_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Callithrix jacchus GN=BBC3 (length=1263 residues).
aggaagccgcccgccctccaccgccgccccctccggcgtgttcatgcccccggggtgagtgtgcgcgccctgaatcctcg
ccggcggcgatcggccaggccgggtgggctccctggaggaggtgacaggagtgcaggcggcgagcagtgcgggcgccctg
cctccccacactgcgcctccccacaaaccccacgagggaccctgggctggggtcgcggggagggaggcggctcggcgttg
gggcgcctggtctgggcgcacaggtgcctcggcggtctggcgggtttgtttacaaacaatggggtgcgggctcggcagcg
ccccctggcggccagtgcgaccccggggaagagggtcgaccccggggtgccccagcccccaaagtcagggaggggcgggg
gggcggcacggaggggcggccacacccagggcgcgcgcccgctgggggcggcgacagggggcggctcgcgggccgtggag
tctgcggctcctgcgggcgggggctgcgccccagcaacagccggttattggccccgcgctcgcctggcgggcggggcggg
cgcacgtggcggcggtgggggtggctgtgacagcggagtggggcgtctgggaccgccgtgggagcgcgcgtgtgcggggt
tgtggatctgcaggtgtctcgcctgggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagccc
gtagagggcttggcccgcgacggcccgcgccccttcccgcttggccgcctggtgccctcggccgtgtcctgcggcctctg
cgagtccggcctgcccgccacccccgccgcccccgccttgctgcccgctgcctacctctgcgcccccgccgccccacccg
ccgtcaccgccgccctggggggcccccgctggcctgggggcccccgcagccgcccccgaggcccgcgcccggacggtcct
cagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccaggggccctggcgggcggtcccac
ccaggcggcccccggagtccgcggggaggaggagcagtgggcccgggagatcggggcccagctgcgacggatggcggacg
acctcaacgcgctgtacgagcggcggagacaagaggagcagccgcagcaccgcccctcgccctggagggtcctgtacaat
ctcatcatgggactcctgccctttcccaggggccacagagccccggagatggagcccaattag
>gnl|bcl2dbcds|A0A2R8MW85_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Callithrix jacchus GN=BBC3 (length=396 residues).
atgaaatgtggcgtggggtctgcctgggcatgtccatgccaagtgcccagggcttcttcctcggtgtgggtcccctgcca
gatgtgtggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccaggggccctgg
cgggcggtcccacccaggcggcccccggagtccgcggggaggaggagcagtgggcccgggagatcggggcccagctgcga
cggatggcggacgacctcaacgcgctgtacgagcggcggagacaagaggagcagccgcagcaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgccctttcccaggggccacagagccccggagatggagcccaattag
>gnl|bcl2dbcds|F7FUT7_BIK-02 BCL2-interacting killer gene OS=[Eukaryota] Callithrix jacchus GN=BIK (length=831 residues).
atggaaacccctgagtgcgcgcccgtctcgggcgcagggaaaacagcgacgcacgagacaaagcaagtttgcagaacagc
agggggcagagaggccgtaaacaagccaaccggccgcacttgtagcggttctgttgctaatgccattcagaccccagtcc
agcattccgcgctcggggtgcgagaggcagctcccggggcggggcggcgcggggcgggacccgggcggggcggggcgtcc
cggtccattaggtcccgcgcgggtccccgggccgcagacacgacgcctctcggctgggtcgcagactctgctatcatcgc
cgccaccgccgccgccgccgccgccgccgccgccagaggagaaatgtctgaagtaagacccctctccagtgacatcttca
tggagaccctcctgtgtgagcagttcgtggatcccctgaccatggaggttgttggtgggagtgaccctgaagaggacctg
gaccctgtggaggaccctttggaatgcatggagaacagtgacgcactggccctgcagctggcctgcatcgcggaccagat
ggatgtgagcctcagggcccggaggctggcccagctctacgaggtggccatgtacagcccgggtctcgctttcgtcctcg
accggaccgacatcggggatgttcttagcggtgtcgtggatgttttcgctaacttccaggaggacatagtgaggctctgg
agatccctgagctccgggtcctgggtgtcccgcaaacaggcagtgctgctagcactcctggcgctgctgctggcgatgtt
cagtgggggtctgcacctgctgctcaagtga
>gnl|bcl2dbcds|F7FUT7_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Callithrix jacchus GN=BIK (length=675 residues).
atgccccagggcgcagttaggcactacccgtccccgcggggcaggctgccgccccccacccctcccggaacctttctgat
ttatctctccttggtgggtctctggggtccgtctcagcaggtctgccggtgggccccctgcccccaattctctcccggtc
ccgccccgctcttgctgtccgggagcccgcgaccggagggaggagaaatgtctgaagtaagacccctctccagtgacatc
ttcatggagaccctcctgtgtgagcagttcgtggatcccctgaccatggaggttgttggtgggagtgaccctgaagagga
cctggaccctgtggaggaccctttggaatgcatggagaacagtgacgcactggccctgcagctggcctgcatcgcggacc
agatggatgtgagcctcagggcccggaggctggcccagctctacgaggtggccatgtacagcccgggtctcgctttcgtc
ctcgaccggaccgacatcggggatgttcttagcggtgtcgtggatgttttcgctaacttccaggaggacatagtgaggct
ctggagatccctgagctccgggtcctgggtgtcccgcaaacaggcagtgctgctagcactcctggcgctgctgctggcga
tgttcagtgggggtctgcacctgctgctcaagtga
>gnl|bcl2dbcds|F7GW45_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Callithrix jacchus GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagagcgcgcaaccgagccccgcgcgggctccagcagaccttgaagtcgagtgtgccac
tcaactcaggagatttggagacaaactgaatttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|U3E722_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Callithrix jacchus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtttgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|F1PK10_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Canis lupus familiaris GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcccagtgagcaggaagactccagccctgcaaataggggcttgggccccagccccac
aggggaccggcccccaagccctggcaagcaccagcagacggccccaggcctcctaggggaagctggtcaccagcaggggc
agccagccagccgcaaacaccatggaggcgctggggctgagacccggagtcgccacagctcgttccccgcggggaccgac
gaggatgaaggaatggaggaagaagagctcagccctttccgggggcgctcgagctcagcgccccccaacctctgcgcggc
acggcgctacggccgcgagctccgcaggatgagcgacgagttccagggctccttcaagggacttcctcgcccgaagagcg
cggggacagcgacgcagatgcgacaaagccccagctggacgcgcgtcatccagtcctggtgggatcggaacttggggaga
ggaggctccgccccgtcccagtga
>gnl|bcl2dbcds|J9NTK9_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Canis lupus familiaris GN=BBC3 (length=882 residues).
atgcaggggctgcccgggcatgtccctgtcaggtgctcggggtttccttctggccctgtgggtcccccgtcagatctgtg
ccaagcgcggctagatgtgcctgctccagagtgtgtccccatcagtgggccagttaccaggaacctgttacaggccccag
ggagcgccatggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggtccgcgcccg
tttcccctcagccgcctggtgccctcggccgtgtcctgcggcctctgcgagcccggcctgcccgccgcccctgctgcccc
tgccctgctgcccgctgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggc
ctgggggtccccgcagccggccccgaggcccgcgccccgacggtcctcagccctcactgtcgccggcggaacagcacctg
gaatcgccggtgcccagcgccccgggggccctggcgggcggtcccacccaagcagccccgggagtccggggggaggagga
gcagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgctgtacgagcggcgggtgagtg
ttgggggaggggtagacggcaggtgggacttcccgcccgggagggggctgcgggcggccccgccagatgtgcggcagctg
ctgcccggcgcggcggggtcgcgctggggacaggcaggtgggatgggcgacgggcccacggacctgccgaagggcccgcg
ccgcggctggcacgacccgggcaagggccgggaccgcctcgagcgccgcggcgcgtccgtggccctcggccgcggggact
ga
>gnl|bcl2dbcds|J9NTK9_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Canis lupus familiaris GN=BBC3 (length=723 residues).
atgccctgtgtgactcccaggctgggccccagggagcgccatggcccgagcacgccaggagggcagctccccggagcccg
tagagggcctggcccgcgacggtccgcgcccgtttcccctcagccgcctggtgccctcggccgtgtcctgcggcctctgc
gagcccggcctgcccgccgcccctgctgcccctgccctgctgcccgctgcctacctctgcgcccccaccgccccgcccgc
cgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagccggccccgaggcccgcgccccgacggtcctc
agccctcactgtcgccggcggaacagcacctggaatcgccggtgcccagcgccccgggggccctggcgggcggtcccacc
caagcagccccgggagtccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggcggatggcggacga
cctcaacgcgctgtacgagcggcggagacaagaggagcagcagcgacaccgcccctcaccctggagggtcctgtacaatc
tcatcatgggactcctgcccttacccaggggccgtggagccccggagatggagcccaattaggtgcctgcacccgcccgg
tggacatcagggacttggggggcaggaccctcccacctcctgatgccctggccagcgcgggggactttttctgcaccatg
tag
>gnl|bcl2dbcds|J9NTK9_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Canis lupus familiaris GN=BBC3 (length=807 residues).
atgccctgtgtgactcccaggctgggccccagggagcgccatggcccgagcacgccaggagggcagctccccggagcccg
tagagggcctggcccgcgacggtccgcgcccgtttcccctcagccgcctggtgccctcggccgtgtcctgcggcctctgc
gagcccggcctgcccgccgcccctgctgcccctgccctgctgcccgctgcctacctctgcgcccccaccgccccgcccgc
cgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagccggccccgaggcccgcgccccgacggtcctc
agccctcactgtcgccggcggaacagcacctggaatcgccggtgcccagcgccccgggggccctggcgggcggtcccacc
caagcagccccgggagtccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggcggatggcggacga
cctcaacgcgctgtacgagcggcgggtgagtgttgggggaggggtagacggcaggtgggacttcccgcccgggagggggc
tgcgggcggccccgccagatgtgcggcagctgctgcccggcgcggcggggtcgcgctggggacaggcaggtgggatgggc
gacgggcccacggacctgccgaagggcccgcgccgcggctggcacgacccgggcaagggccgggaccgcctcgagcgccg
cggcgcgtccgtggccctcggccgcggggactgagggcggcgctcggcggagcagctcatatatcccgggctatttatag
ccggtga
>gnl|bcl2dbcds|J9NWV6_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L11 (length=396 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagaacagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatgggtctttttgaataa
>gnl|bcl2dbcds|J9NWV6_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagaacagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgcagatatgcgcccggagatatggattgcacaagagttgcggcgtattggagacgaatttaatgcatat
tacccaaggagggtctttttgaataattaccaagcagccgaagcccacccccaaatgattatcttacgactgttacgtta
catcgtccgcctggtgtggagattgcagtga
>gnl|bcl2dbcds|J9NWV6_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L11 (length=504 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagaacagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgcagatatgcgcccggagatatggattgcacaagagttgcggcgtattggagacgaatttaatgcatat
tacccaaggaggttagagcaatag
>gnl|bcl2dbcds|J9NWV6_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L11 (length=243 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagaacagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggttagagcaatagaggaaggtgtcgtg
tag
>gnl|bcl2dbcds|J9NWV6_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L11 (length=357 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagaacagcaagcttccatgaggcagtctcaggctgtacctgcagata
tgcgcccggagatatggattgcacaagagttgcggcgtattggagacgaatttaatgcatattacccaaggagggtaatg
atgttttatttactacttctcctcacaccctccccctccccacaattttttttctttaaggttactagtaaaaattccat
acttattctggaaatgcaaggtattacctatatgtga
>gnl|bcl2dbcds|J9NWV6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L11 (length=906 residues).
acacgcccggcggggggccgggccggcggcgcgcgcaggggaacccgtccgggccacccccgcctttacctgttggagcc
tgagcgcgccagccgctgcggcgcggcggggcggggcggggcgtcgggcccgcgcggcggggcgggacctggcgggggcg
gagctcgcggcgattggctgagggcgcggggccgccagtctgagcggagctgcagggctgtgcaggtttcacttcgctcc
gcgcagcctccaggtctgggtcttgcgagagggctccgtcccgcgtcgccgccgccgccgccgccgccaccggattctca
cagtcgccctacgcgccccagcccactgcggccagcatcgccacgggctgctcgctttgccccgctcccgccgccacccc
tttggcgccctttccttggccctcgtcccccccaatgtctgactctgactctcggactgagaaacgcaagaaaaaaagac
caaatggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcc
tcagctcaggcctggggcccctacctctctacagacagaacagcaagacaggagcccggcacccatgagttgtgacaaat
caacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggct
gtacctgcagatatgcgcccggagatatggattgcacaagagttgcggcgtattggagacgaatttaatgcatattaccc
aaggagggtctttttgaataattaccaagcagccgaagcccacccccaaatgattatcttacgactgttacgttacatcg
tccgcctggtgtggagattgcagtga
>gnl|bcl2dbcds|J9PB65_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Canis lupus familiaris GN=BMF (length=639 residues).
atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgg
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcatctcttccctctcaccc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccaagtcag
ggtgtcatgctgccttgtggggtgaccgaagagccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagtttccctgcaggcttgcctctcctcgagcagcccccggaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcggcttcacatgcagcaacaccagcaaaaccaaaatcgagtgtgg
tggcagattctcctcttcctgcacaacctggctttgaatgcagatgagaacaggaatggggcaggtcccagccaaagcct
gcaaatcagattctggagactttcaagaaacttgccttgctcacttcgttcgaagaccacaactccccaggatggttag
>gnl|bcl2dbcds|J9PB65_BMF-04 Bcl2 modifying factor gene OS=[Eukaryota] Canis lupus familiaris GN=BMF (length=657 residues).
atgggggcccgagaagggttgggctgcgggcgtgtggggggaccatggaggactggagcgccggggtgcgggaacgcggt
gcaggacccttatctaggggagatggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatg
gggagccggggacccagcctgggagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgt
ctgcatctcttccctctcacccactgctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagaccct
cagtccggcctccccaagtcagggtgtcatgctgccttgtggggtgaccgaagagccccagcgactcttttatggcaacg
ctggctaccggctccctctccctgccagtttccctgcaggcttgcctctcctcgagcagcccccggaagggcagtggcaa
catcgagcagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccatcggcttcacatgcagcaacacca
gcaaaaccaaaatcgagtgtggtggcagattctcctcttcctgcacaacctggctttgaatgcagatgagaacaggaatg
gggcaggtcccaggtga
>gnl|bcl2dbcds|J9PB65_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Canis lupus familiaris GN=BMF (length=642 residues).
atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgg
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcatctcttccctctcaccc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccaagtcag
ggtgtcatgctgccttgtggggtgaccgaagagccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagtttccctgcaggcttgcctctcctcgagcagcccccggaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcggcttcacatgcagcaacaccagcaaaaccaaaatcgagtgtgg
tggcagattctcctcttcctgcacaacctggctttgaatgcagatgagaacaggaatggggcaggtcccagccaaagcct
gcaaatcagattctggagactttcaagaaacttgccttgctcacttcggaggccagctaccaggatcaggagcctggggt
ag
>gnl|bcl2dbcds|J9PB65_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Canis lupus familiaris GN=BMF (length=612 residues).
atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgg
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcatctcttccctctcaccc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccaagtcag
ggtgtcatgctgccttgtggggtgaccgaagagccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagtttccctgcaggcttgcctctcctcgagcagcccccggaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcggcttcacatgcagcaacaccagcaaaaccaaaatcgagtgtgg
tggcagattctcctcttcctgcacaacctggctttgaatgcagatgagaacaggaatggggcaggtcccagcttccagct
agtcccgggaatatcgtgctctggagctcagcaggattgcagctgcctctga
>gnl|bcl2dbcds|Q1PCT2_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Canis lupus familiaris GN=PMAIP1 (length=165 residues).
atgcccggccggaaggcgcgcaagagcgcgcagcccggccccacgcgggcccccgaagagctcgaagtggagtgtgccat
tcagctcaggaaatttggagacaaactgaatttccggcagaaacttctgaatctgttatccaaactcttccgctcaggaa
cctga
>gnl|bcl2dbcds|Q45KI9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Canis lupus familiaris GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcccagtgagcaggaagactccagccctgcaaataggggcttgggccccagccccac
aggggaccggcccccaagccctggcaagcaccagcagacggccccaggcctcctaggggaagctggtcaccagcaggggc
agccagccagccgcaaacaccatggaggcgctggggctgagacccggagtcgccacagctcgttccccgcggggaccgac
gaggatgaaggaatggaggaagaagagctcagccctttccgggggcgctcgagctcagcgccccccaacctctgcgcggc
acggcgctacggccgcgagctccgcaggatgagcgacgagttccagggctccttcaagggacttcctcgcccgaagagcg
cggggacagcgacgcagatgcgacaaagccccagctggacgcgcgtcatccagtcctggtgggatcggaacttggggaga
ggaggctccgccccgtcccagtga
>gnl|bcl2dbcds|A0A452DXE5_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Capra hircus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgtggccccccggccgtgtgcgcctgcagcgccggccgtctgggtctgcgctc
gtccgccgcgcagctcacggccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccctacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A452E3G1_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Capra hircus GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctcccccgagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cagccgcctggtgccctcggcggtgtcctgtggcctctgcgaacccggcctgcctgctgcccccgccgcccccgccctgc
tgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcactgccgccctgggggccccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgacccgacggtcctcagccttcactctcgcccgcggagcagcacctggaatcgcc
agtgcccagcgccccgggggccctggcgggcggacccacccaagcggccccgggagtccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggcggacgacctcaacgcgctatacgagcggcggagacaagaggagcgg
caacgacaccgcccctcgccctggagggtcctgtacaatctcatcttgggactcctgcccttccccgggggccgcggagc
ccccgaggtggagcccaattag
>gnl|bcl2dbcds|A0A452ER54_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Capra hircus GN=BAD (length=597 residues).
atggggaccccggagaatccctcagcggctcccacaactcggaagctgagcatccggagacgtagaagagaatcaggagg
aaggcagtgggcggggccccggggaagcatgttccagatcccagagtttgagcagagtgagcaggaagactccagccctg
cagataggggcctgggccccagccccacaggggacaggcccccaggtctcaccccgggcctcctgggggaagctggtcac
cagcaggggcagccggccggcagcagccaccatggaggcactggggctgtggagacccggagtcgtcacagctcctaccc
cgcggggccagaggatgatgaagggacggaggaggaggatctcggcccctttaggggccgctcgcgttcggcgcccccca
acctctgggctgcacagcgatatggccgcgagctccgaaggatgagcgacgagtttcacgtctccttcaaggggcttcct
cgcccgaagagcgcgggaacggcaacgcaaatgcgacaaagccctagctggacgcgcttcctccagtcctggttgagccg
gaacttggggaggggaggctccgccccctcccagtga
>gnl|bcl2dbcds|A0A452ER54_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Capra hircus GN=BAD (length=528 residues).
tatcgggcttgggcccagagcatgttccagatcccagagtttgagcagagtgagcaggaagactccagccctgcagatag
gggcctgggccccagccccacaggggacaggcccccaggtctcagcaagcactggctaacagccccgggcctcctggggg
aagctggtcaccagcaggggcagccggccggcagcagccaccatggaggcactggggctgtggagacccggagtcgtcac
agctcctaccccgcggggccagaggatgatgaagggacggaggaggaggatctcggcccctttaggggccgctcgcgttc
ggcgccccccaacctctgggctgcacagcgatatggccgcgagctccgaaggatgagcgacgagtttcacgtctccttca
aggggcttcctcgcccgaagagcgcgggaacggcaacgcaaatgcgacaaagccctagctggacgcgcttcctccagtcc
tggttgagccggaacttggggaggggaggctccgccccctcccagtga
>gnl|bcl2dbcds|A0A452EST2_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Capra hircus GN=PMAIP1 (length=165 residues).
atgcctggaaggagggctcgtaggagcgcccagccgagccccacgcgggtcccggcagatcctgaagttgagtgtgccat
tcagttgaggagaattggagacaaactgaatttccggcagaaacttgtgaatctgatagccaaactcctccgctcaggaa
cttga
>gnl|bcl2dbcds|A0A452F2E0_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Capra hircus GN=BMF (length=555 residues).
atggagccaccccagtgtgtggaggagctggaggatgacgtattccagccagaggatggggaaccaggggcccagcccag
gaggttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgcctgcagctcttccctctcacgc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggctacccagactctcagcccagcttccccgagccag
ggtgtcatgctgccttgtggggtgactgaggagccccagcgactcttttatggcaatgctggctaccggctcccccttcc
tgccagtttccctgcaggcttgccccttggtgagcaaccccctgaagggcagtggcaacatcgagcagagatacagattg
cccgaaaactccagtgcattgcagaccagttccatcggcttcatatgcagcaacatcagcagaaccgaaatcgcatgtgg
tggcagatcctcctcttcctgcacaacgtggctttgaatggagatgagaacaggaatggggcaggccccaggtga
>gnl|bcl2dbcds|A0A452F2E0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Capra hircus GN=BMF (length=555 residues).
atggagccaccccagtgtgtggaggagctggaggatgacgtattccagccagaggatggggaaccaggggcccagcccag
gaggttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgcctgcagctcttccctctcacgc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggctacccagactctcagcccagcttccccgagccag
ggtgtcatgctgccttgtggggtgactgaggagccccagcgactcttttatggcaatgctggctaccggctcccccttcc
tgccagtttccctgcaggcttgccccttggtgagcaaccccctgaagggcagtggcaacatcgagcagagatacagattg
cccgaaaactccagtgcattgcagaccagttccatcggcttcatatgcagcaacatcagcagaaccgaaatcgcatgtgg
tggcagatcctcctcttcctgcacaacgtggctttgaatggagatgagaacaggaatggggcaggccccaggtga
>gnl|bcl2dbcds|A0A452FCR6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Capra hircus GN=BCL2L11 (length=588 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagaccaggggcccccacctctttacagacagagcggcaaggtaatcctgaaggagaaggggaccgctgcccccaag
gcagcccgcagggcccgctggccccaccggccagccccggccctttcgctaccagatccccgctcttcatcttcgtgaga
agatcctccttgctgtctcggtcctccagcgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatccacacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagtttaatgcgtat
tacccaagaagggtcttcgtgcgtcaccaggcgattgagggccacccacaaatggtcctcctgcgcgtcttgcgctacct
ggtgcgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A452FCR6_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Capra hircus GN=BCL2L11 (length=420 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagaccaggggcccccacctctttacagacagagcggcaagacaggagcccggcacccatgagttgtgacaaatcca
cacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgta
cctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagtttaatgcgtattacccaag
aagggtcttcgtgcgtcaccaggcgattgagggccacccacaaatggtcctcctgcgcgtcttgcgctacctggtgcgtc
tggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A3G3M2M0_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Carassius auratus GN=BCL2L11 (length=546 residues).
atgtctgacacgtccagagagcaaacgccgggtaatgtcccggcgtcgcggggaagtggagagagcgccggtgtcggagc
tgcgttgcgccccgggcactttgacttccctcagccgagcgatggggacccgttaaggggagggattgccatgtcgaata
gtcaccagtcgaggtcaccgatgtcccgaaccttctccaggtcctctagtggctatttttccgtcgacagcgattctgtg
ccgggttctccgctattgcccaatatttccgaagcgcaagacgaccaaaatgatgaggtatggtttgccgaacctagcca
ccagcacgtgcagatggcagcacctgtgggagccatggggccggagatttcggtcgctcgggagctgcggcgcattggag
acgagttcaaccgcttgtactgtcaaggggccggtgcaggtgggaacaacagagcccagctgcatgctcccaatgaacac
gccatcatcatgtggatgaacgaccttatcggacgtgtagtacagtttttcctgcgaagaagatga
>gnl|bcl2dbcds|A0A250YBU3_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Castor canadensis GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctctccggagcccgtagagggcttagctcgcgacggcccgcgccccttcccgct
cggtcgcctggtgccctcggccgtgtcctgcggcctctgcgagccgggcctgcccgccgccccagccgccccggccctgc
tgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcaccgcagccttggggggcccccgctggcctggaggt
ccccgcagccggccccgaggcccgcgtccggatggtcctcagccatcactatcaccagcccagcagcacctagagtcacc
cgtgcccagcgtcccggaggccctggcgggcggccccacccaggcggcccccggagtccggggggaggaggagcagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaagagcaa
cagcaacaccgcccctcgccctggagggtgctgtacaatgtcatcatgggactcctgcccttacccaggggcccgggagc
cccggagatggagcccaattag
>gnl|bcl2dbcds|A0A250YBU3_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Castor canadensis GN=BBC3 (length=756 residues).
atgaaattgagtgtgggggctgcccgggcatgttcgtgccaggtgcccagggttgcctcctgtgggtgggcccacgccct
atttgtgtggagcctggctaggtgtgcacagtctggagtatgtcctgccagtgggccagttagcaggaacctgtcacagg
ccccagggagcgccatggcccgcgcacgccaggagggcagctctccggagcccgtagagggcttagctcgcgacggcccg
cgccccttcccgctcggtcgcctggtgccctcggccgtgtcctgcggcctctgcgagccgggcctgcccgccgccccagc
cgccccggccctgctgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcaccgcagccttggggggccccc
gctggcctggaggtccccgcagccggccccgaggcccgcgtccggatggtcctcagccatcactatcaccagcccagcag
cacctagagtcacccgtgcccagcgtcccggaggccctggcgggcggccccacccaggcggcccccggagtccgggggga
ggaggagcagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcgga
gacaagaagagcaacagcaacaccgcccctcgccctggagggtgctgtacaatgtcatcatgggactcctgcccttaccc
aggggcccgggagccccggagatggagcccaattag
>gnl|bcl2dbcds|A0A250YBV9_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Castor canadensis GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttccgatgcaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggctcctacctccctacagacagagccgccaggtaatcctgaaggcagtcccgcaggcgaaggggatc
gctgtccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcttccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
tgaggcagtctcaggtggaacccatggacatgcgcccagagatttggatcgcacaagagttgcgacgtatcggagacgaa
ttcaatgcatattacccaaggagggtatttttgaataattaccaaggagtggaagaccacccccaaatggttatcttacg
actgttacgttacatcatccgtctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A250YBV9_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Castor canadensis GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgcaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggctcctacctccctacagacagagccgccagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggtggaa
cccatggacatgcgcccagagatttggatcgcacaagagttgcgacgtatcggagacgaattcaatgcatattacccaag
gagggtatttttgaataattaccaaggagtggaagaccacccccaaatggttatcttacgactgttacgttacatcatcc
gtctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A286XF37_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Cavia porcellus GN=PMAIP1 (length=309 residues).
atgcctggaaaggtgtgtaagagcgcgcagccgaactccacgcgggcagagctagaagttgagtgtgctgcccagctcag
gagagttggagacacactgaattccctgggttgcaccacggaggccttggaggtgcttgcagagatggctgggaagaagg
cgcggaagagctcggagccggatccggcacgggcgcgcgcggagctggaagtcgagtgtgctgctcagttgagaagaatt
ggagataaactgaatttccagcagaaacttatgtatttgatttccaaactcatcagtttggtaacctga
>gnl|bcl2dbcds|A0A286XJN2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Cavia porcellus GN=BCL2L11 (length=591 residues).
atggccaagcaaccttccgatgtaagttgtgagtgtgacagagaaggtggacaattgcagcctgctgagaggccatccca
gctcagggctggggccccaacctccctacagacggagccccaaggtaatcctgaaggcgcaggggaccgctccccccacg
gcagccctcagggcccgctggccccaccggccagtcctggcccttttgctaccagatccccgctattcatctttgtgaga
agatcttccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctggacctccgcatttgcgcccagagatatggatcgcacaggaattgcgtcgcatcggagatgagtttaatgcctcg
tacccaaggcgggtgttcttgaatcattaccagcccgctgaagaccaaccccaaatggttatcttgcgattgttacgtta
cattatccgcctggtatggcgaatgcattga
>gnl|bcl2dbcds|A0A286XJN2_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Cavia porcellus GN=BCL2L11 (length=423 residues).
atggccaagcaaccttccgatgtaagttgtgagtgtgacagagaaggtggacaattgcagcctgctgagaggccatccca
gctcagggctggggccccaacctccctacagacggagccccaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgga
cctccgcatttgcgcccagagatatggatcgcacaggaattgcgtcgcatcggagatgagtttaatgcctcgtacccaag
gcgggtgttcttgaatcattaccagcccgctgaagaccaaccccaaatggttatcttgcgattgttacgttacattatcc
gcctggtatggcgaatgcattga
>gnl|bcl2dbcds|A0A286XJN2_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Cavia porcellus GN=BCL2L11 (length=591 residues).
atggccaagcaaccttccgatgtaagttgtgagtgtgacagagaaggtggacaattgcagcctgctgagaggccatccca
gctcagggctggggccccaacctccctacagacggagccccaaggtaatcctgaaggcgcaggggaccgctccccccacg
gcagccctcagggcccgctggccccaccggccagtcctggcccttttgctaccagatccccgctattcatctttgtgaga
agatcttccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctggacctccgcatttgcgcccagagatatggatcgcacaggaattgcgtcgcatcggagatgagtttaatgcctcg
tacccaaggcgggtgttcttgaatcattaccagcccgctgaagaccaaccccaaatggttatcttgcgattgttacgtta
cattatccgcctggtatggcgaatgcattga
>gnl|bcl2dbcds|A0A286XXB0_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Cavia porcellus GN=BMF (length=711 residues).
atgcccggggcgggcgtattttggaaacaataccgcgcgcgccgccgccgccgcggacccgaccccccccgagtgttcgt
cacgctggaccctggcacagagccctggcaccacgactcggaggccgattctctctcctggagtcacccaggggagatgg
agccacctcagtgtgtggaggagctggaggatgatgtgttccaacccgaggatggggagccggggacccagcctgggagc
ctgctctctgctgatctctttgcccagagccagctggactgtccccttggtcggctgcacctctttcctctcacccactg
ctgtggccctgggcttcgccccaccagccaggaagacaaggccactcagaccctcagcccatcctctccaagccagggtg
tcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggcttcctctccctgcc
agtttccctgcaggcttgccccttggggagcagccccctgaaggtcagtggcaacatcgagcagaggtacagatcgcccg
gaagcttcagtgcattgcagaccagttccaccgacttcacattcaacaacaccaacagaaccggaatcgcgcatggtggc
aggtcttactcttcatgcacaacctgggtctgaacggagaagagaacagggaaggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A286XXB0_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Cavia porcellus GN=BMF (length=570 residues).
gttttcccaagggagatggagccacctcagtgtgtggaggagctggaggatgatgtgttccaacccgaggatggggagcc
ggggacccagcctgggagcctgctctctgctgatctctttgcccagagccagctggactgtccccttggtcggctgcacc
tctttcctctcacccactgctgtggccctgggcttcgccccaccagccaggaagacaaggccactcagaccctcagccca
tcctctccaagccagggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggcta
ccggcttcctctccctgccagtttccctgcaggcttgccccttggggagcagccccctgaaggtcagtggcaacatcgag
cagaggtacagatcgcccggaagcttcagtgcattgcagaccagttccaccgacttcacattcaacaacaccaacagaac
cggaatcgcgcatggtggcaggtcttactcttcatgcacaacctgggtctgaacggagaagagaacagggaaggggcagg
tcccaggtga
>gnl|bcl2dbcds|H0V608_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Cavia porcellus GN=BAD (length=501 residues).
atgttccagatcccagagtttgagccaagtgagcaggaagactccagctctgaagagaggggcctgggccccagccccac
aggggacgagctaggcagcagcccagcaggaggcttcctgggggacaccagtcaccagcagaggcagctgagaagcagca
ggagccaccatggaggcactgtggctatggagacccggagtcgccaccggtcttatcctgcagggactgaggaggaggaa
gggatggaggaggagctcagtccattccggggccgctcgcgctcggcgccacccaacctctgggctgcacagcgctacgg
ccgagagctccggaggatgagcgacgagttcgtggactccttcaagggtcttcctcgcccgaagagcgcgggcacagcga
cgaagctgtggcagaactctaattggacacgggccatccagtcctggtgggatcggaacttggggagaggaggctccgcc
ccctcccaggagtcggtctga
>gnl|bcl2dbcds|H0W025_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Cavia porcellus GN=BIK (length=477 residues).
atgtcggaagcaaaacctgtcgccagggacccactgatggagaccccgctgtttgagccaccccctgggcctctgctggc
tgaaggggctttgggtgtgacgcagccactgtgggcagaggacctcagtccccctggggacactaacctcatggaatgcg
tggaaggcagcagcctggtggccctgcggctggcctgcatcggtgacgagatggacctgcgcctacggagcccccgcctg
gcccagctgccagggagggcagtgcacagcctggccatcacttacagccagatggggctctggggtgtgctcggaaggct
gaccctcagtctcgccagcctcagggacaatgtgtgggcctgtggacgcccagcctcccgtgcctgggtgtccccccgct
ggacctgcaggtggctgctgcctgtgctgctgttgctgctgctgctgctggggaccctgcgcctgctgctgcagtga
>gnl|bcl2dbcds|A0A2K5PDB1_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Cebus capucinus imitator GN=BAD (length=504 residues).
atgttccagatcccagagtttgagccgagtgagcaggaaggctccagctctgcagagaggggcctgaaccccagcaccgc
aggggacagccccccaggctctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcaccagcagggac
agccaaccagcagcagccaccatggaggcgctggggctgtggagacccggagtcgccacagatcgtaccccgcagggacg
gaggaggacgaagggatggaggaggagcccagcacctttcggggccgttcgcgctcggcaccccccaacctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagttcgtggactcctttaagggacttcctcgcccgaagagcg
cgggcacagcaacgcagatgcggcaaagcgccagctggacgcgagtcatccagtcctggtgggatcggaacttgggcagg
ggaggatccgctccctcccagtga
>gnl|bcl2dbcds|A0A2K5PDB1_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Cebus capucinus imitator GN=BAD (length=450 residues).
atgttccagatcccagagtttgagccgagtgagcaggaaggctccagctctgcagagaggggcctgaaccccagcaccgc
aggggacagccccccaggctctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcaccagcagggac
agccaaccagcagcagccaccatggagagaatcccagtgcaaggatgctctcgaaaacatcagcagggatgtcttcccca
gccactgactcagaagcccaacacacagagaatgtaaagctggaggcgctggggctgtggagacccggagtcgccacaga
tcgtaccccgcagggacggaggaggacgaagggatggaggaggagcccagcacctttcggggccgttcgcgctcggcacc
ccccaacctctgggcagcacagcgctatggccgcgagctccggaggatga
>gnl|bcl2dbcds|A0A2K5PIE7_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Cebus capucinus imitator GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtttgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccagcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A2K5Q1Y0_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Cebus capucinus imitator GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctacttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A2K5Q1Y0_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Cebus capucinus imitator GN=BCL2L11 (length=525 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctacttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggaggatatctcttccatctgattga
>gnl|bcl2dbcds|A0A2K5QNS7_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Cebus capucinus imitator GN=BBC3 (length=396 residues).
atgaaatgtggcgtggggtctgcctgggcatgtccatgccaagtgcccagggcttcttcctcggtgtgggttccttgcca
gatgtgtggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctgg
cgggcggtcccacccaggcggccctgggagtccgcggggaggaggagcagtgggcccgggagatcggggcccagctgcag
cggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagccgcagcaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgccctttcccaggggccacagagcccccgagatggagcccaattag
>gnl|bcl2dbcds|A0A2K5QQC6_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Cebus capucinus imitator GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagagcgcgcaaccgagccccgcgccggctccagcagaccttgaagtcgagtgtgctac
tcaactcaggagatttggagacaaactgaatttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaa
catga
>gnl|bcl2dbcds|A0A2K5QXZ1_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Cebus capucinus imitator GN=BIK (length=471 residues).
atgtctgaagaaagacccctctccattgacatcttgatggagaccctcctgtgtgagcagttcatggatcccctgaccat
ggaggttgtcggtggtgggagtgaccctgaagaggacctggaccctgtggaggacccgttggaatgcatggagaacagtg
acgcactggccctgcagctggcctgcatcgcggaccagatggatgtgagccttagggcccggaagctggcccagctctac
gaggtggccatgtacagcccgggtctcgctgtcacccttgaccagaccgacatcagggatgttctcggcggtattgtgga
cattttcgctaacttccaggaggacgtagtgaggctctggagatccctgagctccgggtcctgggtgtcccgcaaacagg
cagtgctgctggcattcctggcgctgctgctggcgacgttcagcgggggtctgcacctgctgctcaagtga
>gnl|bcl2dbcds|A0A2K5RN49_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Cebus capucinus imitator GN=BMF (length=390 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccagggacccaacccgg
gagcttgctctctgctgacctgtttgcccagagcctactggactgtcccctcagccggcttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatgcaccagcagaaccgaaatcgcgtgtggt
ggcaggtcctcctcttcctgcacaacctggctttgaatggagaagagaacaggaatggggcaggcctgag
>gnl|bcl2dbcds|A0A2K5RN49_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Cebus capucinus imitator GN=BMF (length=555 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccagggacccaacccgg
gagcttgctctctgctgacctgtttgcccagagcctactggactgtcccctcagccggcttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgccccttggggaacagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccagcttcatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcaggtcctcctcttcctgcacaacctggctttgaatggagaagagaacaggaatggggcaggcctgaggtga
>gnl|bcl2dbcds|A0A2K5KZ69_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Cercocebus atys GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgactgcagcgcgggtcgtttggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgcttggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcagcaggcggaacttgtag
>gnl|bcl2dbcds|A0A2K5LDM6_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Cercocebus atys GN=BIK (length=471 residues).
atgtctggagtaagacccatctccagagacacctggatggagaccctcctgtatgagcagctcctggaacccctaaccat
ggaggttcttggtgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttggagtgtatggaggaca
gtgacatgttggccctgcggctggcctgcatcggggacgagatggatgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctgggtctggctttcatctgcgaccagacggacgacatcagggatgttcttagaagttt
catggatggtttcaccacccttagggagaacataatgaggttctggagatccccgaatcccaggtcctgggtgtcccatg
aacaggtgctgctgctgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctcaagtga
>gnl|bcl2dbcds|A0A2K5M0A7_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Cercocebus atys GN=BAD (length=492 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagtctcgc
gggggacaggccctcagactgcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggggagcttggtattctccttcttgggaatctgaggactctgaaaatcccagt
gcaaggatgctcgcggaagcatcagcacggatgtctgccccagccactgactcagaagcccaacacgcagagaatgtaaa
gctgaaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacggaggaggacgaagggatgga
ggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|A0A2K5M0A7_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Cercocebus atys GN=BAD (length=471 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagtctcgc
gggggacaggccctcagactgcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctc
cagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctcccagtgaccttcgc
tccacgccccgaaactccacccgctctcactgtcctggtcggccatcttggatatgggcggaagtgcttccctcaggcct
tatgcaaaagaggatccgtgctgcctctttcggtgggagggctgacccagattcccttccggtgcatgtga
>gnl|bcl2dbcds|A0A2K5MJW4_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Cercocebus atys GN=BMF (length=390 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccaggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtaactgaggaaccccagcgactcttttacgcaccagcagaaccgaaatcgcgtgtggt
ggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcgggccctag
>gnl|bcl2dbcds|A0A2K5MJW4_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Cercocebus atys GN=BMF (length=555 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccaggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtaactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcgggccctaggtga
>gnl|bcl2dbcds|A0A2K5NJZ2_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Cercocebus atys GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccaatgcgggctcaggcagagctcgaagtcgagtgtgctac
tcaactcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|A0A2K5NU92_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2K5NU92_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|A0A2K5P2T8_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Cercocebus atys GN=BBC3 (length=396 residues).
ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccagggctgcttctgcgacgtgggtcctctgcca
gatttgtggtcctcagccctcgctcttgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccccgaaatggagcccaattag
>gnl|bcl2dbcds|A0A0D9QZY8_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Chlorocebus sabaeus GN=BIK (length=480 residues).
atgtctggagtaagacccatctccagacacatcttgatggagagcctcctgtatgagcagctcctggaacccctgaccat
ggaggttcttggtgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttggagtgtatggaggaca
gtgacatgttggccctgcggctggcctgcatcggggacgagatggacgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctgggtctggctttcatctacgaccagacggacgacatcagggatgttcttagaagttt
catagatggtttcaccacccttagggagaacataatgaggttctggagatccctgaatcccgggtcctgggtgtcccgcg
aacaggtgctgctggcgctgctgctgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctcaagtga
>gnl|bcl2dbcds|A0A0D9R491_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Chlorocebus sabaeus GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
agggaacaggccctcagactccggcaagcatcatcaccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagccccttccggggccgctcgcgctccgcgccccccaacctctgggcagc
acagcgttatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A0D9R4R5_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Chlorocebus sabaeus GN=BMF (length=555 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggagagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagacccttggcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtaactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcatgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcgggccctaggtga
>gnl|bcl2dbcds|A0A0D9RWE0_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Chlorocebus sabaeus GN=BCL2L11 (length=330 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctgca
gatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggaggtt
agagaaatag
>gnl|bcl2dbcds|A0A0D9S003_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Chlorocebus sabaeus GN=PMAIP1 (length=162 residues).
atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccaacgcgggctcaggcagagctcgaagtcgagtgtgctac
tcaactcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaa
cc
>gnl|bcl2dbcds|A0A0D9S2H2_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Chlorocebus sabaeus GN=BBC3 (length=600 residues).
caggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacgg
cccgcgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgccgccc
ccgccgcccccgccctgctgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctggggggc
ccccgctggcctgggggtccccgcagccggccccgaggcccacgcccggacggtcctcagccctcgctttcgctggcgga
gcagcacctggagtcgcccgtgcccagcgccccgggggccctggcgggcggtcccacccaggcggccccgggagtccgcg
gggaggaggaacagtgggcccaggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcgg
cggagacaagaggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctgccctt
acccaggggccacagagcccccgaaatggagcccaattag
>gnl|bcl2dbcds|A0A0D9SC73_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Chlorocebus sabaeus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcttggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgcttggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A2K5HKU7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Colobus angolensis palliatus GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcccggc
aggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
aggcaaccagcagcagccatcatggaggcgctggggctgtggagacccggagtcgccacagctcccaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccctaacctctgggcagc
acagcgatatggccgcgagctccggaggatgagtgacgagtttgtggactcttttaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A2K5HKU7_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Colobus angolensis palliatus GN=BAD (length=489 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcccggc
aggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
aggcaaccagcagcagccatcatggagggagagcttggtattctccttctgaatctgaggactctgaaaatcccagtgca
aggatgctcacggaagcatcagcagggatgtctgccccagccactgactcagaagcccaacacgcagagaatgtaaagct
ggaggcgctggggctgtggagacccggagtcgccacagctcccaccccgcggggacggaggaggacgaagggatggagga
ggagcccagcccctttcggggccgctcgcgctccgcgccccctaacctctgggcagcacagcgatatggccgcgagctcc
ggaggatga
>gnl|bcl2dbcds|A0A2K5HZI5_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtgttt
ttgaataa
>gnl|bcl2dbcds|A0A2K5HZI5_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|A0A2K5J4Q7_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Colobus angolensis palliatus GN=BIK (length=483 residues).
atgtctggagtaagacccatctccagagacatcttgatggagaccctcctgtatgagcagctcctggaacccctaaccat
ggaggttcttggtgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttggagtgtatggaggaca
gtgacatgttggccctgcggctggcctgcatcggggatgagatggacgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctgggtctggctttcatctacgaccagaccgacgacatcagggatgttcttagaagttt
catggacggcttcaccacccttaaggagaacataatgaggttctggagatccccgaatcccgggtcccgggtgtcccgcg
aacaggtgctgctggcgctgctgctgctgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctcaag
tga
>gnl|bcl2dbcds|A0A2K5JY17_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccagcgcgggctcaggcagagctcgaagtcgagtgtgctac
tcaactcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|A0A2K5JY17_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=PMAIP1 (length=372 residues).
atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccagcgcgggctcaggcaggtactgacccgctggggccagc
gaagacccaggctgggcggggtcggggccggggcaaaaagctcctctcctccccacttgcccttccgcggggccacgagg
aacaagtgcaagtagctcgaagtcgagtgtgctactcaactcaggagatttggagacaaactgaacttccggcagaaact
tctgaatctgatagccaaactcttctgctcaggaacctgactgcaacaaaaacttgcatgaggggactccaaaagagaat
ttttctcaggaggtgcacatttcatcaatttgaagcaagattgcattgtaat
>gnl|bcl2dbcds|A0A2K5KGP2_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Colobus angolensis palliatus GN=BMF (length=555 residues).
atggagccatctcggtgtgtggaggagctggaggatgacgtgttccagccggaggacggggagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcttacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtaactgaggaaccccagcgactgttttatggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcgggccccaggtga
>gnl|bcl2dbcds|A0A2K5KGP2_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Colobus angolensis palliatus GN=BMF (length=507 residues).
atggagccatctcggtgtgtggaggagctggaggatgacgtgttccagccggaggacggggagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcttacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtaactgaggaaccccagcgactgttttatgcaccagcagaaccgaaatcgcgtgtggt
ggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcgggccccaggtgaggctgg
gctgccctcttcacatggggcaccaggaacaccgtcaggaaggacatcgggcaggactgacactgtgtcttgtgaagttg
tttttttgttgttattttgcgttttaa
>gnl|bcl2dbcds|A0A0P0HZF9_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Ctenopharyngodon idella GN=PMAIP1 (length=138 residues).
atggcgaagaaagagaaaaccgctgttgtcgagtgcgcgcaacagttgcgcacaattggagatctctttgactggaaata
caagttactggaaatcataatcgcgctccagaaagcgcagacggacggaaaaagatga
>gnl|bcl2dbcds|A0A3P8UA78_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Cynoglossus semilaevis GN=BMF (length=522 residues).
atggatgacgaggaggacgatgtctttgagccagacccgcacagctggcacacaacattcagggagataaggtgtgaaga
ccggggcacacagacacctggtccagacctggcactgaacaacggcatgctgccctgtggggtgggagaggagcccagac
cactcttctacggcaacgcaggctttcgattgcacttcccagctcactttgagctaattggagatcgggaaacaaggaga
agacaaagtgacgaggagcgaaataggatggagccgcggccccagcagcagcagcagcagcagcggcagcagcagcagca
gcctgtgcagcgcagcgtggaggtccgcattggccagaaactccagctaataggagaccagttccaccgggatcatctgc
agctgtatcatcgaaaccaaaggaaccacgggccgctgtggtggcgcctgaccacaactctgctcagccttctgttcaac
agagggttctttgctgggggaggcgcagcgggacggaggtga
>gnl|bcl2dbcds|A0A3P8UA78_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Cynoglossus semilaevis GN=BMF (length=522 residues).
atggatgacgaggaggacgatgtctttgagccagacccgcacagctggcacacaacattcagggagataaggtgtgaaga
ccggggcacacagacacctggtccagacctggcactgaacaacggcatgctgccctgtggggtgggagaggagcccagac
cactcttctacggcaacgcaggctttcgattgcacttcccagctcactttgagctaattggagatcgggaaacaaggaga
agacaaagtgacgaggagcgaaataggatggagccgcggccccagcagcagcagcagcagcagcggcagcagcagcagca
gcctgtgcagcgcagcgtggaggtccgcattggccagaaactccagctaataggagaccagttccaccgggatcatctgc
agctgtatcatcgaaaccaaaggaaccacgggccgctgtggtggcgcctgaccacaactctgctcagccttctgttcaac
agagggttctttgctgggggaggcgcagcgggacggaggtga
>gnl|bcl2dbcds|A0A3P8UA78_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Cynoglossus semilaevis GN=BMF (length=522 residues).
atggatgacgaggaggacgatgtctttgagccagacccgcacagctggcacacaacattcagggagataaggtgtgaaga
ccggggcacacagacacctggtccagacctggcactgaacaacggcatgctgccctgtggggtgggagaggagcccagac
cactcttctacggcaacgcaggctttcgattgcacttcccagctcactttgagctaattggagatcgggaaacaaggaga
agacaaagtgacgaggagcgaaataggatggagccgcggccccagcagcagcagcagcagcagcggcagcagcagcagca
gcctgtgcagcgcagcgtggaggtccgcattggccagaaactccagctaataggagaccagttccaccgggatcatctgc
agctgtatcatcgaaaccaaaggaaccacgggccgctgtggtggcgcctgaccacaactctgctcagccttctgttcaac
agagggttctttgctgggggaggcgcagcgggacggaggtga
>gnl|bcl2dbcds|A0A3P8WI83_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Cynoglossus semilaevis GN=BAD (length=537 residues).
atgaatgtagaagtgtccatctttccagatgtcacaatggctgcacagttcactatatcggacagcgaatccgagccgga
ggaggaagtcgagggaggaaaaattaagcattcattgaatgacccagaacaggttgtacctcaccggcacaacctcaccc
tacctgagctcagggtggcaggaagtcgtcggatcaggctaaattcagagtcacatgcttcaaccatttccagagaggaa
gccttccagtcctggggggaggaagaagccggaacgcccacagaaggagctcctttcaggggacggtccaggtcagctcc
tcctgccctgtgggcagcaaagaagtatggcaggcagctccgcaggatgagtgatgaatttgacagcctgctggacaaag
ggatgaggaaggtgaagagcgcaggcacagccagacagatgcaccactccaaaagctggtggagctacctctttagtcac
caggagctggaaggagaaaacaaccatcacgagaaccacactcaccgcactgagtag
>gnl|bcl2dbcds|A0A3P8WI83_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Cynoglossus semilaevis GN=BAD (length=501 residues).
atggctgcacagttcactatatcggacagcgaatccgagccggaggaggaagtcgagggaggaaaaattaagcattcatt
gaatgacccagaacaggttgtacctcaccggcacaacctcaccctacctgagctcagggtggcaggaagtcgtcggatca
ggctaaattcagagtcacatgcttcaaccatttccagagaggaagccttccagtcctggggggaggaagaagccggaacg
cccacagaaggagctcctttcaggggacggtccaggtcagctcctcctgccctgtgggcagcaaagaagtatggcaggca
gctccgcaggatgagtgatgaatttgacagcctgctggacaaagggatgaggaaggtgaagagcgcaggcacagccagac
agatgcaccactccaaaagctggtggagctacctctttagtcaccaggagctggaaggagaaaacaaccatcacgagaac
cacactcaccgcactgagtag
>gnl|bcl2dbcds|A0A3Q2CXC4_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Cyprinodon variegatus GN=BMF (length=492 residues).
atggaggaggaggaggatgatgtgtttgagccagatcccaacagctggcacacaccattcagggagataaagtttgaaga
ccggggcacacaaacgcccggtcctggcgtggcaccacataacgttatgctgccctgtggagttgtggaggagcccagac
cacttttctaccgtaacgcaggttttcgattgcacttcccagcacattttgagcttgtcggggattttgacgtaaggcga
caagcggagcacaacaggatggagcagttacctttgcaacagccggcagcactcagcttggaggcctgcatcgggcagaa
acttcagataataggcgaccagtttcaccgggaacacttacaacagatcccaggacagcccttcccccacctagttcacc
aacaccaggcccttaccctgcctcctcttcctgtttatttctctctcctttcccctgtggtcccgttgtgctgtggaggc
aagtggcattga
>gnl|bcl2dbcds|A0A3Q2CXC4_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Cyprinodon variegatus GN=BMF (length=474 residues).
atggaggaggaggaggatgatgtgtttgagccagatcccaacagctggcacacaccattcagggagataaagtttgaaga
ccggggcacacaaacgcccggtcctggcgtggcaccacataacgttatgctgccctgtggagttgtggaggagcccagac
cacttttctaccgtaacgcaggttttcgattgcacttcccagcacattttgagcttgtcggggattttgacgtaaggcga
caagcggagcacaacaggatggagcagttacctttgcaacagccggcagcactcagcttggaggcctgcatcgggcagaa
acttcagataataggcgaccagtttcaccgggaacacttacaacagtatcatcaaaaccaaaggaatcaggggccgctgt
ggtggcgcatgactgcagctcttctcagcctcctgtttgatagggggttgattggtggagcaggatggaggtga
>gnl|bcl2dbcds|A0A3Q2D5S0_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Cyprinodon variegatus GN=BAD (length=492 residues).
atggctcagtcggtagagacttcggatcctattatggctgcaacctttaccatttcagacagcgacactgagccatcaga
ggaggtggaggaaacaagaaacaaggagccaaggatacgaaacagtgggaaaacacatcgtcggatcagactgagctcgg
agtctcacgctttcaccagagaggaggaggccaggggggaggaggaggtcgggacccccactgagggctatccattcagg
ggccgatctaattcagctcctccagctctgtgggctgccaagaagtacggccggcagcttcgaaggatgagtgatgagtt
tgtcaccctgcttgataaaggggagttgaggaaggtgagcagcacggggacgaacagaccaatacgccattccaagagct
ggtggagctacctcttcagtcaccaggagatggagggagagaacagtcaccatgaaaaccacacgcaatgcactgaacaa
agaggagaataa
>gnl|bcl2dbcds|A7MCM4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Danio rerio GN=BAD (length=444 residues).
atggcacatatgtttaatatctccgatgattcagagacagaaacaatggaagacagtgaagcctcaagcctggataaaca
caagagtgggtcggcacagaaaaagcagcacctcactgttcctgataggctgaaaggagagcaactgggcagacagagga
acctctcgatgaatgaggaggacttgctggaaactggagttgcagaagatcctcatatgcttggggatcctttcaggccg
agatcccgctcagctcctcctgctttgtgggcagctaagaaatacggccaacagctgagaagaatgagtgatgagtttga
taaagggcagatgaagagagtaaaaagtgcaggaactgcgcgtcagatgagtcaatcgcccagctggttggcatttcttt
ggagtcacaaagagtctgatgcggagtcgcgccccgcagagtga
>gnl|bcl2dbcds|B2KKY9_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Danio rerio GN=BCL2L11 (length=531 residues).
atgtctgacacgtccagagagcaaacgctggccaatggcccggcctcgcagggaagcggagagagcaccggtggcggagt
ggtgttgcccgccgggcactttgatttccctcagccgggcgaaggggacccgttaaggggagggatatccatgtcgaata
accagtcgaggtcaccgatgaaccggactttctccaggtcctctagtggctatttttccgtcgacagcgattctgtgcca
ggttcccctctaatgcccaatatttccgaagcgcaagacggacaaaatgatgaggtatggttatcagaacatagccacca
gcacttgcagatggcagcaccagtcgcagccctgccgccggagatggtggtcgctcgtgaactgcgacgcataggcgatg
agttcaatcgcctctactgtgaggccggagcaggagtgaaccagctgcgtgctcccaacgaacacgccatcgtcctgtgg
atgaacgtcattatcggacgcctagtacactttttcctgcgaagaagatga
>gnl|bcl2dbcds|B8JK68_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Danio rerio GN=BCL2L11 (length=531 residues).
atgtctgacacgtccagagagcaaacgctggccaatggcccggcctcgcagggaagcggagagagcaccggtggcggagt
ggtgttgcccgccgggcactttgatttccctcagccgggcgaaggggacccgttaaggggagggatatccatgtcgaata
accagtcgaggtcaccgatgaaccggactttctccaggtcctctagtggctatttttccgtcgacagcgattctgtgcca
ggttcccctctaatgcccaatatttccgaagcgcaagacggacaaaatgatgaggtatggttatcagaacatagccacca
gcacttgcagatggcagcaccagtcgcagccctgccgccggagatggtggtcgctcgtgaactgcgacgcataggcgatg
agttcaatcgcctctactgtgaggccggagcaggagtgaaccagctgcatgctcccaacgaacacgccatcgtcctgtgg
atgaacgacattatcggacgcctagtacactttttcctgcgaagaagatga
>gnl|bcl2dbcds|E7FBJ6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Danio rerio GN=BAD (length=438 residues).
atggagaacacctcgcatgaccatcaagatgattccagcaccttggatgaaaaagagagatcacatctgaaagggacaat
caagaaccatggacaacatcaggatcgaacatcggccaacatttctcctcaagggcgtgtgcggctctattcggaatctc
aagtgtatacagtcagccgctggcaggacacagagacccaggatggagcatcggtggaggagaacggagatggacttcca
ttcaggggtcgttctcaatcagcacctgctgcactgtggaaagcaaaaaagtatggccgtcagttgaggagaatgagcga
tgaattcgacacatggctcgataaaggggtgagtaagacaccgaacagccagaaacagacctaccgaggatggttttcgt
tcctctggagtcccaaagaagaagagggcagagaatga
>gnl|bcl2dbcds|Q0GKC7_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Danio rerio GN=BMF (length=429 residues).
atggatgaggacgaggatgatgtgttcaggaagggtctccagcactggcctcctccccacctgcagataaagcagactga
gttggcaggacgtcccgctgggtcacgcaacggtatgctgctctgccggcatctccagcagcacggacactttctctacg
gtaacgcagaattgctggttctagctgcgtccagccgcgctcagcctccagacgtggtgttacggcagaacgtctcaccg
atggagcgaccagagccccgacctgcacagagcgtggaaaccctcatcggacagaagctgcagctgattggagatcagtt
ctatcaggagcacatcatgcatcatcaaaggccgcaggatccgctgtggaggcgtgtggcgacggccgtcctcacgctgc
tgttcggcgccagagagaaccgcaggtga
>gnl|bcl2dbcds|Q0GKC8_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Danio rerio GN=PMAIP1 (length=138 residues).
atggcgaagaaagagcaaaccgctgtagtagagtgcgcgcagcagttgcgaaacattggagatctgttgaactggaaata
taagttactggagctcatagtaacactccagaaaatacaaatggaggggaagcgatga
>gnl|bcl2dbcds|Q4V925_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Danio rerio GN=BAD (length=444 residues).
atggcacatatgtttaatatctctgatgattcagagacagaaacaatggaagacagtgaagactcaagcctggataaaca
caagagtgggtcggcacagaaaaagcagcacctcactgttcctgataggctgaaaggagagcaactgggcagacagagga
acctctcgatgaatgaggaggacttgctggaaactggagttgcagaagatcctcatatgcttggggatcctttcaggccg
agatcccgctcagctcctcctgctttgtgggcagctaagaaatacggccaacagctgagaagaatgagtgatgagtttga
taaagggcagatgaagagagtaaaaagtgcaggaactgcgcgtcagatgagtcaatcgcccagctggttggcatttcttt
ggagtcacaaagagtctgatgcggagtcgcgccccgcagagtga
>gnl|bcl2dbcds|Q4V925_BAD-04 BCL2-associated agonist of cell death gene OS=[Eukaryota] Danio rerio GN=BAD (length=444 residues).
atggcacatatgtttaatatctctgatgattcagagacagaaacaatggaagacagtgaagactcaagcctggataaaca
caagagtgggtcggcacagaaaaagcagcacctcactgttcctgataggctgaaaggagagcaactgggcagacagagga
acctctcgatgaatgaggaggacttgctggaaactggagttgcagaagatcctcatatgcttggggatcctttcaggccg
agatcccgctcagctcctcctgctttgtgggcagctaagaaatacggccaacagctgagaagaatgagtgatgagtttga
taaagggcagatgaagagagtaaaaagtgcaggaactgcgcgtcagatgagtcaatcgcccagctggttggcatttcttt
ggagtcacaaagagtctgatgcggagtcgcgccccgcagagtga
>gnl|bcl2dbcds|Q4V925_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Danio rerio GN=BAD (length=441 residues).
atggcacatatgtttaatatctctgatgattcagagacagaaacaatggaagacagtgaagactcaagcctggataaaca
caagagtgggtcggcacagaaaaagcagcacctcactgttcctgataggctgaaaggagagcaactgggcagacagagga
acctctcgatgaatgaggaggacttgctggaaactggagttgcagaagatcctcatatgcttggggatcctttcaggccg
agatcccgctcagctcctcctgctttgtgggcagctaagaaatacggccaacagctgagaagaatgagtgatgagtttga
taaagggatgaagagagtaaaaagtgcaggaactgcgcgtcagatgagtcaatcgcccagctggttggcatttctttgga
gtcacaaagagtctgatgcggagtcgcgccccgcagagtga
>gnl|bcl2dbcds|Q4V925_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Danio rerio GN=BAD (length=441 residues).
atggcacatatgtttaatatctctgatgattcagagacagaaacaatggaagacagtgaagactcaagcctggataaaca
caagagtgggtcggcacagaaaaagcagcacctcactgttcctgataggctgaaaggagagcaactgggcagacagagga
acctctcgatgaatgaggaggacttgctggaaactggagttgcagaagatcctcatatgcttggggatcctttcaggccg
agatcccgctcagctcctcctgctttgtgggcagctaagaaatacggccaacagctgagaagaatgagtgatgagtttga
taaagggatgaagagagtaaaaagtgcaggaactgcgcgtcagatgagtcaatcgcccagctggttggcatttctttgga
gtcacaaagagtctgatgcggagtcgcgccccgcagagtga
>gnl|bcl2dbcds|A0A1S3EQA2_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Dipodomys ordii GN=BMF (length=546 residues).
attgtcccaggggagatggagccgcctcagtgtgtggaggagctggaggacgatgtgttccaagcagaagacggggagcc
agggacccagccggggagcctgctctctgctaccctgtttgcccagagtcagctggactgccccctcagccggcttcagc
tcttccctctcacccactgctgtggcccaggacttcgacccaccagccaggaagacaaggccactcagaccctcagcccg
gcctcccccagccagggtgtcatgctgccctgtggggtgactgaagagccccagcgactcttttatggcagtgctggcta
ccggctcccactccctgccggtttccccgcagcccagcagccccccgaaggccaccgcgtggaggtgcagatcgcccgga
agctgcagtgcatcgccgatcagttccatcggcttcatacgcagcggcaccagcagcaccgggaccgagcttgggggcag
gtcctcctcttcctgcacaacctggccttgaaccgagaaaacagggaccgggcgggccccaggtga
>gnl|bcl2dbcds|A0A1S3EQA2_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Dipodomys ordii GN=BMF (length=531 residues).
atggagccgcctcagtgtgtggaggagctggaggacgatgtgttccaagcagaagacggggagccagggacccagccggg
gagcctgctctctgctaccctgtttgcccagagtcagctggactgccccctcagccggcttcagctcttccctctcaccc
actgctgtggcccaggacttcgacccaccagccaggaagacaaggccactcagaccctcagcccggcctcccccagccag
ggtgtcatgctgccctgtggggtgactgaagagccccagcgactcttttatggcagtgctggctaccggctcccactccc
tgccggtttccccgcagcccagcagccccccgaaggccaccgcgtggaggtgcagatcgcccggaagctgcagtgcatcg
ccgatcagttccatcggcttcatacgcagcggcaccagcagcaccgggaccgagcttgggggcaggtcctcctcttcctg
cacaacctggccttgaaccgagaaaacagggaccgggcgggccccaggtga
>gnl|bcl2dbcds|A0A1S3FFM9_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Dipodomys ordii GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtggacagttgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagagcagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccctgccaggccttcaaccattatctcagcgcaatggcttccatgaggcagtctcaggaagag
cctgcagatttgcgcccagagatatggatcgcccaggaattgcggcgtattggagacgagtttgatgcctattatccaag
gagggtatttttgaataattaccaagcagccgaagaccaaccccaaatggttatcttacggctgttacgttacatcattc
gcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A1S3FFM9_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Dipodomys ordii GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtggacagttgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagagcagcaaggtaatcccgaaggcagtcccgaaggcgaaggggacc
gctgcccccaaggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcttccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccctgccaggccttcaaccattatctcagcgcaatggcttcca
tgaggcagtctcaggaagagcctgcagatttgcgcccagagatatggatcgcccaggaattgcggcgtattggagacgag
tttgatgcctattatccaaggagggtatttttgaataattaccaagcagccgaagaccaaccccaaatggttatcttacg
gctgttacgttacatcattcgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A1S3FL84_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Dipodomys ordii GN=BAD (length=465 residues).
atgttccagatcccagagtttgagccaagtgagcaggaagactccagctcagcagacaggggcctgggccccagcctctg
cccggccccaggcctcctgggggaccacagcccccagcagggactgccaaccagccgcagccaccatggaggtgctgggg
ctgtggagaccaggagtcgccatagttcataccctgcggggatggaggaggatgaagggctggaagaggagcctagcccc
tttcggggtcgctcacgctcggctcccccaaatctctgggctgccaggcgctatggccgcgagctccggaggatgagtga
cgagtttgacggctcctttaagggacttcctcgccccaaaagcgcgggcaccgccacgcagatgaggcagagttccagct
ggacgcgcatcttccagtcttggtgggaccggaacttgggccgaggctccgccccttctcagtga
>gnl|bcl2dbcds|A0A1S3FUQ7_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Dipodomys ordii GN=BIK (length=450 residues).
atgtcggaggccgggtctgtcaccagggacctcttcatcaagaccctcctgtaccagcagatgcccggacctcggccggc
agccgggcttttcccgatcaccgagcctatgggggaagaggtctgggaccccatggactgtctggagggcagtaaccagg
tggccctgtggctggtgtgcatcggcgacgaaatggaccagcgcctccgaagtcctcgcctggcccagctgccggggatg
gccatacacagcctggctctgacctacagccagatgggtgtctggggagtgctccgacgcctcatccgtggggtcgccca
cctgagggcgcacatcagggcctggagaccccccatcccccgcctccaggtgtcccctggccaggtccgcaggcagatgc
tgcccgcagtgctgctgctctgcggagccctgcagctgctgctccagtga
>gnl|bcl2dbcds|A0A3Q2GRS5_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Equus caballus GN=BCL2L11 (length=243 residues).
atggccaaacaaccttccgatgtaagttctgagtgtgacagagaaggcggacaattgcagcctgcggagaggcctcctca
gctcaggcctggggcccccacctctctacagatagagcagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaacgccaagtcctccttgccaagccttcaaccactatctcagtgcaatggttagagcaatagaggaggttgtcgtg
tag
>gnl|bcl2dbcds|A0A3Q2GRS5_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Equus caballus GN=BCL2L11 (length=264 residues).
atggccaaacaaccttccgatgtaagttctgagtgtgacagagaaggcggacaattgcagcctgcggagaggcctcctca
gctcaggcctggggcccccacctctctacagatagagcagcaagcttccatgaggcagtcgcaggcggtccctgcagaca
tgcgcccggaggtatggatcgctcaagagctgcggagaattggagacgaatttaatgcctcttacccacggaggctggca
caatgcctggcattctacacctga
>gnl|bcl2dbcds|A0A3Q2GRS5_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Equus caballus GN=BCL2L11 (length=504 residues).
atggccaaacaaccttccgatgtaagttctgagtgtgacagagaaggcggacaattgcagcctgcggagaggcctcctca
gctcaggcctggggcccccacctctctacagatagagcagcaaggtaatcccggaggcgaaggggaccgctgcccccaag
gcagccctctgggcccgctggccccaccggccagccctggcccttttgctaccagatccccgtttttcatctttgtgaga
agatcttccctgctgtctcgctcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaacgccaagtcctccttgccaagccttcaaccactatctcagtgcaatggcttccatgaggcagtcgc
aggcggtccctgcagacatgcgcccggaggtatggatcgctcaagagctgcggagaattggagacgaatttaatgcctct
tacccacggaggttagagcaatag
>gnl|bcl2dbcds|A0A3Q2GRS5_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Equus caballus GN=BCL2L11 (length=702 residues).
atgttcccggcggcggcggccggggcagcgcgggccagaggcgcggcgcgcggagccctcggctgccctgcggagcgcgg
cggcggcgggcgggcggcaagcggcaggctctgcgctgtcctggcgcctctgagcgcgagtcccgggctttgtctccccc
gctgcctaagtggcgacaatcagggggctccgggtcggcgaaaggcgcgggctggacgccgcggggcccgggcccggacg
cgacgctcggaagggaaggggcggataaaaaaagaccaaatggccaaacaaccttccgatgtaagttctgagtgtgacag
agaaggcggacaattgcagcctgcggagaggcctcctcagctcaggcctggggcccccacctctctacagatagagcagc
aagacaggagcccggcacccatgagttgtgacaaatcaacacaaacgccaagtcctccttgccaagccttcaaccactat
ctcagtgcaatggcttccatgaggcagtcgcaggcggtccctgcagacatgcgcccggaggtatggatcgctcaagagct
gcggagaattggagacgaatttaatgcctcttacccacggagggtcgttttgaatcatcaccaagcagctgaagcccacc
cccaaatgatcatcttgcgactgttacgttacatcatccgcctggtacggagactgcagtga
>gnl|bcl2dbcds|A0A3Q2GRS5_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Equus caballus GN=BCL2L11 (length=870 residues).
atgttcccggcggcggcggccggggcagcgcgggccagaggcgcggcgcgcggagccctcggctgccctgcggagcgcgg
cggcggcgggcgggcggcaagcggcaggctctgcgctgtcctggcgcctctgagcgcgagtcccgggctttgtctccccc
gctgcctaagtggcgacaatcagggggctccgggtcggcgaaaggcgcgggctggacgccgcggggcccgggcccggacg
cgacgctcggaagggaaggggcggataaaaaaagaccaaatggccaaacaaccttccgatgtaagttctgagtgtgacag
agaaggcggacaattgcagcctgcggagaggcctcctcagctcaggcctggggcccccacctctctacagatagagcagc
aaggtaatcccggaggcgaaggggaccgctgcccccaaggcagccctctgggcccgctggccccaccggccagccctggc
ccttttgctaccagatccccgtttttcatctttgtgagaagatcttccctgctgtctcgctcctccagtgggtatttctc
ttttgacacagacaggagcccggcacccatgagttgtgacaaatcaacacaaacgccaagtcctccttgccaagccttca
accactatctcagtgcaatggcttccatgaggcagtcgcaggcggtccctgcagacatgcgcccggaggtatggatcgct
caagagctgcggagaattggagacgaatttaatgcctcttacccacggagggtcgttttgaatcatcaccaagcagctga
agcccacccccaaatgatcatcttgcgactgttacgttacatcatccgcctggtacggagactgcagtga
>gnl|bcl2dbcds|A0A3Q2GWE8_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Equus caballus GN=BBC3 (length=786 residues).
gtgagagtcagcgcaggggctgcccgggcatgtctgtgccaggcgcctggggcttccttctcaccctgggtcccccagca
gactcgtggccccagggagcgccatggcccgagcacgccaggagggcagctccccggagccggtagagggcctggcccgc
gacggcccgcgccccttcccgctcagccgcctggtgccctcggccgtgtcctgcggcctctgcgagcccggcctgcccgc
cgcgcccgccgcgcccgccctgctgcccgctgcctacctctgcgcccccgccgccccgcccgccgtcaccgccgccctgg
ggggcccccgctggcctgggggcccccgcagccgtccccgagccccgcgccccgacggtccacagccctcactcttgccg
gccgagcagcacctggagtcgccggtgcccagcgccccgggggccctggagggcggccccacccaggcagccccgggagt
ccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctgaacgcgctgtacg
agcggcggagacaagaggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctg
cccctacccaggggccgagcggccccggagatggagcccaactaggtgcctgcacccgcccgggggacgtcggggacttg
gggggcaggaccctcccacctcctgacgccctggccagcgcggggggctctttctgcaccatgtag
>gnl|bcl2dbcds|A0A3Q2GWE8_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Equus caballus GN=BBC3 (length=396 residues).
gtgagagtcagcgcaggggctgcccgggcatgtctgtgccaggcgcctggggcttccttctcaccctgggtcccccagca
gactcgtggtccacagccctcactcttgccggccgagcagcacctggagtcgccggtgcccagcgccccgggggccctgg
agggcggccccacccaggcagccccgggagtccggggggaggaggagcagtgggcccgggagatcggggcccagctgcgg
cggatggcggacgacctgaacgcgctgtacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgcccctacccaggggccgagcggccccggagatggagcccaactag
>gnl|bcl2dbcds|A0A3Q2HR24_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Equus caballus GN=BMF (length=675 residues).
atggagccgcctcagtgtgtagaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcccag
gagcttgctctctgctgacctgtttgccccgagccagctggactgccccctcagccatctgcggctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcagtccagcctccccaagccag
ggtgtcatgctgccttgtggggtgaccgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagaccctgctctttctccacaacctcgctttgaacggagacgagaacaggaacggggcaggtcccaggtgtggtaa
aaatgtgaggggacccgttagggaattggagacttctgacttgtttctcagctgccatcctgagttacccccagctcccg
gcttttgtcaggacttcgtgctctcttggagttga
>gnl|bcl2dbcds|A0A3Q2HR24_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Equus caballus GN=BMF (length=684 residues).
atggagccgcctcagtgtgtagaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcccag
gagcttgctctctgctgacctgtttgccccgagccagctggactgccccctcagccatctgcggctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcagtccagcctccccaagccag
ggtgtcatgctgccttgtggggtgaccgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagaccctgctctttctccacaacctcgctttgaacggagacgagaacaggaacggggcaggtcccagcttccagcc
aggccaggagggtgtgctctggaagtcagcaggattgcagctgcctctgtccgaacttcttcccttctctccctgctgtg
gcactaatggagagaatttaaagcagccagtctggctgctctga
>gnl|bcl2dbcds|A0A3Q2I0H2_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Equus caballus GN=PMAIP1 (length=165 residues).
atgcctacaaggaaggcgcgtaagtctgggcagccgagccccacgcgagccccggcagagcttgaggctgagtgtgccat
tcaaattaggagaattggagacaaactgaatttccggcagaaacttctgaatctcatagccaaactcttccgctcaggaa
cctga
>gnl|bcl2dbcds|A0A3Q2IBL3_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Equus caballus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgtgcctgcagcgcgggccgcctgggtctgcgctc
gtcagccgcgcagctcacggccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A3Q2LHE3_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Equus caballus GN=BIK (length=546 residues).
atgtctcaagtaggacccgtctccagggacctctttctggacgccttcctgcacgagcgcagcccggaagccctggaggt
tcctggcatgaccgagctcacagagtcctcccccgacagtgacaaccgtgactctgtggccatgcggctggccttcatcg
gggacgagatggaagtgagatggatgctgccccacatcgctgagctgcctggggtggccgtgtacagcttggccttcacc
tacaaccagacaggcctgaggggtgtttttagaagtttcatggatggtctcactaacctcagggagaacataaggttctg
gagcttcctgacccgcagggacagggtaagcctgagatttcatgaccttgactcaccttcctgcatgtgtagccctctgg
agccgtggagcagctgccccgtagggcacagcctcgctggttgccacagtccccaccaatccctattgtcttcttttgcc
tgcttcacccattcctcctcctgcctgttccctgggcctttgggtttgagatggctggcttactga
>gnl|bcl2dbcds|A0A3Q2LHE3_BIK-02 BCL2-interacting killer gene OS=[Eukaryota] Equus caballus GN=BIK (length=681 residues).
atgagaaagcggcggcgtcacgcagctgctaagcggcagacctgggattcgaactcaggccctctggtttcagagccgcg
ttcttcatcatcgtattctgtacctaaggctgtttggtccagtgtgggagaagaaatgtctcaagtaggacccgtctcca
gggacctctttctggacgccttcctgcacgagcgcagcccggaagccctggaggttcctggcatgaccgagctcacagag
tcctcccccgacagtgacaaccgtgactctgtggccatgcggctggccttcatcggggacgagatggaagtgagatggat
gctgccccacatcgctgagctgcctggggtggccgtgtacagcttggccttcacctacaaccagacaggcctgaggggtg
tttttagaagtttcatggatggtctcactaacctcagggagaacataaggttctggagcttcctgacccgcagggacagg
gtaagcctgagatttcatgaccttgactcaccttcctgcatgtgtagccctctggagccgtggagcagctgccccgtagg
gcacagcctcgctggttgccacagtccccaccaatccctattgtcttcttttgcctgcttcacccattcctcctcctgcc
tgttccctgggcctttgggtttgagatggctggcttactga
>gnl|bcl2dbcds|F7DN67_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Equus caballus GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcagagtgagccagaagactccagccctgcagataggggcctgggccccagccctac
gggggactggccctcagacccggtcaggcaccagcggacagccccaggcctcctgggggaagctggtcaccagcaggggc
agccggccagcagcagccaccatggaggcgctggggcggtggagacccggagtcgccatagctcgtaccccgaggggacc
gaggatgaagggatggaaggggaggagcccggccccttccggggccgctcgcgctcggcgccccccaacctctgggctgc
acgacgctacggccgcgagctccggaggatgagcgacgagttccaggtctccttccaggcacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagccccagctggacgcgcgccatccagtcctggtgggatcggaacttggggaga
ggaggctccgccccctcccagtga
>gnl|bcl2dbcds|A0A1S3WU31_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Erinaceus europaeus GN=BMF (length=555 residues).
atggagctcccccagtgtgtggatgagctagaggatgacgtgttccagcctgaggatggggagccagggaccacaccagg
gagcttgctctcctctgacctgttcgcccagagcccgatggactgctccctcagccggctgcagctcttcccactcacgc
actgctgcggccctgggcttcgacctgccagccaggaggacaaggccacccagaccctcagcccagcctccccaagccag
ggtgtcatgctaccctgtggggtgacagaggaaccccagcgactcttctacggcaatgcaggctaccggctgccgctccc
caacagcttccctgcaggctctccctttgcagagcagcgccgtgaagggcagtggcagcagcgagtagaagtgcagatcg
ctcgcaagcttcagtgcattgcagaccagttccaccacctgcacatgcagcaacaccagcagaaccgaaatccagtgtgg
tggccgttcctgctcttcctacacaacctggctttgaatgagggtgagaatagaaacagggaagcgcccaggtga
>gnl|bcl2dbcds|A0A3P8XIA2_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Esox lucius GN=BCL2L11 (length=399 residues).
agagagtcttcctgcgaagggaaccagcagtcacggggaggaataatgatgccgacgaatagtctgcttggtttccagtc
gaggtcgcctcttttcagaacaacatccacgtcctccagtggatatttttcgttcgactgcgactctattccaagctcgc
cactactaagaaataacaagtcgacacagactccgagcccatctagtcaagttattactcacgcaatgaggccgggggac
atgcggccggaaatactgatcggtcaggagcttcagcgcattggagatgagtttaacaacctgttcatacatggggtgag
tggttgcagtaaaatgcctgtgttgcatcaccttatttacaaaccatatcaaggaccgcactgtattaaattgagctga
>gnl|bcl2dbcds|A0A3P8XIA2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Esox lucius GN=BCL2L11 (length=651 residues).
atgtttgattcgtccagaccacaaaatcggtccaatggcacgaccaccctaattgggagagggaaaatcggagagtcgca
tccctgtggcggagcaacctcgagttccaaactgtcagattacccccagtcctgcgaagggaaccagcagtcacggggag
gaataatgatgccgacgaatagtctgcttggtttccagtcgaggtcgcctcttttcagaacaacatccacgtcctccagt
ggatatttttcgttcgactgcgactctattccaagctcgccactactaagaaataacaagtcgacacagactccgagccc
atctagtcaagttattactcacgcaatgaggcgcttgtctaagccacaagacacctggcgaggttatgaagcgtggccca
ccccccaccacccctatagaccacggccaccaccaatagcgggggacatgcggccggaaatactgatcggtcaggagctt
cagcgcattggagatgagtttaacaacctgttcatacatgggcgtcttggggcaagaaatggtcaggttgcccaagcaaa
ccttcctcagatgcaccaagaacctgcctttctactgtggatgggcctcctgattggtcgactattacagatcatttggc
ggagaagataa
>gnl|bcl2dbcds|A0A3P8Y761_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Esox lucius GN=BAD (length=501 residues).
atggaaaatattttcactatatcagacaccgaatctgaatcctcagatgtagaagaaaccaaaaaggaatggattgccgg
acaggggaagactggaagccgattaggcctctcccttaacctaccaggcgagggccggataaggttaaactctgaatctc
aggtcttcgctacatctggtggggagaggagcggggagctccagggtttggggcaagggttgaactgtgtggccacagaa
ggactaccttttagggtccgctcccagtcagcccccccggccctctgggctgccaagagatatggacggcagctgcgacg
catgagtgacgagttcgatacgtggctggataaagggcaaatgaagcgggtgaagagtgcaggagcagccaaacagatga
caacatccccgagctggtgggccttcctgttcagccacaaggaaactgagacagaaaagacccccaaccttatcattact
gaaccaagatcttctgagtag
>gnl|bcl2dbcds|A0A3P8ZIE7_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Esox lucius GN=BMF (length=483 residues).
atggaggatgaggaggatgatgtgtttgagccagactcctactgctggcacacagcctccagggagataaagtacgagga
caggggcacccagactcccacaactgctctggcactgctcaatgacatgctaccctgcagattggaccaggatcccagac
cactgttctacggtaacgcaggctttcgattgcactttccggcccagtttgagtgcgttggagacccggggcctcagcag
cgtccccaggcggtgagaggggggatggagcacccccaacagctgccccagcagccagtagcccgttgcattggacagaa
gctccaactcattggtgaccagtttcatgaagaacatctgcaactgtatcacagaaaccaaaggaacctgaggcccctgt
ggtggcgcctggcctcggctctgctcactctgctgtgggagcaggaggccgtggctggaggcgggagagccgggtggagg
tga
>gnl|bcl2dbcds|A0A3P9A5G8_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Esox lucius GN=BAD (length=480 residues).
atggcttttaaaatggatcacactcaggattgtgtgggtgacattccagaaaacataaacgaaaaatatgatttggacca
cttaggaactacacattacccagaatttcagttctgtaatacctccactaatacaagcaatagaacactaccaggtgtac
gcgtccggctctactcggaatcccaggtgtgttcccaggttggcagacaggacaacacagagtttcaggttgcaatgact
cctacggaggagagtgggggcgatgcagcaccgttccggggccggtcacagtctgctccccctgcgctgtgggctgcaaa
aaaatatggctgccagctgaggaggatgagtgatgaatttgacacctggcttgacaaaggggagcccaagagaggaatta
tcccaggaagagcaaagcaggtctacagaggatggttctcgttcctctggagtccaaaggaagctgaaggcagggactga
>gnl|bcl2dbcds|A0A3P9A5G8_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Esox lucius GN=BAD (length=480 residues).
atggcttttaaaatggatcacactcaggattgtgtgggtgacattccagaaaacataaacgaaaaatatgatttggacca
cttaggaactacacattacccagaatttcagttctgtaatacctccactaatacaagcaatagaacactaccaggtgtac
gcgtccggctctactcggaatcccaggtgtgttcccaggttggcagacaggacaacacagagtttcaggttgcaatgact
cctacggaggagagtgggggcgatgcagcaccgttccggggccggtcacagtctgctccccctgcgctgtgggctgcaaa
aaaatatggctgccagctgaggaggatgagtgatgaatttgacacctggcttgacaaaggggagcccaagagaggaatta
tcccaggaagagcaaagcaggtctacagaggatggttctcgttcctctggagtccaaaggaagctgaaggcagggactga
>gnl|bcl2dbcds|A0A2I2UX96_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Felis catus GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccgggccttttgctaccagatccccgtttttcatctttgtcaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctc
aggctgtacccgcagatatgcgcccggagatatggattgcacaagagttgcggcgtatcggagacgaatttaatgcatat
tacccaaggagggtctttttgaataattaccaagcagccgaagcccagccccaaatgattatcttacgactgttacgtta
catcgtccgcctggtatggcgattgcagtga
>gnl|bcl2dbcds|A0A2I2UX96_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Felis catus GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctcaggctgta
cccgcagatatgcgcccggagatatggattgcacaagagttgcggcgtatcggagacgaatttaatgcatattacccaag
gagggtctttttgaataattaccaagcagccgaagcccagccccaaatgattatcttacgactgttacgttacatcgtcc
gcctggtatggcgattgcagtga
>gnl|bcl2dbcds|A0A337SAW2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Felis catus GN=BAD (length=822 residues).
atggggaccccagagaatcccttatctgctcccacacacgtcccaggcccagggatgtcgggaactgagcagcgggaggc
gaggaagggacccaggacgaaggcggtaggcagggagcaagtcccgcggcgggggcggagactgggtcggaagcggccac
gccccctggccagccctggtgacatttcaaaagctgattgggccgggtcggtgacagttcccgttgcccaggcaactagg
gccgggctccctcagtactggagggaggcggcaggcccgggtcaggggcctcgagatcgggcttgggcccagagcatgtt
ccagatcccagagtttgagcccagtgagcaggaagactccagccctacggataggggcctgggccccagccccacagggg
accggccccgcggccctggcaagcaccagcggacgaccccaggcctcctcggggaagctggtcaccagcaggggcagccc
gccagcagcaaccaccatggaggcgctggggctgtggagacccggagtcgccacagctcgtaccccgccgggaccgagga
ggatgaagggacggaggaggaagagcccagccctttccggggtcgctcgcgctcagcgccccccaacctctgggctgccc
tgcgctacggccgcgagctccggaggatgagcgacgagttccagggctccttcaagggacttccacgcccgaagagcgcg
ggcacagcgacgcagatgcggcaaagccccagctggacgcgcttcatccagtcctggtgggatcggaacttggggagagg
aggctccgccccctcccagtga
>gnl|bcl2dbcds|A0A337SQ56_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Felis catus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggccgcctgggtctgcgctc
gtccgccgcgcagctcacggccgctcggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A337ST43_BMF-05 Bcl2 modifying factor gene OS=[Eukaryota] Felis catus GN=BMF (length=864 residues).
atgaccagaaccagcccgggtcagaagaaaaggccaaggtgggagtggctctgggaaggcccagggaggaggtgtggagc
ctccttgagcagtgaggcaggccacatttggggagggtgtcatcctcagtggtactttatcaccaggtcgtttgtcatca
gtgtcgggccccacttcccccaggtagaagggaaaggagaaaggaaagggggagtccttcaggttcggccttcgggcagg
ggacagcaccccagatgcctgcattgcaccccagcaggggagatggagccgcctcagtgtgtggaggagctagaggatga
tgtgttccagccagaggatgtggagccggggacccagcctgggagcttgctgtctgctaacctgtttgcccagagccagc
tggactgccccctcagccatctgcagctcttccctctcacccactgctgtggtcctgggcttcgacccaccagccaggaa
gacaaggccacccagaccctcagtccggcctccccgagtcagggtgtcatgctgccttgtggggtgaccgaagaacccca
gcgactcttttatggcaacgctggctaccggctccctctccctgccagtttccctgcaggcttgccccttggtgagcagc
cccctgaagggcattggcagcatcgagcagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccatcgg
cttcatatgcagcaagtaggcatgggggcttggggcggggggagagtctgctggggctggggggccaggacctgcctcag
caactctgtctctgccaggctataccaggatatggtcccagagttttggcctcggctattatga
>gnl|bcl2dbcds|A0A337ST43_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Felis catus GN=BMF (length=582 residues).
atggagccgcctcagtgtgtggaggagctagaggatgatgtgttccagccagaggatgtggagccggggacccagcctgg
gagcttgctgtctgctaacctgtttgcccagagccagctggactgccccctcagccatctgcagctcttccctctcaccc
actgctgtggtcctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccgagtcag
ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcattggcagcatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcggcttcatatgcagcaagtaggcatgggggcttggggcgggggg
agagtctgctggggctggggggccaggacctgcctcagcaactctgtctctgccaggctataccaggatatggtcccaga
gttttggcctcggctattatga
>gnl|bcl2dbcds|A0A337ST43_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Felis catus GN=BMF (length=450 residues).
atggagccgcctcagtgtgtggaggagctagaggatgatgtgttccagccagaggatgtggagccggggacccagcctgg
gagcttgctgtctgctaacctgtttgcccagagccagctggactgccccctcagccatctgcagctcttccctctcaccc
actgctgtggtcctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccgagtcag
ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatgcaccagcaaaaccgccgtcgagtgtggt
ggcagattctcctcttcctacacaacctggctttgaatgcagaagagaacaggaatggggcaggtcccaggtgaggctgg
gctgccctcctcgcatggggcaccacaggaaggacatcagcgaggactga
>gnl|bcl2dbcds|A0A337ST43_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Felis catus GN=BMF (length=591 residues).
atggagccgcctcagtgtgtggaggagctagaggatgatgtgttccagccagaggatgtggagccggggacccagcctgg
gagcttgctgtctgctaacctgtttgcccagagccagctggactgccccctcagccatctgcagctcttccctctcaccc
actgctgtggtcctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccgagtcag
ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcattggcagcatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcaaaaccgccgtcgagtgtgg
tggcagattctcctcttcctacacaacctggctttgaatgcagaagagaacaggaatggggcaggtcccaggacctcacc
aggaatgagggcctttgtcaaacactgttga
>gnl|bcl2dbcds|A0A337ST43_BMF-04 Bcl2 modifying factor gene OS=[Eukaryota] Felis catus GN=BMF (length=837 residues).
atgaccagaaccagcccgggtcagaagaaaaggccaaggtgggagtggctctgggaaggcccagggaggaggtgtggagc
ctccttgagcagtgaggcaggccacatttggggagggtgtcatcctcagtggtactttatcaccaggtcgtttgtcatca
gtgtcgggccccacttcccccaggtagaagggaaaggagaaaggaaagggggagtccttcaggttcggccttcgggcagg
ggacagcaccccagatgcctgcattgcaccccagcaggggagatggagccgcctcagtgtgtggaggagctagaggatga
tgtgttccagccagaggatgtggagccggggacccagcctgggagcttgctgtctgctaacctgtttgcccagagccagc
tggactgccccctcagccatctgcagctcttccctctcacccactgctgtggtcctgggcttcgacccaccagccaggaa
gacaaggccacccagaccctcagtccggcctccccgagtcagggtgtcatgctgccttgtggggtgaccgaagaacccca
gcgactcttttatggcaacgctggctaccggctccctctccctgccagtttccctgcaggcttgccccttggtgagcagc
cccctgaagggcattggcagcatcgagcagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccatcgg
cttcatatgcagcaacaccagcaaaaccgccgtcgagtgtggtggcagattctcctcttcctacacaacctggctttgaa
tgcagaagagaacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A337SUX1_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Felis catus GN=PMAIP1 (length=165 residues).
atgcctgggaagaggacgcgtaagagcgcgcagccgagccccgcgcgggccccggcagagcccgaagtggaatgtgccat
gcagctccggagatttggagacaaactgaatttccgacagaagcttatgaatctgatatccaaactcttccgctcgggaa
cctga
>gnl|bcl2dbcds|U3JS06_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Ficedula albicollis GN=BMF (length=582 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggctttttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactattccccctcacacactgctgtggtcccggtatcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccatcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccacggagactcttctatgggag
tgctggttaccgtttacatgtccctccagctggctttgtgttggatccgcacctccaagaggaacctcaggaaggtcagc
gggaagcacgtgctgaggtgcagattgcacggaagttgcagtgcattgccgaccagttccaccggctccacatacagagg
catcagcagaacagaaatcaagtgtggtggcagctttttctcttcctacacaacttggccttaaacacggaggtgaacag
gaaccacactgggcagaggtga
>gnl|bcl2dbcds|A0A091DDU4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Fukomys damarensis GN=BAD (length=489 residues).
atgttccagatcccagagtttgagcccagtgagcaggaagactccagctccgaagagaggggcctgggccccagtcccat
aggggaccagctaggtcccagcccagcacgaggcttcctgggggacaccagtcaccagcagaggcagctgttcagcagca
gacaccatggaggcgctggggctatggagacccggagtcgccacagctcataccccacagggaccgaggaggaagagggg
atggaagaggagcccagcccattccggggccgctcgcgctcggcgcctcccaatctctgggctgcacagcgctacggcag
agagctccggaggatgagcgacgagttcgtggactccttcaagggtcttcctcgcccgaagagcgcaggcacagcgacga
agctctggcagagctccagctggacacgcgccatccagtcctggtgggatcggaacttgggaagaggaggctccgccccc
tctcagtga
>gnl|bcl2dbcds|A0A3Q2PJX9_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Fundulus heteroclitus GN=BMF (length=525 residues).
atggaggatgaggaggatgatgtgtttgagccagatcccaactgctggcgcacacccttcagggagataaagtgcgaaga
ccggggcacgcagacgcccggtcctgccctggcaccgaacaacggcatgctgccctgcggcgttgcggaggagcccagac
aactgttctacggtaacgcaggttttcgattgcacttcccagcacattttgagcttgtcggggattttgacgcgaggcga
caggaggagcagaacaggatggagccgttacccctgcaccagccggcagcgctcagcttggaggcctgcatcgggcagaa
gcttcagctgataggcgaccagtttcatcgggaacacttacaacagagaggctcttttcggtcttctcttgctgcaggag
aggttgggaaaccaatgtactacacaaacgtctactcacagtgtccaacctgctggctcgcaaattgcctgagtcgcctt
gctgccgaactgctgattctctgtgagttccctacgcttctctga
>gnl|bcl2dbcds|A0A3Q2PJX9_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Fundulus heteroclitus GN=BMF (length=483 residues).
atggaggatgaggaggatgatgtgtttgagccagatcccaactgctggcgcacacccttcagggagataaagtgcgaaga
ccggggcacgcagacgcccggtcctgccctggcaccgaacaacggcatgctgccctgcggcgttgcggaggagcccagac
aactgttctacggtaacgcaggttttcgattgcacttcccagcacattttgagcttgtcggggattttgacgcgaggcga
caggaggagcagaacaggatggagccgttacccctgcaccagccggcagcgctcagcttggaggcctgcatcgggcagaa
gcttcagctgataggcgaccagtttcatcgggaacacttacaacagtatcatcaaaaccaaaggaatcaggggccgctgt
ggtggcgcatgactgcagctcttctcagcctcctgcttgatagggggtttgttgctggaagaggtggagccggacggagg
tga
>gnl|bcl2dbcds|A0A3Q2PJX9_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Fundulus heteroclitus GN=BMF (length=483 residues).
atggaggatgaggaggatgatgtgtttgagccagatcccaactgctggcgcacacccttcagggagataaagtgcgaaga
ccggggcacgcagacgcccggtcctgccctggcaccgaacaacggcatgctgccctgcggcgttgcggaggagcccagac
aactgttctacggtaacgcaggttttcgattgcacttcccagcacattttgagcttgtcggggattttgacgcgaggcga
caggaggagcagaacaggatggagccgttacccctgcaccagccggcagcgctcagcttggaggcctgcatcgggcagaa
gcttcagctgataggcgaccagtttcatcgggaacacttacaacagtatcatcaaaaccaaaggaatcaggggccgctgt
ggtggcgcatgactgcagctcttctcagcctcctgcttgatagggggtttgttgctggaagaggtggagccggacggagg
tga
>gnl|bcl2dbcds|A0A3Q2QC80_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Fundulus heteroclitus GN=BAD (length=630 residues).
atgtcgccaagtagcagcagccatattggatgctttccttacccactgagaaatcagatcaactcgagtccaagttgcac
tttcatttctggtttgaattttccgaattcgtgtcttccagatgatacgatggcggccaagtttactatttcggacagcg
actcggagccaccagaagaagtcgaggaagaaggaaacgatcagccagcagacggaaaagtggagccgctccgccagcgc
cacgccctcacccttcctgagctcagatcagggcatggccggatcagactgaactcggagtcccacgcctccaccatctc
cagagaggaggagctgcagggcagggcggaggaggaggccgggacccccaccgaggggcttccattcaggaaccgctcca
attcggctcctccggcgctgtgggcagccaagaagtacgggcggcagcttcgcaggatgagcgacgagttcggcagcctg
ctcgataaaggggagttgaggaaggtgagcagcgctgggacgaacagacccattcaccactccaggagctggtggaacta
cctcttcagccaccaggagacggagggagagaacagccaccatgaaaaccacgccccccgcaccgagtag
>gnl|bcl2dbcds|A0A3Q2SZH6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Fundulus heteroclitus GN=BCL2L11 (length=720 residues).
atggtgacgctctgttcatccaacagaccgccaaatctgcgcgatggctctaccgaagtaacgccaccagaggggaccgg
aggagacccagcatcctcagcgcgaacaccacgtttgtccaagcacagggaggggagctgcgcgcagccgccgggcgccg
ttaccgccgccggaggaggaggaggggagccggactcggactcgccgccccgctccataagcccgaacagtttagacgtc
tttcaaagaaggtcgatttttcgcaaatccagcggatacttctcctttgactgcgagtcgctgccgagcactccgctctc
tccgcacccactgacggctgacaaagccacgcagactgccagccccaccggccaggtgatgaaccacgccctgcagcgaa
tggctgcggagcacggtggacagccagcaagaatactggggctgcacggacactcctttagcgcgcggcagggaaacgca
gcacgggatatgcagccggaacgttttggtcgtcaactccgggctattggcgatgaatacaacaatcacctcatgagaat
ggcgggacgacaacaacgagatatggtccctctaaacctgatgccacacatccagcaggagcctgttgccatgctctgtg
tcggcctcttgctcctcctgattggacgaataatgtacttgcaaggcagtacaaacagccatgaccactctcaggtttag
>gnl|bcl2dbcds|A0A1D5PAR2_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Gallus gallus GN=PMAIP1 (length=165 residues).
atgatgcccggcaggacgattcgcaaacctgcgccgcccgccgcgcctgcagagcgggacgcggtggctgagtgcgcgct
ggagctgcgcaggatcggagacaaggcggacctgcagcagaaagtcctgaacctcatcacgaaactgttctgccccaaaa
cgtga
>gnl|bcl2dbcds|A0A3Q2U844_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Gallus gallus GN=BCL2L11 (length=540 residues).
atggccaagcagccccccgaggcgaaggcgccccgcgaccgccgggccgggcggctgccgccgggagaggggccgggccc
ggccgtcccgctgcggcccggagcccccgccgcgctgcccggcgccgcccggcccgcctcgcccggcagccccggcccgt
tcgccatccgctcgccgctcttcttcttcgtgcggaggtccccgctgctgccgcgctcctccagcgggtacttctccttc
gaggccgagcgcagccccgcgcccatgagctgcgataaggccacgcagacccccagcccgccgtgccaggccgtcagcca
ctacctgagcgccatggcttccaggtggcgatctcactcgcttgcagaagaaatacaaccagaaatatggattgcacagg
agctgcggcgcatcggggatgaattcaatgcctcctattgtccaagaaggggtttcttggataaccgtgctggaaacccc
caggttgtcattctgcgcctcctgcattacatcatccgcctcatctggaggatgcagtga
>gnl|bcl2dbcds|A0A3Q2UCA0_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Gallus gallus GN=BMF (length=603 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgcttacatgtccctccagttggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagcgg
gtagggtgtttccacaggggaaggtggggtctttcttatctaagagtggtgctccagaagactggctccaggcttcggct
aagcaggctgttgcctaaggcagccgcaggctaccggcagtga
>gnl|bcl2dbcds|A0A3Q2UCA0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Gallus gallus GN=BMF (length=603 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgcttacatgtccctccagttggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagcgg
gtagggtgtttccacaggggaaggtggggtctttcttatctaagagtggtgctccagaagactggctccaggcttcggct
aagcaggctgttgcctaaggcagccgcaggctaccggcagtga
>gnl|bcl2dbcds|A0A3Q2UCA0_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Gallus gallus GN=BMF (length=582 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgcttacatgtccctccagttggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagcgg
catcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaacgtggaggcgaacag
gaaccgcactgggcagaggtga
>gnl|bcl2dbcds|A0A3Q2UCA0_BMF-04 Bcl2 modifying factor gene OS=[Eukaryota] Gallus gallus GN=BMF (length=582 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgcttacatgtccctccagttggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagcgg
catcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaacgtggaggcgaacag
gaaccgcactgggcagaggtga
>gnl|bcl2dbcds|A9XRH0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Gallus gallus GN=BMF (length=357 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcagggaatgctggttaccgcttacatgtccctccagttggctttgcattggatccaaatctccaagaagagc
ctcaggaaggtcagcgggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccgg
ctccacatacagcggcatcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaa
cgtggaggcgaacaggaaccgcactgggcagaggtga
>gnl|bcl2dbcds|G3Q8B3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Gasterosteus aculeatus GN=BAD (length=447 residues).
atggctgcacatttcaccatttccgacagcgagtcagagccctcggatggggtagaggaaagagaagatggccagttatc
atcggggcaagagcagcagcgtcttcaacgtcacaccctcaccttacctgagctcagattgtcaggtaggaaatctcaaa
gaattgtggaaaaagaagaggagctgtggctagacgagaccgggacgcccactgagggggctccattccgggtacgttcc
aagtcggctcccccggctctgtgggcagccaagaaatacggacggcagctccgaaggatgagcgacgagttcgacagcct
gctggacaaaggggaaatgaggagggtaaagagcgccgggacgaccaaacagatgcagcactccaagagctggtggagtt
ccctctttagtcaccaggagatggagggagagaacaaccaccatgaa
>gnl|bcl2dbcds|A0A452H3N6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Gopherus agassizii GN=BMF (length=579 residues).
atggatccccccaactacctggaagacgactattccagcctggacgggctggacgatgacgtgtttcactctgactttgg
actcacaggtcagcctggtgagatgacccctcctggcattttcacacagaaccaatcctacagctgtctcctggggaggt
ttcaactgttccccctcacacactgctgtggtccaggtatcaggcatgctgagcagcaggacaaggcaacccaaacactc
agtccatcctcttctactcaggatgtcatgttgccatgtggagtcactgaagagccccagagactcttctatgggaatgc
tgggtaccgtttacatgtccccccagttggctttgcattgaatccgcacctccaagaggagcctcgggaaggtcagcggg
aagcacttgctgaggttcagattgcacggaagttacagtgcattgcagaccagttccacaggctccacatacagaggcat
cagcagaacagaaatcaagtgtggtggcagatccttctctttatacataacttggccttaaatgtggaggtgaacaggaa
ccacgtaggtcagaggtga
>gnl|bcl2dbcds|A0A452IFQ4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Gopherus agassizii GN=BAD (length=426 residues).
atgtttcgcatccaggagttcccggacgaggtgttcccggggcgagggaaggaggcgcctgctccccccgagtcgcagcg
gggacacacgcccggctccaagcagccagacacccccacagctgaggtgcgaagccggatagggtcagacaccccatctc
tggagccagaagtgcaggatgagccaggtggggcattccgggcacgttcacgctcagcaccccccatcctttgggctgct
atgcgttatgggcgggagctgcgcaggatgagtgacgagtttgatgtggcgctgcaggtgctgccacgccccaagagtgc
aggcacgacatcccagctccaccgggggaacagctggaaagagaccctccaggcctggttggggcacagacccgcccgtg
atgccctccccaggagctccaagtga
>gnl|bcl2dbcds|A0A452J430_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Gopherus agassizii GN=PMAIP1 (length=165 residues).
atgccgggaaagaccctgcgcaagggtgcgcagcagaaccccgctctcccagcacaggaagctgtgacgcagtgctcttt
gcaactacgcaaaataggagatatatgcaacctgcagcagaagattcttaacgttattacaaaactgttctgcccaggaa
cgtga
>gnl|bcl2dbcds|A0A2I2YQ13_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A2I2YQ13_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|A0A2I2YVQ5_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggctccagcagagctggaagtcgagtgtgctac
tcaactcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|A0A2I2YVQ5_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=PMAIP1 (length=453 residues).
atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggctccagcaggaccggcgggtacggcgaggga
ccaagccggctttgggattgagatgcagctgcgtttcaccaggggcaaaaagctcctttcctcctcgccacttgcccttc
cccggggccacgaggaacaagtgcaagtagctggaagtcgagtgtgctactcaactcaggagatttggagacaaactgaa
cttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaacctgactgcatcaaaaacttgcatgagggg
actccttcaaaagagttttctcaggaggtgcacatttcatcagtttgaagaaagactgcattgtaattgggaggaatgtg
aaggtgcattcatgggtgcccttggaaacggaagatggaatacatcaaagtga
>gnl|bcl2dbcds|A0A2I2Z168_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BMF (length=390 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggggagccggtgacccaacccgg
gagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaagctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatgcaccagcagaaccaaaatcgtgtgtggt
ggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcaggccctag
>gnl|bcl2dbcds|A0A2I2Z168_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BMF (length=555 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggggagccggtgacccaacccgg
gagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaagctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctatcggcttcctctccc
tgccagtttcccagcagtcttgcccattggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccaaaatcgtgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcaggccctaggtga
>gnl|bcl2dbcds|A0A2I2Z8C7_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAD (length=474 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagaagggacttcctcgcccgaagagcgcaggcacagcaacgcagatgcggcaaag
ctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctcccagtgacctt
cgctgcacatcccgaaactccacccgttcccactgccctgggcagccatcttgaatacgggcggaagtacttccctcagg
cctatgcaaaaagaggatccgtgctgtctcctttggagggaaggctgacccagattcccttccggtgcgtgtga
>gnl|bcl2dbcds|A0A2I2Z8C7_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacg
gaggacgacgaagggatgggggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcaggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggc
aggggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A2I2Z8C7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacg
gaggacgacgaagggatgggggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcaggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggc
aggggaagctccgccccctcccagtga
>gnl|bcl2dbcds|G3QCT2_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BIK (length=483 residues).
atgtctgaagtaagacccctctccagagacatcttgatggagaccctcctgtatgagcagctcctggaacccccgaccat
ggaggttcttggcgtgactgactctgaagaggacctggaccctatggaggacttcgattctttggagtgcatggagggca
gtgacgcgttggccctgcggctggcctgcatcggggatgagatggacgtgagcctcagggccccgcgcctggcccagctc
tccgaggtggccatgcacagcctgggtctggctttcatctacgaccagaccgaggacatcagggatgttcttagaagttt
catggacggtttcaccacccttaaggagaacataatgaggttctggagatccccgaaccccgggtcctgggtgtcccgcg
aacaggtgctgctggcgctgctgctgctgctggcgctgctgctgccgctgctcagtgggggcctgcacctgctgctcaag
tga
>gnl|bcl2dbcds|G3QTJ6_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Gorilla gorilla gorilla GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccttggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A3Q3C5V2_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Haplochromis burtoni GN=BMF (length=492 residues).
atggacgatgaggaggacgatgtgtttgagccaaaagccaactgttggcgcaccacattcagggagataaagtgtgaaca
tcgaggcacacagacacccggtcctgccctggtaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtaacgcaggttttcgattgcacttcccggcacgcttcgagctcgtcggggatcacagagcgagtcga
caaggaagcacggagcagcaaaacagcatggagcgcctgccccgccagcgacccgcggctcgcagcgtggaggcctgcat
tggacagaaactccagctcataggagaccagtttcactgggaacgcctgcaactgtatcaccgaaaccaaaggaaccagg
ggccgatgtggtggcgcctggccgcggccattctcagccttctgtttgatagggggttcatagccggcggagggggtgga
ggacggaggtga
>gnl|bcl2dbcds|A0A3Q3C680_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Haplochromis burtoni GN=BAD (length=477 residues).
atggctgcaaacttcaaaatttcagacagtgattcagaggcatcagaggaggtaggggaagaagaaaaccaacagtcagc
aggacaagctcaagaaagcaagccccagacgctttcccttcctgtaatcaaaacgacagctgctggaaggctcagggtga
actcagagtcccacacttcctcaattgccagggatgaggagctcatggctagaggggaggatgaggtctgtactcccaca
gagggagacccattcaggcgaaggtcaaagtcagctccccctgctctgtgggctgccaagaagtacggcaggcagcttcg
acgaatgagtgacgagtttgacagcttactagataaaggggagatgaaggtcaagaagctgcaccactctaaaacctggt
ggagctatctctttagtcaccaagagactgaaggagagaacaaccatcttgaaaaccacaaccaacgcactgagtaa
>gnl|bcl2dbcds|A0A3Q2Y0E4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Hippocampus comes GN=BAD (length=522 residues).
atggccgcaaacttcagcatatccgacagcgagtccgagccctctgaggaggtagaagaaggggacgacggccaaggagc
cgctgaaaaagagcaggagcagtgcctccgccaaggcctccgcctcaccttgccggagctcccaatggaagcaatgtcgg
ggcggatccggctcaactcggagtcccacgctttggcagtgtcccgagaggaggagttccaggccagggtggacgaggag
gtcggcacacccaccgacggggcgccgttccgggggcgctccaagtcggctccccccgtgctatgggctgcgaaaaagta
cggacggcagctgcggcgcatgagcgacgagttcgatagcctgatggacaaaggggagttgaagttcaagagcgccggcg
gcacatccagggccatccaccactccaaaacctggtggagctacctcttcagccaccaggagacggagggcgagaacaac
aacaacaaccaccacgacaaccatgctaatcgtactgaatag
>gnl|bcl2dbcds|A0A3Q2YCX7_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Hippocampus comes GN=BMF (length=408 residues).
atggaggatgaggaggatgatgtgtttgagccagacccccactgctggcgcaccacattcaaggagataaagtgtgagga
gcgggcaacacagacacctggccccgtcccggcatcaaacaacggcatgctgccctgtggagtcgcagaggagccaagac
cactcttctacggtaacgcaggttttcgattgcacttcccggcccactttgaacttgttggtgaacaggaggagcgactg
caagaaagcgacgacggaatggagcagcaactccagcagcagcagcagcagcagcccgtggcacgcagcatagaggcctg
cgtcggtcagaaactccagctgattggagaccagtttcatcgggaacacttacagctggtgagcaggaatcaacacaagc
acaaataa
>gnl|bcl2dbcds|A0A3Q2YCX7_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Hippocampus comes GN=BMF (length=408 residues).
atggaggatgaggaggatgatgtgtttgagccagacccccactgctggcgcaccacattcaaggagataaagtgtgagga
gcgggcaacacagacacctggccccgtcccggcatcaaacaacggcatgctgccctgtggagtcgcagaggagccaagac
cactcttctacggtaacgcaggttttcgattgcacttcccggcccactttgaacttgttggtgaacaggaggagcgactg
caagaaagcgacgacggaatggagcagcaactccagcagcagcagcagcagcagcccgtggcacgcagcatagaggcctg
cgtcggtcagaaactccagctgattggagaccagtttcatcgggaacacttacagctggtgagcaggaatcaacacaagc
acaaataa
>gnl|bcl2dbcds|A8MXU7_BAD-04 BCL2-associated agonist of cell death gene OS=[Eukaryota] Homo sapiens GN=BAD (length=492 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagaacttcgtattctccttcttgggaatctgaggactctgaaaatcccagt
gcagggatgctcgcggaagcatcagcagggatgtccgccccagccgctgactcagaagcccaacacgcagagaatgtaaa
gctagaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacggaggacgacgaagggatggg
ggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|A8MXU7_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Homo sapiens GN=BAD (length=474 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagaagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaag
ctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctcccagtgacctt
cgctccacatcccgaaactccacccgttcccactgccctgggcagccatcttgaatatgggcggaagtacttccctcagg
cctatgcaaaaagaggatccgtgctgtctcctttggagggagggctgacccagattcccttccggtgcgtgtga
>gnl|bcl2dbcds|B4DQK3_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Homo sapiens GN=BBC3 (length=600 residues).
atggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacgg
cccgcgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgccgccc
ccgccgcccccaccctgctgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctggggggt
tcccgctggcctgggggtccccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctctcgctggcgga
gcagcacctggagtcgcccgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagtccgcg
gggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcacagtacgagcgg
cggagacaagaggagcagcagcggcaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgccctt
acccaggggccacagagcccccgagatggagcccaattag
>gnl|bcl2dbcds|B4DZQ9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Homo sapiens GN=BAD (length=450 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacg
gaggacgacgaagggatgggggaggagcccagcccctttcggggccgttcgcgctcggcgccccccaacctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcgggcacagcaacgcagatgcggcaaagccccaggcgcctgcgctaa
>gnl|bcl2dbcds|O43521_BCL2L11-20 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=228 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagtctcactctgtcacccaggctggagtgcactggtgc
gatcttggctcactgcaacctccaactcccaagttcaagcggttctcctgcctcagcctcccaagtag
>gnl|bcl2dbcds|Q6JTU4_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=111 residues).
atgaggcaggctgaacctgcagatatgcgcccagagatatggatcgcccaagagttgcggcgtatcggagacgagtttaa
cgcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|Q9BXH1_BBC3-04 BCL2 binding component 3 gene OS=[Eukaryota] Homo sapiens GN=BBC3 (length=306 residues).
atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggctgcttccacgacgtgggtcccctgcca
gatttgtgagacaagaggagcagcagcggcaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctg
cccttacccaggggccacagagcccccgagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|Q9BXH1_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Homo sapiens GN=BBC3 (length=786 residues).
atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggctgcttccacgacgtgggtcccctgcca
gatttgtggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgc
gacggcccgcgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgc
cgcccccgccgcccccaccctgctgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctgg
ggggttcccgctggcctgggggtccccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctctcgctg
gcggagcagcacctggagtcgcccgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagt
ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcacagtacg
agcggcggagacaagaggagcagcagcggcaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctg
cccttacccaggggccacagagcccccgagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|A0A287CT05_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BAD (length=537 residues).
atggggatcccagaaaaagccctcatcgcttccacgcacgctccaggcgcgaggaagtcagggaaggagggaccggggag
gaaggcggtaggacccgcaggtcggcggcgagggtggcacccggcctggacccagagcatgttccagatcccagagtttg
agcccagtgagcaggaagactccagctccgcagaagggggcctgggccccagccccgcaggggaccggccaggctgcggc
ttggctccaggcctccccagggacacgggtcaccagcagtggcaggcaaccagcagcagcaaccatggaggcgctggggc
tacggagacccggagtcgccacagctcgtaccccgcagataccgatttggatgaagggatggaagaggagcccagcccct
tccgcggccgctcgcgctcggcgccccccaatctctgggctgcacagcgctacggccgcgagctccggaggatgagcgac
gaattcgagggctcctttaaggtgacattttcccagtccccattcctgagggcctaa
>gnl|bcl2dbcds|A0A287CT05_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BAD (length=627 residues).
atggggatcccagaaaaagccctcatcgcttccacgcacgctccaggcgcgaggaagtcagggaaggagggaccggggag
gaaggcggtaggacccgcaggtcggcggcgagggtggcacccggcctggacccagagcatgttccagatcccagagtttg
agcccagtgagcaggaagactccagctccgcagaagggggcctgggccccagccccgcaggggaccggccaggctgcggc
ttggctccaggcctccccagggacacgggtcaccagcagtggcaggcaaccagcagcagcaaccatggaggcgctggggc
tacggagacccggagtcgccacagctcgtaccccgcagataccgatttggatgaagggatggaagaggagcccagcccct
tccgcggccgctcgcgctcggcgccccccaatctctgggctgcacagcgctacggccgcgagctccggaggatgagcgac
gaattcgagggctcctttaagggacttcctcgcccgaggagcgcaggcacagcgtcgcagatgcggcaaagctccagctg
gacgcgcttcatccagtcctggtgggatcggaacttggggaggcgaggctccgccccctcccagtga
>gnl|bcl2dbcds|A0A287CXH0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BMF (length=777 residues).
atgccccgagcgggcgtattttggaaacaataccgcgcggtgcgcagtggcctcctccggcgcccgccagagtccgcagc
cgccgccggccctgccagcggctcccgcctccctgggagcggagtctcgctcccccaagtgttcatcacgctggaccctg
gcgcagagccctggcatcacgactcggaggccgagactctctcctggagtcacccaggtgagatggagccgcctcagtgt
gtggaggagctggaagatgatgtgttccagccagaggatggggagccagggacccagcctgggagcttgctctctgctga
cttgtttgcccagagccagctggactgccccctcagcaggcttcagctcttccctctcacccactgctgtggtcctgggc
ttcgacctaccagccaggaagacaaggccactcagaccctcagcccagcctccccaagccagggtgtcatgctgccttgt
ggagtgactgaagaaccccagcgactcttttatggcaatgctggctaccggcttcctctccctgctagtttccctgcagg
cttgccccttggagagcagccccctgaaggtcagtggcaacatcgagcagaggtacagatcgcccgaaaacttcagtgca
ttgcagaccagttccaccggcttcatatgcagcaacaccagcagaaccgaaatcgtgtgtggtggcagattctcctcttc
ctgcacaacctggcattaaatggagatgagaacagggaccgggcaggtcctaggtga
>gnl|bcl2dbcds|A0A287CXH0_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BMF (length=570 residues).
gttttcccagaggagatggagccgcctcagtgtgtggaggagctggaagatgatgtgttccagccagaggatggggagcc
agggacccagcctgggagcttgctctctgctgacttgtttgcccagagccagctggactgccccctcagcaggcttcagc
tcttccctctcacccactgctgtggtcctgggcttcgacctaccagccaggaagacaaggccactcagaccctcagccca
gcctccccaagccagggtgtcatgctgccttgtggagtgactgaagaaccccagcgactcttttatggcaatgctggcta
ccggcttcctctccctgctagtttccctgcaggcttgccccttggagagcagccccctgaaggtcagtggcaacatcgag
cagaggtacagatcgcccgaaaacttcagtgcattgcagaccagttccaccggcttcatatgcagcaacaccagcagaac
cgaaatcgtgtgtggtggcagattctcctcttcctgcacaacctggcattaaatggagatgagaacagggaccgggcagg
tcctaggtga
>gnl|bcl2dbcds|A0A287DFJ0_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L11 (length=420 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgcagagaggcctcccca
gctcaggccgggggcccctacctcccttcagacagagcctcaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctgagtgcaatggcttccatgcgggagtctcaggcagaa
cctgcagacatgcgcccggagatctggatcgcgcaggagctgcggcgaatcggagatgagtttaacctgtattacccacg
gagggtattttttaataattaccaacctgaagaccgcccccaaatggttatcttgcgcctgttgcgttgcatcatccgcc
tggtgtggaggatgcactga
>gnl|bcl2dbcds|A0A287DFJ0_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L11 (length=588 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgcagagaggcctcccca
gctcaggccgggggcccctacctcccttcagacagagcctcaaggtaatcccgaaggcgaaggggaccgctgcccccacg
gcagcccacagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcttccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctgagtgcaatggcttccatgcgggagtctc
aggcagaacctgcagacatgcgcccggagatctggatcgcgcaggagctgcggcgaatcggagatgagtttaacctgtat
tacccacggagggtattttttaataattaccaacctgaagaccgcccccaaatggttatcttgcgcctgttgcgttgcat
catccgcctggtgtggaggatgcactga
>gnl|bcl2dbcds|I3LVX0_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BIK (length=324 residues).
atggttcagggcagtcaccaggtggccctgcgactggcctgcattggggatgagatggatctgtgttttcaggacctcca
actggcccagctgcctgggatggccatgcacagccttgctctcagctacagccaggcgagagtcacgggtgtgctcagaa
gcttggcccagggtctcgccagcctcagggagaacatgtggttctggagacctgcagcccccagcacccgggtgcctcct
gcccgggcctgccgggagctgctgcccgtgctgctgctgctgggcctgttgctgagcagggccctgtacctgcggctcca
gtga
>gnl|bcl2dbcds|A0A3Q2ZA20_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Kryptolebias marmoratus GN=BMF (length=492 residues).
atggacgatgaggaggatgatgtgtttgagccagatcccagctgctggcgcacgactttcagggagataaagtgcgaaga
ccggggcacacagacacccggtcctgccctggtaccacacagcggcatgctgccctgtggagtcgcagaggagcccagac
cactattctacggtaacgcaggttttcgattgcacttcccagctcgcttcgaactcatcagggatcttgaagcgaggcaa
caagacagggaagaggagccaaacaggatggagcggctgccccggcagctgcccgtggcgcgcagcttggaagtttgtat
tggacagaaactccagctgataggagaccagtttcaccgggaacacttgcagcagtatcatcgaaaccaaaggaaccagg
ggccgctgtggtggcgcctgactgcagctctcctcagccttctgtttgatagggggttcattgcgggaggagggggtgca
ggacggaggtga
>gnl|bcl2dbcds|A0A3Q3AEL8_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Kryptolebias marmoratus GN=BAD (length=501 residues).
atggctgcaaagttcaccatttcagacagcgagtcggagccctcagacgaggtagaggagggaaagagcaaacagccggc
agcgggaccggaggacggcgtccgccagcgcctcaccctgcccgagctcaggcattcaaagaacggccggctcagggtga
actcggagtcgctctcctccaccagctccaggggggaggaggagctcccggcgcgggcagacgacgagcccgggaccccc
accgaggggtatccgttcagggggcgatccaagtcggcccctccagccctgtgggccgccaagaagtacggccggcagct
ccgccggatgagcgacgagttcgacagcctgctcgacaagggggagatgaggaaggtgaagagcgccgggacgaccaaac
agatacaccactcccgaagctggtggaactacctctttagtcaccaggagacggacggcgagagcagccaccacgagaag
ccgacccaccgcaccgagtaa
>gnl|bcl2dbcds|A0A3Q3AEL8_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Kryptolebias marmoratus GN=BAD (length=501 residues).
atggctgcaaagttcaccatttcagacagcgagtcggagccctcagacgaggtagaggagggaaagagcaaacagccggc
agcgggaccggaggacggcgtccgccagcgcctcaccctgcccgagctcaggcattcaaagaacggccggctcagggtga
actcggagtcgctctcctccaccagctccaggggggaggaggagctcccggcgcgggcagacgacgagcccgggaccccc
accgaggggtatccgttcagggggcgatccaagtcggcccctccagccctgtgggccgccaagaagtacggccggcagct
ccgccggatgagcgacgagttcgacagcctgctcgacaagggggagatgaggaaggtgaagagcgccgggacgaccaaac
agatacaccactcccgaagctggtggaactacctctttagtcaccaggagacggacggcgagagcagccaccacgagaag
ccgacccaccgcaccgagtaa
>gnl|bcl2dbcds|A0A3Q3B113_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Kryptolebias marmoratus GN=BCL2L11 (length=717 residues).
atgcgtagtccatccagaccgccaaatctgcgcgatggctcgaccgaagtaaaggcaacagagggcagcagcggaggagc
tccaccgtccgccggcgccgctcgaggctcggcgcacgcgacccgtccggtccgcggcagagcgccgagcgccgcgggag
gagagcccgagtcgccggcctgctcctccaacccccccgctggcttagacgtgtttcggagcaggtcgatatttcgcttc
ccccggcgctcgtccagcggctacttctctttcgagggcgactcgctgccgagctctccgctctcgccgaagccagtgac
ggcggagaaagccacgcagacgcccagccccaccggccaggtgatgaaccacgccctgcagcgaatggctgtggagcagg
gaggaggaccggggacgcaccggctgcacggaagctctcccaacccctctggcacgcaggcacgaaacgcagcaggggac
atggaggcagagtcattcggacgtcatctccggaccattggggatgagtacaataggcttttacttttaaggaggatggc
aggccgacccagacgaaacatcgttcctctgaacctcctgccacacatccaccaggagcctgtcgccatgctctgcgtga
gcctcctgctcctcctgattggacggctcatgtacttacaaggctgcacaaacagccagaataattctcaggtttag
>gnl|bcl2dbcds|A0A3Q3ESW6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L11 (length=714 residues).
atgcaccgtccgtccagaccaccgaaccggttggatggctcgcccacagtaacggaatcacacgggaccagaggagatcc
accacaaacctcccgttcagacaacagcggggggcgaaactttggccgcaccgattccacgggaggaggagagccggact
caccgtcccggtgcagattcaaaccagtctcccctgtggacagcctcggcgtgttccagaagagatctatatttcacctt
cctcgccgcgcctcgagtggatacttctcctacgacggagactcgctgccgagctctccgctctccccgaggccgctgac
ggctgacaaagccacgcagactcccagccccagtggccaggtgatgcaacacgctctgcagcgcatgactgaggcgcacg
gaggaggaccggggacgcagcagcagtacgggcactctcccagcctcactagccggcgacaacggactgcagcaggggac
atgcaggcggaggctattggacgagatctccaacgcattggcgacgactataatagactactgctatggagaatggcagg
tagacatggtcggcctgaggtccatccaaacccgcagccgcacatccaaccggagcccaccatgctgctgtgtacgggtc
tcatgatccttctgattggatggattatctacttgcgaggcaatacaaacagccatgaccactctcaggtgtag
>gnl|bcl2dbcds|A0A3Q3FKT9_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Labrus bergylta GN=BAD (length=666 residues).
atgaagtgtaacaacaagtgttatcattttataagacttgtttttgtcaaaaagcagtcggttatctgcgcaggttacgg
cactgtgaatacctttggaccggcttacagcagggacagcacagagaataagatatcctgcttgggtgtgttagatgtca
cgatggctgcgaagttcactatttcagacagtgagtccgggtcagaagaggaggtaaaagaggaagagaacgaccaatca
tcagctgtggaagagccgcatgttccccaacgacacagcttaaccctaccagagctcagactggcagggactggtcggat
caggttgaactcagagtcccacgcttacaccgtctccagggacgaagagctccaggccaggggggaagaagaggctggca
cccccacggaaggagcgccattcaggggacgatcaaaatcggctccccctgccttgtgggcagctaaaaaatacggccgg
cagctccggaggatgagcgacgagtttgacatcctgcttgacaaaggggagatgaaaaaagtaagaagccctgggccagc
caaacagatgcaccactccaagagttggtggagctacctcttcagccaccaggagacagagggagagaacaaccaccacg
aaaaccacacccaccgcaatgagtaa
>gnl|bcl2dbcds|A0A3Q3FKT9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Labrus bergylta GN=BAD (length=588 residues).
atgacactaacagcaagtgatgtcacgatggctgcgaagttcactatttcagacagtgagtccgggtcagaagaggaggt
aaaagaggaagagaacgaccaatcatcagctgtggaagagccgcatgttccccaacgacacagcttaaccctaccagagc
tcagactggcagggactggtcggatcaggttgaactcagagtcccacgcttacaccgtctccagggacgaagagctccag
gccaggggggaagaagaggctggcacccccacggaaggagcgccattcaggggacgatcaaaatcggctccccctgcctt
gtgggcagctaaaaaatacggccggcagctccggaggatgagcgacgagtttgacatcctgcttgacaaaggggtgagaa
ttaaaggggggggggggggtagcaggggtggctgtggattagtggtggagtcggtcgtctctcaaccgaaaagtcaggag
ttcaatacccagctcctgcagccacatgtccgatgtgtccttgggtccttgaatgtgtataaatgggattacctaatact
gatcatcactttacacagcagcctctag
>gnl|bcl2dbcds|A0A3Q3GUU5_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Labrus bergylta GN=BMF (length=474 residues).
atggacgatgaagaggatgatgtgttcgagccggacccacacagctggcgcacctattttcaggagataaagtgtgaaga
ccggggcacgcagacacctggcccggccctggcacccaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggcaacgcaggttttcgattacacttccctgcaaactttgagcttgttggggatcaggaagagagcgga
caagaaagcgagctgcagcaaattgggatggagcagcagcaacctgttgcccacagtgtggaggccagcatcggtctgaa
actccaactcataggagaccagtttcatcgggaacacttacaactgtatcatcgaaaccaaaggaaccaggggcctctgt
ggtggcgtctgggtgcagctttgctgagccttctgtttgacaggggcttcatcgctggagcaggacggaggtga
>gnl|bcl2dbcds|H3ANP3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Latimeria chalumnae GN=BAD (length=522 residues).
atgttccagatttcagactccgactcagacgcgtacgaagatgatagaacgggccccttgccactgcagtctggaggagg
aagaggcgagggatcagagccaagtgaaaaaacagcgggtttaaagaaacacagccggacagcccccaatctgcagaacc
cgggacctcaccagagccaccccccttctcacacagataacatggagattctggggcgtccaagttccgagtcccagatc
tcagactcagaatcactggatgagcttggccctttcaggacaaggtctcgttccgcaccacctaacttctgggccgcaag
gaagtacgggcaagaactgcggagaatgagcgatgaattcgacatgtcctttctggggcttccgaggccaaagagcgctg
gagcagctggagaaatggtggacgagagctggtggaagaaactgatacgctctctaaaggggcgcgggcaacccagggac
ccgcctgggcaacagggagtgtcgatccgaggacctgactaa
>gnl|bcl2dbcds|H3ANP3_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Latimeria chalumnae GN=BAD (length=522 residues).
atgttccagatttcagactccgactcagacgcgtacgaagatgatagaacgggccccttgccactgcagtctggaggagg
aagaggcgagggatcagagccaagtgaaaaaacagcgggtttaaagaaacacagccggacagcccccaatctgcagaacc
cgggacctcaccagagccaccccccttctcacacagataacatggagattctggggcgtccaagttccgagtcccagatc
tcagactcagaatcactggatgagcttggccctttcaggacaaggtctcgttccgcaccacctaacttctgggccgcaag
gaagtacgggcaagaactgcggagaatgagcgatgaattcgacatgtcctttctggggcttccgaggccaaagagcgctg
gagcagctggagaaatggtggacgagagctggtggaagaaactgatacgctctctaaaggggcgcgggcaacccagggac
ccgcctgggcaacagggagtgtcgatccgaggacctgactaa
>gnl|bcl2dbcds|H3ANP3_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Latimeria chalumnae GN=BAD (length=525 residues).
atgttccagatttcagactccgactcagacgcgtacgaagatgatagaacgggccccttgccactgcagtctggaggagg
aagaggcgagggatcagagccaagtgaaaaaacagcgggtttaaagaaacacagccggacagcccccaatctgcagaacc
cgggacctcaccagagccaccccccttctcacacaggtgtatacggttgggtaaaacttaggaagcgaaataacatggag
attctggggcgtccaagttccgagtcccagatctcagactcagaatcactggatgagcttggccctttcaggacaaggtc
tcgttccgcaccacctaacttctgggccgcaaggaagtacgggcaagaactgcggagaatgagcgatgaattcgacatgt
cctttctggggcttccgaggccaaagagcgctggagcagctggagaaatggtggacgagagctggtggaagaaactgata
cgctctctaaaggggcgcgggcaacccagggacccgcctgggcaa
>gnl|bcl2dbcds|M3XHJ5_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Latimeria chalumnae GN=BCL2L11 (length=477 residues).
atgccaacagaggaaagtttacaatttgacaaagaccaaggtacatcagatgtaatttctgaatgtggacatttgcatcc
cacccaaagaccagatcaaccaccgtttgtaaagcaagagggctgctactgcattatcagcccactttcaaaagtgatcg
cactggtgaggtggagagacagatctttactcagcaccctgatgggaggacttctgttgccccccagcccctgtcctttt
gtcactaggtccccgtttttcatcttcatgaggcggtccttagttttatccacatcttccagtggatattttacttttga
ctctgatatagttcatagccctgcacctgtaagtgtccacaaggctacacagactccaagcccatcaagccaactcatcg
tacacgtacagcattgcttagcgcaaagagaacagcatcccgaaactcatggtaagaaccctttgaactttacataa
>gnl|bcl2dbcds|W5N4P7_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Lepisosteus oculatus GN=BMF (length=462 residues).
atggaagaggatgaagatgacgtgttccacccgtcacatttctcacactgctggggaacccaattcagggaaataaagta
cgaggacaagggcacgcagacgccaagtccagccttggtacatggtgacaacatgttgccgtgtggtgtcggagcagagc
ctcgccgactcttctatggtaatgctgcctttcgattgcacttccctgcacattttgaacagggcggggatgaggaagag
gagacgggtgaagctgaggagcagccggtgcggagtgctgaggttcgaataggccaaaagctccagaggataggagatca
gtttcaccgagactatctccacatgtaccgcagaaaccaaaggaaccaccagcccatgtggtggaggctggctttggctt
tgttcacattcctgtttgagagacaagggaacaggaaccaacttcgtggtgaccagaggtga
>gnl|bcl2dbcds|C1C3S9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Lithobates catesbeiana GN=BAD (length=453 residues).
atgggggattctcctcataagtctatgtttagtattgaagagtttccaccgacagaaagggggtctgcattttctggaac
aaatcctccaggttttggaggagatcctggacacaagagttcccctaacttgagacgaataaaaggaaaagaaactcggc
aacggacagaatctgcttcagaagcctcagagacggacagtgttggagagcttcaacatttccgctcacgttcccgctct
gctccatcttctctaatggttgcagctcgatatggacgagagctgaggcgaatgagtgatgaattcgaccaaatcttcac
gagtatccctcgacctaaaagtgcaagtgcagccactgagatgaccgttagcaagagtttcggagaaacattttttaact
tctttagaagaaagaacaaagaccgaagtcagtcagaaaacgacaagcactga
>gnl|bcl2dbcds|G3SU55_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Loxodonta africana GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacagttacagcctgcggagaggcccccgca
gcctcctcagctcaggcctggggcccctacctctctgctcacggagcctcaaggtaatcctgacggtgaaggggacagct
gcccccagggcagcccacagggcccgcaggccccaccagccagccccggcccttttgctaccagatccccgcttttcatc
tttgtgagaagatcctccctgctgtctcgatcctccagcgggtatttctcttttgacacagacaggagcccagcacccat
gagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccatcaaccattacctcagtgcaatggcttccatga
ggcagtctcaggctctacctgcagacctgcgcccggagatctggattgcgcgagagctacggcgcattggagacgaattc
aatgcctactacccaaggagggcttttttgaataattaccaagcagccgaagaccaccctcaaatggttatcttacgtct
cttacgctacatcgtccgcctggtgtggaga
>gnl|bcl2dbcds|G3T0P7_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Loxodonta africana GN=PMAIP1 (length=177 residues).
atgccggggaagaaggcacgcaagagcgcgcagcccggccctgccgggaccccggcaggtactcaacagcgcgatgttgt
cgagtgtgctattcaactcaggagaattggagacaaaattaatttccggcagaaacttctgaatgtgatatgcaagctct
tctgctcaggcacctga
>gnl|bcl2dbcds|G3T2N1_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Loxodonta africana GN=BBC3 (length=561 residues).
atggcccgcgcacgccaggagggcagctcccccgagcccgtagagggtctggcccgcgagagcccgcgccccttcccact
cggcagcctggtgccctcggccgtgtcctgtggcctctgcgagcccggccttcctcgagttgcagggccacggctccttc
cggggcctcggacacagctgtttcccagcccctctccagtctgggtctctgatctctcgggactgcagttggagagaggt
ggggccgagtgggaggacagggcccctcgtcctctctcaggtcctcagccctcactctcgccggcggagcagcacctgga
gtcgccggtgcccacgcaggcggccccgggggtccggggagaggatgagcaatgggcccgagagatcggggcccagtttc
ggcggaaggcggacgacctctatgcgctgtacgagcggtcggtgagacaggaggagcagcaccggcaccgtccctcgccc
tggagggtcctgtacaatctcatcatgggactactgcccttaccaagggaccatggcgcccccgagatggagcccaatta
g
>gnl|bcl2dbcds|G3T7Z4_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Loxodonta africana GN=BMF (length=807 residues).
atgccccgagcgggggtattttggaaacaataccgcacggtgttgagtctcgtccaccagcgcccgccagcgcttgctgc
cgccgccgtccgttcgccgcgcctgccgccgctgcccgctgagctttttccctccttcccaatcgaatctgggcgccaag
ccccccgagtgctcgtcacgctggaccctggcgcggagccctggcgtcacgacccggagactgacactctttcctggagt
cacccaggggagatggagccatctcagtgtgtggaggagctggaggatgatgtattccaaccagaggagggggagcctgg
gacccagcccgggggcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccggcttcagctct
tccctctcacccactgctgtggccctgggcttcgacacaccagccaggaggacaaggcaactcagactctcagcccagcc
tccccaagccagggtgtcatgctgccttgtggggtgaccgaggaaccccagcgactcttttatggcaatgctggctaccg
gctccctctccctgccagtttccctgcaggcttgccacttggggagcagccccctgaagggcagtggcaacatcgagcag
aggtacagattgcccgaaagcttcagtgcattgcagaccacttccaccggcttcatatgcagcggcaccagcagaaccga
aatcctgcgtggaggcagattctccaattcctgcaccaccttgctgtgaacggggaggagaacaggaatggggcaggtcc
taggtga
>gnl|bcl2dbcds|G3TP47_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Loxodonta africana GN=BAD (length=621 residues).
ggacccccagagaatccctcaccggcttccacacacgcccaaggcgtgaggatgtcgggagctgaacatccggagaagaa
gaagggacgcaggagatcatcgggcgggctgcagagtatgttccagatcccagagtttgagcagagtgaccgggaagact
ccacccctgcagacaggggcctgggccccagccccgaagggtactggccttcaggccccagcgaccgccaccgtgtggcc
ccaggcttcctgcgggactccagtcaccagcaggggcagccgaccagcagcggccaccatggaggtgctgcggctgtgga
gacccggagtcgccacagctcataccccgcagggtctgatgaggctgaagggctggaggaggatcccagcccctttcggg
gtcgctcgctttcagcgccccccaacctctgggctgcacagagatatggccgtgagctccgcaggatgagtgatgagttc
cagggctatttcaagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaagccccagctggacacg
catcatccaggcctggtgggatcggaatttggggagaggcagctccgccccgtctcagtga
>gnl|bcl2dbcds|G3UH24_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Loxodonta africana GN=HRK (length=273 residues).
atgtgtccgtgccccctgcaccgtggccgcggccccccggccgtgtgcgcctgcagcgcaggtcgcctgggtctgcgctc
gtccgccgcgcagctcaccgctgctcggctcaaggcgcttggagacgagctgcaccagcgcaccatgtggcggcgtcgcg
cgaggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggcggcgcaggtggcggcg
ctggcggcctggctgctccgcaggcggaacttg
>gnl|bcl2dbcds|A0A2K5V8J3_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Macaca fascicularis GN=BBC3 (length=396 residues).
ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccagggcttcttctgcgacgtgggtcccctgcca
gatttgtggtcctcagccctcgctcttgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcaatacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccccgaaatggagcccaattag
>gnl|bcl2dbcds|A0A2K5VCA9_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca fascicularis GN=BAD (length=492 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagagcttggtattctccttcttgggaatctgaggactctgaaaatcccagt
gcaaggatgctcgcggaagcatcagcacggatgtctgccccagccactgactcagaagcccaacacgcagagaatgtaaa
gctgaaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacggaggaggacgaagggatgga
ggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|A0A2K5VCA9_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca fascicularis GN=BAD (length=471 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctc
cagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgcaccctcccagtgaccttcgc
tccacgcccggaaactccacccgctctcactgtcctggtcggccatcttggatatgggcggaagtgcttccctcaggcct
tatgcaaaagaggatccgtgctgcctctttcggtgggagggctgacccagattcccttccggtgcatgtga
>gnl|bcl2dbcds|A0A2K5VLE9_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Macaca fascicularis GN=BMF (length=390 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccggggtcccaacccgg
gagctctctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacgcaccagcagaaccgaaatcgcgtgtggt
ggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcgggccctag
>gnl|bcl2dbcds|A0A2K5VLE9_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Macaca fascicularis GN=BMF (length=555 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccggggtcccaacccgg
gagctctctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcgggccctaggtga
>gnl|bcl2dbcds|A0A2K5VPX2_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Macaca fascicularis GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccaacgcgggctcaggcagagctcgaagtcgagtgtgctac
tcaactcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|A0A2K5VPX2_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Macaca fascicularis GN=PMAIP1 (length=399 residues).
atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccaacgcgggctcaggcaggacaggcagggacggcagggac
ggcgagggaccaggccggatttgggattgggatgcagctgcattacaccagaggcaaaaagctcgtctcctcctccccac
ttgtccttccgcggggccacgaggaacaagtgcaagtagctcgaagtcgagtgtgctactcaactcaggagatttggaga
caaactgaacttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaacctgactgcatcaaaaacttg
cataaggggactccaaaagagactttttctcaggaggtgcacacttcatcaatttgaagaaagattgcattgtaattgg
>gnl|bcl2dbcds|A0A2K5VW94_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Macaca fascicularis GN=BIK (length=483 residues).
atgtctggagtaagacccatctccagagacaccttgatggagaccctcctgtatgagcagctcctggaacccctaaccat
ggaggttcttggtgtcactgaccctgaagaggacctggaccctatggaggacttcaatcctttggagtgtatggaggaca
gtgacatgttggccctgcggctggcctgcatcggggacgagatggatgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctgggtctggctttcatctacgaccagatggacgacatcagggatgttcttagaagttt
catggatggtttcaccacccttagggagaacataatgaggttctggagatccccgaatcccaggtcctgggtgtcccgtg
aacaggtgctgctggtgctgctgctgctgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctcaag
tga
>gnl|bcl2dbcds|A0A2K5X1Y3_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|A0A2K5X1Y3_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggatgtcgcttccacctgattaa
>gnl|bcl2dbcds|Q2PG01_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca fascicularis GN=BAD (length=249 residues).
atggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccg
cgagctccggaggatgagtgacgagtttgtggactcctttaaggggcttcctcgcccgaagagcgcgggcacagcgacgc
agatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgcaccc
tcccagtga
>gnl|bcl2dbcds|F7CM09_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Macaca mulatta GN=BMF (length=555 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaacagaacaggaacggggcgggccctaggtga
>gnl|bcl2dbcds|F7CM09_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Macaca mulatta GN=BMF (length=555 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaacagaacaggaacggggcgggccctaggtga
>gnl|bcl2dbcds|F7CM09_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Macaca mulatta GN=BMF (length=591 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaacagaacaggaacggggcgggccctaggcccctgac
ctggaatggggctgttgtcaaaccctgttga
>gnl|bcl2dbcds|A0A2K6ASP2_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Macaca nemestrina GN=BBC3 (length=396 residues).
ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccagggcttcttctgcgacgtgggtcccctgcca
gatttgtggtcctcagccctcgctcttgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcaatacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccccgaaatggagcccaattag
>gnl|bcl2dbcds|A0A2K6AYL7_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Macaca nemestrina GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcttggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgcttggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A2K6B5F6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Macaca nemestrina GN=BMF (length=555 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtaactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcgggccctaggtga
>gnl|bcl2dbcds|A0A2K6B5F6_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Macaca nemestrina GN=BMF (length=555 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtaactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcgggccctaggtga
>gnl|bcl2dbcds|A0A2K6B5F6_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Macaca nemestrina GN=BMF (length=390 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtaactgaggaaccccagcgactcttttacgcaccagcagaaccgaaatcgcgtgtggt
ggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcgggccctag
>gnl|bcl2dbcds|A0A2K6B5F6_BMF-04 Bcl2 modifying factor gene OS=[Eukaryota] Macaca nemestrina GN=BMF (length=555 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtaactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcgggccctaggtga
>gnl|bcl2dbcds|A0A2K6BV43_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Macaca nemestrina GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccaacgcgggctcaggcagagctcgaagtcgagtgtgctac
tcaactcaggagatttggagacaaactaaacttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|A0A2K6BV43_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Macaca nemestrina GN=PMAIP1 (length=399 residues).
atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccaacgcgggctcaggcaggaccggcagggacggcagggac
ggcgagggaccaggccggatttgggattgggatgcagctgcattacaccagaggcaaaaagctcgtctcctcctccccac
ttgtccttccgcggggccacgaggaacaagtgcaagtagctcgaagtcgagtgtgctactcaactcaggagatttggaga
caaactaaacttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaacctgactgcatcaaaaacttg
cataaggggactccaaaagagactttttctcaggaggtgcacacttcatcaatttgaagaaagattgcattgtaattgg
>gnl|bcl2dbcds|A0A2K6DBJ4_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Macaca nemestrina GN=BIK (length=483 residues).
atgtctggagtaagacccatctccagagacaccttgatggagaccctcctgtatgagcagctcctggaacccctaaccat
ggaggttcttggtgtcactgaccctgaagaggacctggaccctatggaggacttcgatcctttggagtgtatagaggaca
gtgacatgttggccctgcggctggcctgcatcggggacgagatggatgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctgggtctggctttcatctacgaccagatggacgacatcagggatgttcttagaagttt
catggatggtttcaccacccttagggagaacataatgaggttctggagatccccgaatcccaggtcctgggtgtcccgtg
aacaggtgctgctggtgctgctgctgctgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctcaag
tga
>gnl|bcl2dbcds|A0A2K6E212_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2L11 (length=417 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctgca
gatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggt
atttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtccgcctgg
tgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K6E212_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggatgtcgcttccacctgattaa
>gnl|bcl2dbcds|A0A2K6E7I4_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca nemestrina GN=BAD (length=471 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctc
cagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgcaccctcccagtgaccttcgc
tccacgcccggaaactccacccgctctcactgtcctcgtcggccatcttggatatgggcggaagtgcttccctcaggcct
tatgcaaaagaggatccgtgctgcctctttcggtgggagggctgacccagattcccttccggtgcatgtga
>gnl|bcl2dbcds|A0A2K6E7I4_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca nemestrina GN=BAD (length=492 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagagcttggtattctccttcttgggaatctgaggactctgaaaatcccagt
gcaaggatgctcgcggaagcatcagcacggatgtctgccccagccactgactcagaagcccaacacgcagagaatgtaaa
gctgaaggcgctggggctgtggagacccgcagtcgccacagctcctaccccgcggggacggaggaggacgaagggatgga
ggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|A0A2K5XJR2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mandrillus leucophaeus GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcctcgc
gggggacaggccctcagactgcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagc
acagcgttatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A2K5XJR2_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mandrillus leucophaeus GN=BAD (length=471 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcctcgc
gggggacaggccctcagactgcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctc
cagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctcccagtgaccttcgc
tccacgccccgaaactccacccgctctcaccgtcctggtcggccatcttggatatgggcggaagtgcttccctcaggcct
catgcaaaagaggatccgtgctgcctctttcggtgggagggctgacccagattcccttccggtgcatgtga
>gnl|bcl2dbcds|A0A2K5XSA1_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Mandrillus leucophaeus GN=BIK (length=471 residues).
atgtctggagtaagacccatctccagagacaccttgatggagaccctcctgtatgagcagctcctggaacccctaaccat
ggaggttcttggtgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttggagtgtatggaggaca
gtgacatgttggccctgcggctggcctgcatcggggacgagatggatgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctgggtctggctttcatctacgaccagacggacgacatcagggatgttcttagaagttt
cctggatggtttcaccacccttagggagaacataatgaggttctggagatccccgaatcccaggtcctgggtgtcccgtg
aacaggtgctgctgctgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctcaagtga
>gnl|bcl2dbcds|A0A2K5Z4A9_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Mandrillus leucophaeus GN=BMF (length=555 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtaactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcgggccctaggtga
>gnl|bcl2dbcds|A0A2K5Z4A9_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Mandrillus leucophaeus GN=BMF (length=390 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtaactgaggaaccccagcgactcttttacgcaccagcagaaccgaaatcgcgtgtggt
ggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcgggccctag
>gnl|bcl2dbcds|A0A2K5Z7V3_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L11 (length=336 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcattctagaggatataggtgat
agttcattgtttggatttatatttactggcttagatttgtatggccaccaccacagtcaagatacagaacaactcaacca
caaggatttctcatga
>gnl|bcl2dbcds|A0A2K5Z7V3_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgtt
gcgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K5ZWH1_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=PMAIP1 (length=399 residues).
atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccaacgcgggctcaggcaggacaggcagggacggcagggac
ggcgagggaccaggccggatttgggattgggatgcaactgcatttcaccagaggcaaaaagctcgtctcctcctccccac
ttgcccttccgcggggccacgaggaacaagtgcaagtagctcgaagtcgagtgtgctactcaactcaggagatttggaga
caaactgaacttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaacctgactgcatcaaaaacttg
cataaggggactccaaaagagactttttctcaggaggtgcatacttcataaatttgaagaaagattgcattgtaattgg
>gnl|bcl2dbcds|A0A2K5ZWH1_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccaacgcgggctcaggcagagctcgaagtcgagtgtgctac
tcaactcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|A0A3Q3RVI2_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Mastacembelus armatus GN=BMF (length=492 residues).
atggacgatgaggaggatgatgtgtttgagccagacccccacttctggcgcaccacgttcagggagataaagtgtgaaga
ccggggcacacagacacctggccctgccttggcgctgaacaacggcatgctgccctgtggagtcgcagaggagccaagac
cactcttctacggcaacgcaggttttcgattgcacttcccggcacattttgaacttgttggggatcaggaagtgaggcaa
caagaaagagaagaggagcaaaacaggatggagcagctacccaggcagcaacctctcgtgcacagtgtggaggcgtgtat
tggccagaaactccagctgataggagaccaatttcaccgagaacacttgcaactgtatcatctaaaccaaaggaaccagg
ggctgctgtggtggcgcctggccacagctctgctcagcctactgtttgacagagggttcattgctggaggaggcagagca
ggacggaggtga
>gnl|bcl2dbcds|A0A3Q3RVI2_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Mastacembelus armatus GN=BMF (length=465 residues).
atggacgatgaggaggatgatgtgtttgagccagacccccacttctggcgcaccacgttcagggagataaagtgtgaaga
ccggggcacacagacacctggccctgccttggcgctgaacaacggcatgctgccctgtggagtcgcagaggagccaagac
cactcttctacggcaacgcaggttttcgattgcacttcccggcacattttgaacttgttggggatcaggaagtgaggcaa
caagaaagagaagaggagcaaaacaggatggagcagctacccaggcagcaacctctcgtgcacagtgtggaggcgtgtat
tggccagaaactccagctgataggagaccaatttcaccgagaacacttgcaactgcaggttggctgggcgccagagacgt
caggcagtttgcctgtcttgttagcatgcctcaccttgataacaggagtgtggagagagggatga
>gnl|bcl2dbcds|A0A3Q3RXS8_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mastacembelus armatus GN=BAD (length=468 residues).
atggctgcaaaattcagtatttcagaaagcgaatcagactcatcagaggaggtagagggaggaaaacagaagaagtcgtc
agcaaggcaagagcaacaggtttctcagcgccacgcccttgccttacctgagctcagaacaacagcctccaatcgaatca
ggctgagttcggagtcccagtccagggtggatgaggaggctggtacgcccacagacggagctccatttaggggaaggtcc
aagtcagctccccctgctctgtgggcagccaagaaatatggccagcagctccgaaggatgagcgatgagtttgacagcct
cctggataaaggggaaatgagagtgaggaatgctggcaaggcccaaaagatgcaccactctaaaacctggtggagctacc
tctttagttaccaggagacagatggagaaaacaacctccatgaaaaccacacaccccgcacagagtag
>gnl|bcl2dbcds|A0A3Q3RXS8_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mastacembelus armatus GN=BAD (length=468 residues).
atggctgcaaaattcagtatttcagaaagcgaatcagactcatcagaggaggtagagggaggaaaacagaagaagtcgtc
agcaaggcaagagcaacaggtttctcagcgccacgcccttgccttacctgagctcagaacaacagcctccaatcgaatca
ggctgagttcggagtcccagtccagggtggatgaggaggctggtacgcccacagacggagctccatttaggggaaggtcc
aagtcagctccccctgctctgtgggcagccaagaaatatggccagcagctccgaaggatgagcgatgagtttgacagcct
cctggataaaggggaaatgagagtgaggaatgctggcaaggcccaaaagatgcaccactctaaaacctggtggagctacc
tctttagttaccaggagacagatggagaaaacaacctccatgaaaaccacacaccccgcacagagtag
>gnl|bcl2dbcds|A0A3Q3SYA1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL2L11 (length=438 residues).
atggcaacagaggagagcggagatccaccagccggtgatcccagagtctcggcgcaaacctcccgttcgaacggcggcac
cgaccagagctccgtctcgccgtcccgaggcagaaccagatccattgcccatctcgacagcctaagcgtgtttcacacga
ggtcaatattccagcttcctcgccgctcctctagtggatatttctcctccgacggcgactcgctgccgagttcccctctc
tccccgaggccggtgacagctgacaaagccacgcagactccgagcctcacgagccaggtgatgaaccacgccctgcagcg
cctggctgaagcgcacggcggaggagctggagcgcaccggcagcatggtgagcacaaacacctacgtagtcgcttattca
ctgcccatgctgaatacacgcaggtaaagcagccttaa
>gnl|bcl2dbcds|A0A3P9B2E4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Maylandia zebra GN=BAD (length=393 residues).
atggctgcaaacttcaaaatttcagacagtgattcagaggcatcagaggaggtaggggaaggagaaaaccaacagtcagc
aggacaagctcaagaaagcaagccccagacgctttcccttcctgtaaccaaaacgacagctgctggaaggctcagggtga
actcagagtcccacacttcctcaattgccagggatgaggagctcatggctagaggggaggatgaggtctgtactcccaca
gagggagacccattcaggcgaaggtcaaagtcagctccccctgctctgtgggctgccaagaagtacggcaggcagcttcg
acgaatgagtgacgagtttgacagcttactagataaaggggtaagaatgggagtgagtcaaggcttaaattag
>gnl|bcl2dbcds|A0A3P9DPJ5_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Maylandia zebra GN=BMF (length=492 residues).
atggacgatgaggaggacgatgtgtttgagccaaaagccaactgttggcgcaccacattcagggagataaagtgtgaaca
tcgaggcacacagacacccggtcctgccctggtaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtaacgcaggttttcgattgcacttcccggcacgcttcgagctcgtcggggatcacagagcgagtcga
caaggaagcacggagcagcaaaacagcatggagcgcctgccccgccagcgacccgcggctcgcagcgtggaggcctgcat
tggacagaaactccagctcataggagaccagtttcactgggaacgcctgcaactgtatcaccgaaaccaaaggaaccagg
ggccgatgtggtggcgcctggccgcggccattctcagccttctgtttgatagggggttcatagccggaggagggggtgga
ggacggaggtga
>gnl|bcl2dbcds|A0A3P9DPJ5_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Maylandia zebra GN=BMF (length=492 residues).
atggacgatgaggaggacgatgtgtttgagccaaaagccaactgttggcgcaccacattcagggagataaagtgtgaaca
tcgaggcacacagacacccggtcctgccctggtaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtaacgcaggttttcgattgcacttcccggcacgcttcgagctcgtcggggatcacagagcgagtcga
caaggaagcacggagcagcaaaacagcatggagcgcctgccccgccagcgacccgcggctcgcagcgtggaggcctgcat
tggacagaaactccagctcataggagaccagtttcactgggaacgcctgcaactgtatcaccgaaaccaaaggaaccagg
ggccgatgtggtggcgcctggccgcggccattctcagccttctgtttgatagggggttcatagccggaggagggggtgga
ggacggaggtga
>gnl|bcl2dbcds|G1MV54_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Meleagris gallopavo GN=BCL2L11 (length=219 residues).
tttttgctctgtgcagcttccaggtggcgatctcactcacttgcagaagaaatacaaccagaaatatggattgcacagga
gctgcggcgcatcggggatgaattcaatgcctcctattgtccaagaaggggtttcttggataaccatgctggaaaccccc
aggtggtcattctgcgcctcctgcattacatcatccgcctcatctggaggatgcagtga
>gnl|bcl2dbcds|G1NHG8_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Meleagris gallopavo GN=BMF (length=582 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgcttacatgtccccccagttggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
gggaggcgcgtactgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagcgg
catcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaatgtggaggcgaacag
gaaccgcactgggcagaggtga
>gnl|bcl2dbcds|A0A1U7Q4V0_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mesocricetus auratus GN=BAD (length=615 residues).
atgggaaccccaaaacagccctcgctggctcctgcacacgccctaggcgtgaggaagtccgatcccggaatccgaagcct
ggggaacgacgcgggaggaaggcggcgaagaccagcagcccagagtatgttccagatcccagagtttgagccgagtgagc
aggaagactccaatactgcagataggggcctgggccctagcctcactggggacccaccaggtccctgcctggctccaggt
ctcctggggaacatcagacaccaacaggaacaggcagccaacagcagtcatcatggaggcactggggctatggagacccg
gagtcgccacagttcatacaccgcggggaacgaggaggatgaagggatggaagaggagctcagcccctttcggggccgct
cgcgttcggctccccccaatctctgggctgcgcagcgctacggccgcgagctccgaaggatgagcgatgagtttgagggt
tccttcaagggacttcctcgcccaaagagcgcagggactgcaacacagatgcgacaaagcgccagctggacgcgcattat
ccagtcctggtgggatcgaaacttgggcaaaggaggctccactccctcccaatga
>gnl|bcl2dbcds|A0A1U7QLK6_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Mesocricetus auratus GN=PMAIP1 (length=318 residues).
atgctccagagcgtagcgcgtcagaacgcgccatcgaacccagcgcgggcagagctagcgcctgagttcatagctcaact
ccggaggattggagacaaactgtcttctgagtggtgtgaacccgacatcattgcggtgctggcggagatgcctggcaaga
aggctcgaaagagcgtgacgaggattccgagcccaacgcgggtcccaacagatgtggaagacgagtgtgttcatcaactc
cggaggattggagacaaacagaatttgcggcagaaacttctgaattttatttccaagctctttagtttagtaacctga
>gnl|bcl2dbcds|A0A1U7R468_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Mesocricetus auratus GN=HRK (length=279 residues).
atgtgcccgtgtccccggcatcgcggccacgggcctccggccgtgtgcggttgcggcgacactcgccccgggctgcgctg
ggcggcggcacaggtgaccgcgctgaggctgcaggcgctgggcgacgagctgcaccgacgcgccatgcggcgccgcgcgc
ggccccgggacccgctgcctgcgctgctgcccgcactccgcgcccgctggccctggctgtgcgcggccgcgcaggtggcg
gcgctggcggcctggctgctcggcaggcggagcgcgtag
>gnl|bcl2dbcds|A0A1U7R5N5_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Mesocricetus auratus GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctctccggagcccgtagagggcttggcccgcgacagtccgcgccccttcccgct
cggccgcctggtgccctccgctgtgtcctgcggcctctgcgagcccggcctgcccgccgcccctgctgcccccgccctgc
tgccggccgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccgaccccgaggcccacgcccggacggtcctcagccctcgctgtcaccggcccagcagcacctagagtcgcc
cgtgcccagcgccccggaggccctggcgggcggccccacccaagcagccccgggagtgcgcggggaggaggaggagtggg
cccgggagatcggggctcagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaagagcaa
catcgacaccgcccgtcgccctggagggtcatgtacaatctcttcatgggactcctccccttacccagggatcctggagc
cccagaaatggagcccaactag
>gnl|bcl2dbcds|A0A1U8BW10_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Mesocricetus auratus GN=BCL2L11 (length=270 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaacagcaagacaggagtccggcacccatgagttgtgacaagtcaa
cacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcaatggatctgtgtgagaatcttaagcacgag
tggcagattcatggtgatcaaagtaaaagt
>gnl|bcl2dbcds|A0A1U8BW10_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Mesocricetus auratus GN=BCL2L11 (length=426 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaacagcaagacaggagtccggcacccatgagttgtgacaagtcaa
cacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcaatggcttccataaggcagtctcaggaggaa
cctgcagatatccgcccggagatatggattgcacaggagcttcggcggattggagacgagttcaacgaatcttacagaag
gagggtaaataattaccaagaggatgaagaccaccctcaccaccctcaaatggttatcttacaactgttacgcttcatcg
tccgactagtatggagaaggcattga
>gnl|bcl2dbcds|A0A1U8BW10_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Mesocricetus auratus GN=BCL2L11 (length=594 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaacagcaaggtaatcctgacggtgaaggggaccgctgcccccacg
gcagcccgcagggcccgctggccccaccggccagccctggcccttctgctaccagatccccacttttcatctttgtgaga
agatcttctctgctgtcccggtcctccagtgggtatttctcttttgacacagacaggagtccggcacccatgagttgtga
caagtcaacacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcaatggcttccataaggcagtctc
aggaggaacctgcagatatccgcccggagatatggattgcacaggagcttcggcggattggagacgagttcaacgaatct
tacagaaggagggtaaataattaccaagaggatgaagaccaccctcaccaccctcaaatggttatcttacaactgttacg
cttcatcgtccgactagtatggagaaggcattga
>gnl|bcl2dbcds|A0A1U8CPE0_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Mesocricetus auratus GN=BMF (length=570 residues).
attttcccaggagagatggagccacctcagtgtgtggaggagctggaagatgatgtgttccagtcagaggatggggagcc
agggacacaacctgggagcttgctctctgctgacccgtttgcccagagccagctggattgtcccctcagccggcttcagc
tcttccctctcactcactgctgtggtcctgggctccggcccataagccaggaagacaaggccacccagaccctcagccca
gcctccccaagccagggtgttatgctgccttgtggggtgacagaggaaccccagagactcttttacggcaatgctggcta
caggcttcctctccctgccagtttccccgcaggcttgcccctcggggagcagccccctgaaggacagtggcaacatcgag
cagaggtacagatcgccagaaagcttcagtgtattgctgaccagttccatcggctgcacatacaacaacaccagcagaac
cgagaccgtgcatggtggcaggtcttcctcttcctgcaaaacctggccttgaacagagaagaaaacagggaaggggtggg
tccctggtga
>gnl|bcl2dbcds|A0A1U8CPE0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Mesocricetus auratus GN=BMF (length=555 residues).
atggagccacctcagtgtgtggaggagctggaagatgatgtgttccagtcagaggatggggagccagggacacaacctgg
gagcttgctctctgctgacccgtttgcccagagccagctggattgtcccctcagccggcttcagctcttccctctcactc
actgctgtggtcctgggctccggcccataagccaggaagacaaggccacccagaccctcagcccagcctccccaagccag
ggtgttatgctgccttgtggggtgacagaggaaccccagagactcttttacggcaatgctggctacaggcttcctctccc
tgccagtttccccgcaggcttgcccctcggggagcagccccctgaaggacagtggcaacatcgagcagaggtacagatcg
ccagaaagcttcagtgtattgctgaccagttccatcggctgcacatacaacaacaccagcagaaccgagaccgtgcatgg
tggcaggtcttcctcttcctgcaaaacctggccttgaacagagaagaaaacagggaaggggtgggtccctggtga
>gnl|bcl2dbcds|A0A3Q3VLX6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Mola mola GN=BMF (length=450 residues).
atggacgatgacgaggatgatgtatttgagccagaggcccactgctggcgcaccacattccgggagataaagtgtgaaga
ccggggcacgcagacacctggccctgccctggcaccatacagcggcatgcttccttgtggagtcgcagaggaacccagac
acctcttctacgtgacctcatccctggcgcctgatagtcgtgataactgtagggagcgaaacgggatggagcggcttcca
cggcagcagcctgtggctcacagtgtggaggcctgcatcggccagaagctccagctgataggagaccagtttcaccggga
acacatgcaactgtatcatcgaaaccaaaggaaccaggggccgctctggtggcgcttgggttcagctctgctcagccttc
tgtttgacagggggttctttgctggaggaggtggagcgggacggaggtga
>gnl|bcl2dbcds|A0A3Q3WTY4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mola mola GN=BAD (length=438 residues).
atggctaccaatttcaccatttcaagtgacagcgagtcagagctgtcagaggaaatagaagaaggagaaaacagtcagct
acaaactgagcaagagcagcaggtttttcaacgtcacaccctcaccctacctgagctcaggatggcaggtaggacactgc
aggttaagggggaagacgaggctgggacgcccaccgatggagctccgttcaggggcaggtccaaatctgctcccccttct
ttgtgggcagccaagaaatatggacagaggctccgaaggatgagcgatgaatttgacaggcaagaatggaagacgaggag
tgctgggacggccacacagatgcaccagtctcgaagctggtggagctacctctttagtcaccaggagacggacggagaga
acaaccatcatgatagccacacgcatcgtaatgagtag
>gnl|bcl2dbcds|F7CXT2_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Monodelphis domestica GN=BCL2L11 (length=618 residues).
atggcaaaacaaccgtcagatctaaattctgagtgtgacagagaaggtggacaattgcagcctacagaaaggcctactca
gcctcaacaactcagaccaggggcccctacctctatacaaacacagtatcaaggtaattcaggtgaaggggacagctgct
cacccagcagtcctcagggaccgtttgcaccacccactagccctagtccatttgctaccagatccccacttttcatcttt
ttaagaagatctccactgctgcctcgatcttccagtgggtatttctcttttgacacagacaggagtccagcgcctatgag
ttgtgataaatctacacaaactccaagccctccttgtcaagccttcaatcattatctaagtgcaatgggtaagcaagatc
atgcttccatgaggcagtctcaatcaatacctgcagatatgcggccagaaatttggattgcacaagaattgcgccgtatt
ggagatgaatttaatgcttcctattatccaagaagggggtttttggataataactatcaaggagcaggtgaccatcacca
aatggttattttacgcctgttacgttacatcatccgccttgtttggagaatgcagtga
>gnl|bcl2dbcds|F7CXT2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Monodelphis domestica GN=BCL2L11 (length=390 residues).
atggcaaaacaaccgtcagatctaaattctgagtgtgacagagaaggtggacaattgcagcctacagaaaggcctactca
gcctcaacaactcagaccaggggcccctacctctatacaaacacagtatcaagacaggagtccagcgcctatgagttgtg
ataaatctacacaaactccaagccctccttgtcaagccttcaatcattatctaagtgcaatggcttccatgaggcagtct
caatcaatacctgcagatatgcggccagaaatttggattgcacaagaattgcgccgtattggagatgaatttaatgcttc
ctattatccaagaagggcagtgtggcattgtttcaagagctttgggattggagttggaagtcagctttga
>gnl|bcl2dbcds|F7G1G0_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Monodelphis domestica GN=HRK (length=297 residues).
atgtgcccgtgtcccctgcaccgcggtcgcggtcccccggcggtgtgcgcctgcagctcggaccgcctggaacagcgcgc
ggcggcggcagcacagctcacggccgcccgcctcaaggcgcttggggacgagctgcaggaacggaccatgtggaggcgcc
gggcgcggagtcggcgggccgcagcggaggcggccggcagcggcggcggcgggctccccgcctactgggcttggctgtgc
gcggccgctcatgtggcggcgctggcggcctggctgctccggaggagaaacttgtag
>gnl|bcl2dbcds|F7GL32_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Monodelphis domestica GN=BBC3 (length=615 residues).
atggccagagcccagcaggatggcagctctccggagccggtggaggggctgccccgggagagccccaggaccttccccct
gggccggctcatgccctctgcggtctcctgcagcctctgtgaggccggcttgaacccctctggcgactccatgtgcccag
ccccggggccagcgctggcaccctcttccctcctgcccctcgcttacttctgcacgcgacagccccgtgcctatgggggc
ccccgctgggcacgggcggccaggagcccggcggccggcaaccagggccaaagcggttccctgccctccctgggccccag
gtctgcccaggaggaggggggacaggagggagagccccagggagcgtcccccatgtctggcggccccccgggggtgttag
gcccggagcacggggaccaaggcgagcagcaggaccgggagatcggcgcccagctgcgcaggatggccgatgacctcaac
gccctgtacgagcagcggagacgggaggaggagcagaggcgccacctgtcgccctggaggctgctgtacaatctcatctc
ggggctcctggccccccagcgaaggaaccggatgccggacgtggagcccaactag
>gnl|bcl2dbcds|F7GL32_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Monodelphis domestica GN=BBC3 (length=957 residues).
atgggtgtgcggccccgcggcgccccctggcgcccggagccggcggggggcggcggggctgggggccgggcgaggggcac
ggccgggcgggcgcgtgccactgggcgtgttgttttccaggggctcggcgtgggcctccgcagtggtgagtgtgcgccgc
ggctgggggtgcgcgtgccgtgccgtgagcgggggccgctgtcaccgcgctgctgctgccgctgtgagtgcggggccgga
ctggggaaactgaggcggggccgggcccgaggggtggcaccgccgctcacctgctccgcccacctgtctgtgtccctccg
caggctccctccccactggggcatggccagagcccagcaggatggcagctctccggagccggtggaggggctgccccggg
agagccccaggaccttccccctgggccggctcatgccctctgcggtctcctgcagcctctgtgaggccggcttgaacccc
tctggcgactccatgtgcccagccccggggccagcgctggcaccctcttccctcctgcccctcgcttacttctgcacgcg
acagccccgtgcctatgggggcccccgctgggcacgggcggccaggagcccggcggccggcaaccagggccaaagcggtt
ccctgccctccctgggccccaggtctgcccaggaggaggggggacaggagggagagccccagggagcgtcccccatgtct
ggcggccccccgggggtgttaggcccggagcacggggaccaaggcgagcagcaggaccgggagatcggcgcccagctgcg
caggatggccgatgacctcaacgccctgtacgagcagcggagacgggaggaggagcagaggcgccacctgtcgccctgga
ggctgctgtacaatctcatctcggggctcctggccccccagcgaaggaaccggatgccggacgtggagcccaactag
>gnl|bcl2dbcds|A0A3Q3K6I5_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Monopterus albus GN=BCL2L11 (length=711 residues).
atgcacctatctagaccaccaaaccgctccgatggctcgaccgcagtaacagcaacagaggagagcggagatccaccatc
tgtcggtgccgctggaacctcggcgcaaagctcccgttcgaacggcggcagcgagcggagctttggccaccccggctcgg
ccggaggaggagagccggtctcgccttcccggtgcagaaccaaagccatcgctcctctcgacagcctaagcgtgtttcac
acaaggtctatattccacctccctcgccggtcctccagtggatatttctccaacgacagcgactctgtgccgagctcccc
gctctccccgaggccagtgacggctgacaaagtcacgcagactccgagtcccagcagccaggtgatgaaccacgccctgc
agtgcatggctgaggcgcacggcggtcgaccggggacgcaccggcaagatgcaagctcgcccagcccctctagcgcacgg
cagcagaacgcaataagggacatgcaggcggaggcagttggacgagagctccgacgcatcggagatgactataataacca
ccttctggagttggcagacagacgtagacgggttgtgccgcgtatccaccaggaactcaccatcgtgctctgcgtgggca
tcctggtccttgtgattggtcagataatcttgcaaggcagtataaacagccaggacaactctcaggtttag
>gnl|bcl2dbcds|A0A3Q3QZ16_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Monopterus albus GN=BMF (length=483 residues).
atggacgatgaggaggatgatgtgtttgagccagacccccactgctggcgtactgcattcagggagataaagtgtgaaga
ccggggcacacagacagctggccctaccctggcaccgaacaacagtatgctgccctgtggagttgcagaggatcccagac
cactcttctatggcaacgcaggttttcgattgcacttcccagcacactttgagcttgttggggatcaggaagcgaggcga
caagaggatcaaaacgggatggagcatctaccccggcagcaacgtgtggcgcgcagtgtggaggcctgtattggccagaa
actccagctgataggagatcagtttcatcgagaacacctacagctgtatcatcgaaaccaaaggaaccaggggccgctgt
ggtggcgcctggccacaactctgctcagccttctgtttgatagggggttcattgctggaggaggcggagcgggacggagg
tga
>gnl|bcl2dbcds|A0A3Q3QZ16_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Monopterus albus GN=BMF (length=483 residues).
atggacgatgaggaggatgatgtgtttgagccagacccccactgctggcgtactgcattcagggagataaagtgtgaaga
ccggggcacacagacagctggccctaccctggcaccgaacaacagtatgctgccctgtggagttgcagaggatcccagac
cactcttctatggcaacgcaggttttcgattgcacttcccagcacactttgagcttgttggggatcaggaagcgaggcga
caagaggatcaaaacgggatggagcatctaccccggcagcaacgtgtggcgcgcagtgtggaggcctgtattggccagaa
actccagctgataggagatcagtttcatcgagaacacctacagctgtatcatcgaaaccaaaggaaccaggggccgctgt
ggtggcgcctggccacaactctgctcagccttctgtttgatagggggttcattgctggaggaggcggagcgggacggagg
tga
>gnl|bcl2dbcds|A0A3Q3R5S3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Monopterus albus GN=BAD (length=507 residues).
atggctgcaaacttcacgatttcagacagtgaatcagagtcttcggaggaggtagaggaaggaaaacacagccaatcatc
aacttcgcaagaacaacaggttcctccatgccacagccttaccttacctgagctcagaatggcagcaaccagtcgaaaca
gggtgagctcggagtccaatgcttccactgtccaggatgccaagtcagatgaggaggctggtacacccacagacggagct
ccattccggggacggtccaagtcagctccccctgctctgtgggcagcaaagaaatatggccggcagctccgaaggatgag
cgatgagtttgacagtctgctggacaaaggggagatgaagagggtgaggagtgccggggcggccagccagatgcaccact
ctaaaagctggtggagctacctctttagtcatcaggagacagagggagagaacacccaccatgaaaacgcggcgctggct
caggaggtagagcgggtcgtttcctaa
>gnl|bcl2dbcds|A2AV74_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Mus musculus GN=BMF (length=816 residues).
atgcccggagcgggcgtattttggaaacaataccgcgcggtgtgccgtggcctcctcccgcgccagctcgcgcctgcagc
agtcgctgccgcagcccgcgccaccgcctcccaccgcagcccgctggagtttgcccccttcttcccaatcgagtgtgggc
accaagccccccgagtgttcttcaccctggaccctggcgcagagccctggcatcacaactcggaggctgagacgctgtcc
tggagtcacccaggagagatggagccacctcagtgtgtggaggagctagaagatgatgtgttccagtcagaggatgggga
gccagggacacagcctgggggcttgctctctgctgacctgtttgcccagagccagctggactgtcccctcagtcgactcc
agctcttccctctcacccattgctgtggtcccggactccggcccataagccaggaagacaaggccactcagaccctcagt
ccagcttccccaagccagggtgtcatgctgccttgtggggtgacagaggaaccccagagactcttttacggcaacgctgg
ctacaggcttcctctccctgccagtttccctgcaggctcaccccttggggagcagccccctgaaggacagttccttcagc
accgagcagaggtgcagatcgccagaaagcttcagtgtattgcagaccagttccatcggcttcatacgcaacaacaccag
cagaaccgagaccgtgcgtggtggcaggtcttccttttccttcaaaacctcgccctgaacagacaagaaaacagggaagg
ggtggggccctggtga
>gnl|bcl2dbcds|A2AV74_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Mus musculus GN=BMF (length=573 residues).
atgtccccaggagagatggagccacctcagtgtgtggaggagctagaagatgatgtgttccagtcagaggatggggagcc
agggacacagcctgggggcttgctctctgctgacctgtttgcccagagccagctggactgtcccctcagtcgactccagc
tcttccctctcacccattgctgtggtcccggactccggcccataagccaggaagacaaggccactcagaccctcagtcca
gcttccccaagccagggtgtcatgctgccttgtggggtgacagaggaaccccagagactcttttacggcaacgctggcta
caggcttcctctccctgccagtttccctgcaggctcaccccttggggagcagccccctgaaggacagttccttcagcacc
gagcagaggtgcagatcgccagaaagcttcagtgtattgcagaccagttccatcggcttcatacgcaacaacaccagcag
aaccgagaccgtgcgtggtggcaggtcttccttttccttcaaaacctcgccctgaacagacaagaaaacagggaaggggt
ggggccctggtga
>gnl|bcl2dbcds|O54918_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Mus musculus GN=BCL2L11 (length=591 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaaccgcaaggtaatcccgacggcgaaggggaccgctgcccccacg
gcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccacttttcatctttgtgaga
agatcttctctgctgtcccggtcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caagtcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatacgacagtctc
aggaggaacctgaagatctgcgcccggagatacggattgcacaggagctgcggcggatcggagacgagttcaacgaaact
tacacaaggagggtgtttgcaaatgattaccgcgaggctgaagaccaccctcaaatggttatcttacaactgttacgctt
tatcttccgtctggtatggagaaggcattga
>gnl|bcl2dbcds|O54918_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Mus musculus GN=BCL2L11 (length=276 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaaccgcaagacaggagcccggcacccatgagttgtgacaagtcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatcagttggagaatcttaaccaagtg
gcacaaaatatccacggtgatgcctggtacaactga
>gnl|bcl2dbcds|O70337_BIK-02 BCL2-interacting killer gene OS=[Eukaryota] Mus musculus GN=BIK (length=453 residues).
atgtcggaggcgagacttatggccagagacgtcatcaagactgttccacacgaccaggtcccccaacctccagtggcctc
tgagactcccagcatgaaggagcctgtgagagacgtggacctcatggagtgcgtggaaggcagaaaccaggtggccttga
ggctggcctgcatcggcgatgagatggacctgtgtctgcggagcccccgtctggtccagctgcctgggattgctatacac
agactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagcttgattcgaagcctcaccaacctcaggga
aaacatctggtcctggagagtcttgactcctggcgcctgggtgtcacctgaccaggaccctgggcagctgtttccgatgg
tgctgctggtcttcttgctgctgggtggggcctggtatttgcagcttcagtga
>gnl|bcl2dbcds|O70337_BIK-04 BCL2-interacting killer gene OS=[Eukaryota] Mus musculus GN=BIK (length=321 residues).
atgttcaccagaaaccaggtggccttgaggctggcctgcatcggcgatgagatggacctgtgtctgcggagcccccgtct
ggtccagctgcctgggattgctatacacagactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagct
tgattcgaagcctcaccaacctcagggaaaacatctggtcctggagagtcttgactcctggcgcctgggtgtcacctgac
caggaccctgggcagctgtttccgatggtgctgctggtcttcttgctgctgggtggggcctggtatttgcagcttcagtg
a
>gnl|bcl2dbcds|O70337_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Mus musculus GN=BIK (length=453 residues).
atgtcggaggcgagacttatggccagagacgtcatcaagactgttccacacgaccaggtcccccaacctccagtggcctc
tgagactcccagcatgaaggagcctgtgagagacgtggacctcatggagtgcgtggaaggcagaaaccaggtggccttga
ggctggcctgcatcggcgatgagatggacctgtgtctgcggagcccccgtctggtccagctgcctgggattgctatacac
agactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagcttgattcgaagcctcaccaacctcaggga
aaacatctggtcctggagagtcttgactcctggcgcctgggtgtcacctgaccaggaccctgggcagctgtttccgatgg
tgctgctggtcttcttgctgctgggtggggcctggtatttgcagcttcagtga
>gnl|bcl2dbcds|P62816_HRK-03 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Mus musculus GN=HRK (length=279 residues).
atgtgcccgtgtccccggcatcgcggccgcgggcccccggccgtgtgcggttgcggcgacgctcgccccgggctgcgctg
ggcggcggcgcaggtgaccgcgctgcggctgcaggcgctgggcgacgagctgcaccgacgcgccatgcggcgtcgcgcgc
ggccccgggacccgctgcccgcgctgctgcccgcgctccgcgcccgctggccctggctgtgcgcggccgcgcaggtggcg
gcgctggcggcctggctgctcggcaggcggagcgcgtag
>gnl|bcl2dbcds|Q61337_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mus musculus GN=BAD (length=615 residues).
atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtccgatcccggaatccggagcct
ggggagcgacgcgggaggaaggcggtggagaccagcagcccagagtatgttccagatcccagagtttgagccgagtgagc
aggaagacgctagtgctacagataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
ctcctggggagcaacattcatcagcagggacgggcagccaccaacagtcatcatggaggcgcaggggctatggagactcg
gagtcgccacagttcgtacccagcggggaccgaggaggatgaagggatggaggaggagcttagcccttttcgaggacgct
cgcgttcggctccccccaatctctgggcagcgcagcgctacggccgtgagctccgaaggatgagcgatgagtttgagggt
tccttcaagggacttcctcgcccaaagagcgcaggcactgcaacacagatgcgacaaagcgccggctggacgcgcattat
ccagtcctggtgggatcgaaacttgggcaaaggaggctccaccccctcccagtga
>gnl|bcl2dbcds|Q61337_BAD-05 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mus musculus GN=BAD (length=396 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagacgctagtgctacagataggggcctgggccctagcctcac
tgaggaccagccaggtccctacctggccccaggtctcctggggagcaacattcatcagcagggacgggcagccaccaaca
gtcatcatggaggcgcaggggctatggagactcggagtcgccacagttcgtacccagcggggaccgaggaggatgaaggg
atggaggaggagcttagcccttttcgaggacgctcgcgttcggctccccccaatctctgggcagcgcagcgctacggccg
tgagctccgaaggatgagcgatgagtttgagggttccttcaaggtgagcgccagcgttaggtgcgatgggacctga
>gnl|bcl2dbcds|Q99ML1_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Mus musculus GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctctccggagcccgtagagggtctagcccgcgacagtccgcgccccttcccgct
cggccgcctgatgccctccgctgtatcctgcagcctttgcgagcccggcctgcccgccgcccctgctgcccctgccttgc
tgccggccgcctacctctgcgcccccaccgctccacctgccgtcaccgccgccctggggggcccccgctggcctgggggt
caccgcagccggcccagaggcccgcgcccggacggtcctcagccctccctgtcaccagcccagcagcacttagagtcgcc
cgtgcccagcgccccggaggccctggcaggaggccccacccaagctgccccgggagtgcgtgtggaggaggaggagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaagagcag
catcgacaccgaccctcaccctggagggtcatgtacaatctcttcatgggactcctccccttacccagggatcctggagc
cccagaaatggagcccaactag
>gnl|bcl2dbcds|Q9JM54_PMAIP1-03 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Mus musculus GN=PMAIP1 (length=165 residues).
atgcctgggaagtcgcaaaagagcaggatgaggagcccaagcccaacccgggtgccagcagacttgaaggacgagtgtgc
tcaactccggaggattggagacaaagtgaatttacggcagaaacttctgaatttgatttccaagctcttcaatttagtaa
cctga
>gnl|bcl2dbcds|Q9JM54_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Mus musculus GN=PMAIP1 (length=312 residues).
atgcccgggagaaaggcgcgtcggaacgcgccagtgaacccaacgcgggcagagctaccacctgagttcgcagctcaact
caggaagatcggagacaaagtgtattgcacgtggagtgcaccggacataactgtggttctggcgcagatgcctgggaagt
cgcaaaagagcaggatgaggagcccaagcccaacccgggtgccagcagacttgaaggacgagtgtgctcaactccggagg
attggagacaaagtgaatttacggcagaaacttctgaatttgatttccaagctcttcaatttagtaacctga
>gnl|bcl2dbcds|M3Y0R3_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Mustela putorius furo GN=BBC3 (length=606 residues).
caggccccagggagcgccatggcccgagcacgccaggagggcagctccccggagcccgtagagggcctgtcccgcgacgg
cccgcgcccctttcccctcagccgcctggtgccctcggccgtgtcctgtggcctctgggaatctgactgcagtccccgag
ttgcagcccacggccttttccgggccggggcagcagctgtttcccagcccccacctcccccagtctgggtctccttaacc
tcccagaggacgatagttggagggagtgtgggcagagcgagaggactgcttttcccaggtcctcagccctcactctcgcc
ggcggagccgcacctggaatcgccggtgcccagtgccccgggggccctggcgggcggccccacccaggcagccccgggag
tccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggaggatggcggacgacctcaacgcgctgtac
gagcggcggagacaagaagagcagcagcgacaccgcccctccccctggagggtcctgtacaatctcatcatgggactcct
gcccttacccaggggccgtggagccccagagatggagcccaattag
>gnl|bcl2dbcds|M3YAD5_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Mustela putorius furo GN=BMF (length=555 residues).
atggagccgcctcagtgtgtggaggagctggaggatgacgtgttccagccagaggatggggagccggggacccagcctgg
gagcttgctctctgctgacctgtttgcccagagccagctggactgccctcttagccgtctgcatctcttccctctcaccc
actgctgtggccctgggcttcgacccaccagccaggaggacaaggccacccagaccctcagtccagcctccccgagtcag
ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagcttccctgcaggcttgcctctcggggaccagccccctgaagggcagtggcagcatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcgacttcacatgcagcaacaccagcaaaaccaaaatcgggtgtgg
tggcagatccttctcttcctacacaaccttgctttgaacgcagacgagaacaggaatggggcgggtcccaggtga
>gnl|bcl2dbcds|M3YDI3_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Mustela putorius furo GN=BCL2L11 (length=699 residues).
atgttcccggcggcggcggccggggcagcgcgggccagaggcgcggcgcgcggagccctcggctgccggacggctcgcgg
cggcgggcgggctgccagtggccggctctgcgctgccccgggggctctgaaggcgagtcccaggctttgtctcccgcgct
tctttcgtgctgagggtcagggagctccgggtcggcgaaggacgcgagcgggacgccgcggggctcgggcccggacgcga
cggtcggaagggaaggggcggacaaaaaaagaccaaatggcaaagcaaccttcagatgtaagttctgagtgtgaccgaga
aggtggacaattgcagcctgttgagaggcctcctcagctcaggcctggggcccctacctctctacagacagagcagcaag
acaggagcccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctc
agtgcaatggcttccaggaggcagtctcaggctgtacctgcagatatgcgcccggagatgtggattgcgcaggagttgcg
gcgtattggagacgagtttaatgcgtattacccaaggagggtctttttgaataattacccagcagccgaagcccaccccc
aaatgattatcttacgactgttacgttacatcatccgcctggtgtggagattacagtga
>gnl|bcl2dbcds|M3YNE7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mustela putorius furo GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcccagtgagcaggaagactccagccctgcagataggggcctgggccccagccccac
aggggatcaacccccaggccttggcaagcacctgcagacggccccaggcctcctaggggaagctggtcaccagcaggggc
agccggccagcagcagccaccatggaggcgctggggctgtggagacgcggagtcgccacagctcgtaccccgcggggacc
gaggaagatgaggggatggaggaagaagagcttagccctttccgggggcgctcgcggtcagcgccccccaacctctgtgc
ggcactgcgttacggccgcgagctccggaggatgagcgacgagttccagggctccttcaaggggcttcctcgcccgaaga
gcgcaggcacagccacgcagatgcgacagagccccagttggacgcgcgtcatccagtcctggtgggatcggaacttgggg
agaggaggctccgccccctcccaatga
>gnl|bcl2dbcds|G1P8C5_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Myotis lucifugus GN=BAD (length=525 residues).
cctacagcccagagcatgttccagatcccagagtttgagcacagtgagcaggaagactccagccctgcagataggggcct
gggcccctgccccacaggggaccagcccccaggcctcaacaagcactggagtacggtcccaggtctcctgggggaagctg
gtcaccagcagggccagccggccagcagcagccaccatgacggcgctgggtctgtggagccgcggagtcgccacagctcg
taccccacggggaccgaggaggatgacgacaccgaggagggggagcccagccccttccgcggccgctcgcgttcagcgcc
cccaaacctctgggcagcacagcgctacggccgcgagctccggaggatgagcgacgagttccagggctcctttaagaagg
gtctccctcgcccgaagagcgctggcacagcaacgcagatgtggcaaaagtccagctggacgcgctttttccagtcctgg
tgggatcggaactcggggagaggaggctccgccccctcccagtga
>gnl|bcl2dbcds|G1P8F9_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Myotis lucifugus GN=PMAIP1 (length=165 residues).
atgcccgggaagaaggcgcgtaagaacgcgcagcctagcccgacgcgggccccggcagaggctgaaattgagtgtgccct
tcaattaaggagaattggagacaagctgagtttcctgcagaaacttctgaatctgatgtacaaactctttggctcaggaa
cctga
>gnl|bcl2dbcds|G1PAU1_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Myotis lucifugus GN=BMF (length=555 residues).
atggagccacctcagtgtgtggaggagctggaggatgatgtgtttcagccagaggatgagctggggacccagcctgggag
tttgccctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcagctcttccctctcacccact
gctgtggccctgggcttcgacccatcagccaggaagacaaggccacccagaccctcagtccagcctccccgagccagggt
gtcatgctgccttgtggggtgaccgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccctgc
cagtttccctgcaggctcgccccttggtgagcagcccccggaaggacagtggcaacatcatcgagcagagatccagatcg
ccagaaagcttcagagtattgccgaccaatttcatcggcttcaaatgcagcaacaccagcagaaccgaaatcgcatgtgg
tggcagttcctcctcttcctacataacctcgccttgaatggagatgagaacaggaacggggccggtcccaggtga
>gnl|bcl2dbcds|G1PDJ5_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Myotis lucifugus GN=BCL2L11 (length=210 residues).
tccatgcagcagtctcaggccctacctgtagacatgcgtccggagatgtggatcgctcaggagctgcggcggatcgggga
cgagttcaacaactcctaccgcaacccacggagggactttctgaatgtttaccgggaagcagaaggccacccccagatgg
tggtcttacgactgttgcgttacatcctccgtctggtgtggaggaggatg
>gnl|bcl2dbcds|A0A3Q4G1I4_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Neolamprologus brichardi GN=BMF (length=492 residues).
atggacgatgaggaggacgatgtgtttgagccaaaagccaactgttggcgcaccacattcagggagataaagtgtgaaca
tcgaggcacacagacacccggtcctgccctggtaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtaacgcaggttttcgattgcacttcccggcacgcttcgagctcgtcggggatcacagagcgagtcga
caaggaagcacggagcagcaaaacagcatggagcgcctgccccgccagcgacccgcggctcgcagcgtggaggcctgcat
cggacagaaactccagctcataggagaccagtttcactgggaacgcctgcaactgtatcaacgaaaccaaaggaaccagg
ggccgatgtggtggcgcctggccgcggccattctcagccttctgtttgatagggggttcatagccggaggagggggtgga
ggacggaggtga
>gnl|bcl2dbcds|A0A3Q4GGN3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Neolamprologus brichardi GN=BAD (length=477 residues).
atggctgcaaacttcaaaatttcagacagtgattcagagacatcagaggaggtaggggaaggagaaaaccaacagtcagc
aagacaagttcaagaaagcaagccccagacgctctcccttcctgtaatcaaaacgacagctgctggaaggctcagggtga
actcagagtcccacacttcctcaattgccagggatgaggagctcatggctagaggggaggatgaggtctgtactcccaca
gagggagacccattcaggcgaaggtcaaagtcagctccccctgctctgtgggctgccaagaagtacggcaggcagcttcg
acgaatgagtgacgagtttgacagcttactagataaaggggagatgaagctcaagaagctgcaccactctaaaacctggt
ggagctatctctttagtcaccaagagactgaaggagagaacaaccatcttgaaaaccacaaccaacgcactgagtaa
>gnl|bcl2dbcds|U6CSY8_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Neovison vison GN=BMF (length=555 residues).
atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgg
gagcttgctctctgctgacctgtttgcccagagccagctggactgcccgcttagccgtctgcatctcttccctctcaccc
actgctgtggccctgggcttcgacccaccagccaggaggacaaggccacccagaccctcagtccggcctccccgagtcag
ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagcttccctgcaggcttgcccctcggggaccagccccctgaagggcagtggcagcatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcgacttcacatgcagcaacaccagcaaaaccaaaatcgggtgtgg
tggcagatccttctcttcctacacaaccttgctttgaacgcagatgggaacaggaatggggcgggtcccaggtga
>gnl|bcl2dbcds|U6CTE3_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Neovison vison GN=BCL2L11 (length=336 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgaccgagaaggtggacaattgcagcctgttgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccaggaggcagtctcaggctgta
cctgcagatatgcgcccggagatgtggattgcgcaggagttgcggcgtattggagacgagtttaatgcatattacccaag
gaggttagagcaatag
>gnl|bcl2dbcds|U6CTE3_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Neovison vison GN=BCL2L11 (length=264 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgaccgagaaggtggacaattgcagcctgttgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaagcttccaggaggcagtctcaggctgtacctgcagata
tgcgcccggagatgtggattgcgcaggagttgcggcgtattggagacgagtttaatgcatattacccaaggaggctggca
agaattccagcatcctgcctctgc
>gnl|bcl2dbcds|U6CTE3_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Neovison vison GN=BCL2L11 (length=504 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgaccgagaaggtggacaattgcagcctgttgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccactggccccacctgccagccccggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccaggaggcagtctc
aggctgtacctgcagatatgcgcccggagatgtggattgcgcaggagttgcggcgtattggagacgagtttaatgcatat
tacccaaggaggttagagcaatag
>gnl|bcl2dbcds|U6CTE3_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Neovison vison GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgaccgagaaggtggacaattgcagcctgttgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccactggccccacctgccagccccggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccaggaggcagtctc
aggctgtacctgcagatatgcgcccggagatgtggattgcgcaggagttgcggcgtattggagacgagtttaatgcatat
tacccaaggagggtctttttgaataattacccagcagcagaagcccacccccaaatgattatcttacgactgttacgtta
catcatccgcctggtgtggagattgcagtga
>gnl|bcl2dbcds|A0A2I3GVB2_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|A0A2I3GVB2_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L11 (length=279 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgaggccgctggatcctccctcgaa
gttcagtggccattcgagtggttagcaaaatcaagctaa
>gnl|bcl2dbcds|A0A2I3H4B2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Nomascus leucogenys GN=BAD (length=249 residues).
atgggggaggagcccagcccttttcgcggccgctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccg
cgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcgcgggcacagcaacgc
agatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccc
tcccagtga
>gnl|bcl2dbcds|A0A2I3HD83_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Nomascus leucogenys GN=BMF (length=390 residues).
atggagccatctcagtgtgtggaggagctagaggatgatgtgttccaaccagaggatggggagccgggcacccaacccgg
gagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaagctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatgcaccagcagaaccgaaatcgcgtgtggt
ggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaatggggcaggccctag
>gnl|bcl2dbcds|A0A2I3HWI8_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Nomascus leucogenys GN=BBC3 (length=324 residues).
atgaaatttggcatggggtctgcccgggcatgtccatgccaggtgcccagggcttcttccgtgacgtgggtcccctgcca
gatttgtgcaggcggtcccacccaggcggctccgggagtccgcggggaggaggaacagtgggcccgggagatcggggccc
agctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcaacagcggcaccgcccctcg
ccctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccccgagatggagcccaa
ttag
>gnl|bcl2dbcds|A0A2I3HX97_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Nomascus leucogenys GN=PMAIP1 (length=162 residues).
aagcctgggagagcgcgcaggaacgctcaaccgagccccgcgccggctccagcagagctggaagttgagtgtgctactca
actcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaacct
ga
>gnl|bcl2dbcds|G1QHD8_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Nomascus leucogenys GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|G1S1X2_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Nomascus leucogenys GN=BIK (length=480 residues).
atgtccgaagtaagacccatctccagagacatcttgatggagagcctcctgtatgagcagctcctggaacccccgaccat
ggaggttcttggcgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttgcagtgcatggagggca
gtgacgcgctggccccgcggctggcctgcatcggggacgagatggacgtgagcctcagggccccgcgcctggcccagctc
tccgaggtggccatgcacagcctgggtctggctttcatctatgaccagactgaggacatcagggatgttcttagaagttt
catggacggtttcaccacctttaaggagaacataataaggctctggagatccccgaaccccgggtcccgggtgtcccgcg
aacagatgctgctggtgctgctggtgctgctgctgctgctgctgccgctgctcagcgggggcctgtacctgctgaattga
>gnl|bcl2dbcds|I3K2D6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Oreochromis niloticus GN=BMF (length=492 residues).
atggacgatgaggaggacgatgtgtttgagccaaaagccaactgttggcgcaccacattcagggagataaagtgtgaaca
tcgaggcacacagacacccggtcctgccctggtaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtaacgcaggttttcgattgcacttcccggcacgcttcgaactcgtcggggatcacagagcgaggcga
caagaaatcgcggagcagcaaaacagcatggagcgcctgccccggcagcgacctgcggctcgcagcgtggaggcctgcat
cggacagaaactccagctcataggagaccagtttcactgggaacgcctgcaactgtatcaccgaaaccaaaggaaccagg
ggccaatgtggtggcgcctggccgcggcccttctcagccttctgtttgacagggggttcatagccggaggagggggtgga
ggacggaggtga
>gnl|bcl2dbcds|I3K7B6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oreochromis niloticus GN=BAD (length=477 residues).
atggctgcaaacttcacaatttcagacagtgaatcggagacatcagaggaggtaggggaagaagaaaaccaacagccagc
aggacaagatcaagaaagcaagccccagacacttgcccttcctgtaatcaaaacgacaggtgctggaaggctcaggctaa
actcagagtcccacacttcctcagttgccagggatgaggacctcatggctagaggggaggatgaggtctgtactcccaca
gagggagacccattcaggcgaaggtcaaagtcagctccccctgctctgtgggctgccaagaagtacggccagaagcttcg
acggatgagtgacgagtttgacagcctactagataaaggggagatgaagctcaagaagctgcaccactctaaaacctggt
ggagctacctctttagtcaccaagagactgaaggagagaacaaccatcttgaaaaccacaaccaacgcactgagtaa
>gnl|bcl2dbcds|F7FTC8_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=BCL2L11 (length=435 residues).
atggccaagcaaccttccgacctaaattctgaatgtgacagcgaaggcggacgactggagcccgcagaggggccggctca
gcccccgcagctccgacccggggcacctacctctatccgaacccagtatcaagacaggagccctccgcctgtgagttgcg
ataaatcgacccagacccccagtccccactgtcaagccttcaatcattatctaagtgcaatggcttccattagacagcct
cagtctgttcctgaagatatgcggccggaaatatggattgcccaggagttacggcgaattggagatgagtttaacgcttc
ctattgtccaagaaggggtctcttggataataataatccggcaggaaacaaccaccaaatgggttttgtgcacctgttac
gttacatcatccgccgcgtttggagactgcagtga
>gnl|bcl2dbcds|G1SR62_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Oryctolagus cuniculus GN=BMF (length=555 residues).
atggagccacctcagtgtgtggaggagctggaggatgacgtgttccagccagaggacggggagccggggacccagcccca
aagcttgctctctgctgacccgtttgcccagagccagctggactgccccctggggcggctgcacctcttccctctcaccc
actgctgtggtcctgggctgcgacccaccagccaggaagacaaggccacccagaccctcagccccgcctccccgagccaa
ggggtcatgctgccttgtggggtgaccgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccc
tgccagtttccctgcaaacttcgcgctgggggagcagccccctgaagggcagtggcagcatcgagcagaggtccagattg
ctcggaagcttcagtgcattgctgaccagttccaccggcttcatttacagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaacctggctctgaatggtgacgagaacagggatggggcaggtcctaggtga
>gnl|bcl2dbcds|G1SSY0_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL2L11 (length=441 residues).
atggccaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggagaggccgcccca
gctcaggcctggggcccccacctccctgcagtcggagccgcaagacaggagcccggcacccatgagctgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtaagcaaagcctgggtaagacgaag
ccagcatacgggtgtctgcatagctgtgtgtgtggcgtccacgttacgtgtattttacttttcctgaaaggtagaggttt
tccatcagctggttgcttccccagatgcccaccacggcctggactggactgggccaggccaaagccaggagcctggaact
tggctctgagtctcccgcctgggtggcagggaccgagctag
>gnl|bcl2dbcds|G1SSY0_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL2L11 (length=585 residues).
atggccaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggagaggccgcccca
gctcaggcctggggcccccacctccctgcagtcggagccgcaaggtaatccggaaggcgaccgctgtgcgcacggcagcc
ctcagggcccgctggccccatcggccagccctggccctttcgctaccaggtccccgctcttcatctttgtccgaagatcc
tccctgctgtctcgatcgtccagtgggtatttctcttttgacacagacaggagcccggcacccatgagctgtgacaaatc
aacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcagtctcaggctg
aacctgcagacacgcgtccggagacctggatcgcgcaggagttgcggcggatcggagacgagttcaacgcgtattaccca
cgcagggtttttttgaataattacccagcagcggaggagcagccccaaatggttatcttgcgactgttgcgttacatcgt
gcgcctggtgtggaggatgcattga
>gnl|bcl2dbcds|G1T7W1_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Oryctolagus cuniculus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgtggccgcggccccccggccgtgtgcgcctgcagcgcgggccgcctggggctgcgctc
ggccgccgcgcagctcaccgccgcccggctcaaggcactcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|G1TZR9_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Oryctolagus cuniculus GN=BIK (length=501 residues).
atgtctgaagtcagacctggctccagggacctcttccaggaagccctcctggatgagcaggtcccagaacctctgttgac
ggcggaagttcccggcctgacccgtcccgtggaggaaggggacttggatctcatggagtgcctcgagggcagtaaccagg
tggccctgaggctggcgtacatcggcgacgagatggacctgcacccccgacggtacacctctgcccggctgcttgttccg
tcttacagcttggccttcacctacagccagacgggcttcacgggtgttctcggaagcgtggggctccaccttgccagcct
cgtagagctctggagcccctgggtaagagcttggggggccccttggagccgcttctgcctgtccggtttgccactgtccc
caccccagcctgatcctgcaggcctctgggtcggtgcccaggctagctgggtggacataagcctgagaccagtcggctgc
cacccggagcagcactgctga
>gnl|bcl2dbcds|A0A3B3HAU1_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Oryzias latipes GN=BMF (length=492 residues).
atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggcgcacgacagccaggaagataaagtgtgaaga
ccggggcacgcagacacccggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccagac
cacttttctacggtaacgcaggttttcgattgcacttcccagcacgctttgagcttgctggggatcttgaggtgaggcgg
cacgacagggaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggcacgcagcacggaggcctgcat
tgcacagaaactccagctgataggggaccagtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccagg
ggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcgatagaggctttattgctggagcagggggtgca
ggacaaaggtaa
>gnl|bcl2dbcds|A0A3B3HAU1_BMF-04 Bcl2 modifying factor gene OS=[Eukaryota] Oryzias latipes GN=BMF (length=510 residues).
atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggcgcacgacagccaggaagataaagtgtgaaga
ccggggcacgcagacacccggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccagac
cacttttctacggtaacgcaggttttcgattgcacttcccagcacgctttgagcttgctggggatcttgaggtgaggcgg
cacgacagggaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggcacgcagcacggaggcctgcat
tgcacagaaactccagctgataggggaccagtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccagg
ggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcgatagaggctttattgctggagcagggggtgca
ggacaaaggcaatctgtcgtgagtgactga
>gnl|bcl2dbcds|A0A3B3HAU1_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Oryzias latipes GN=BMF (length=492 residues).
atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggcgcacgacagccaggaagataaagtgtgaaga
ccggggcacgcagacacccggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccagac
cacttttctacggtaacgcaggttttcgattgcacttcccagcacgctttgagcttgctggggatcttgaggtgaggcgg
cacgacagggaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggcacgcagcacggaggcctgcat
tgcacagaaactccagctgataggggaccagtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccagg
ggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcgatagaggctttattgctggagcagggggtgca
ggacaaaggtaa
>gnl|bcl2dbcds|A0A3B3HAU1_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Oryzias latipes GN=BMF (length=492 residues).
atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggcgcacgacagccaggaagataaagtgtgaaga
ccggggcacgcagacacccggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccagac
cacttttctacggtaacgcaggttttcgattgcacttcccagcacgctttgagcttgctggggatcttgaggtgaggcgg
cacgacagggaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggcacgcagcacggaggcctgcat
tgcacagaaactccagctgataggggaccagtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccagg
ggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcgatagaggctttattgctggagcagggggtgca
ggacaaaggtaa
>gnl|bcl2dbcds|A0A3B3HDU2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oryzias latipes GN=BAD (length=495 residues).
atggcagcaaagttcaccatctcagacgattcggagtcatccgaggaggtagagggaggaaaacttgacctgggagcggc
agcaggaggagaaggggagcaccttcatgatcgacattccctcaccctgccagagcttcgactcacaagtaacgggcgta
ccaggctgaattcagagtccaccgcttccacgtactccagagatgaggacctcgcgcgggaagacgaggccggaaccccc
actgatgggttggccttcaggggcagatccaagtcggcccctccggctctgtgggccgccaaaaagtacggtcagcagct
ccgacggatgagcgacgagtttgacagcctgctggataaaggggagatgaggaaggtgaggagcactggggcggccaaac
agatgctccactccacgagctggtggaactacctcttcagccacccggaggcggaaggagagtacagccaccacgagagc
caccgcactgagtaa
>gnl|bcl2dbcds|A0A3P9HNZ2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oryzias latipes GN=BAD (length=504 residues).
atggcagcaaagttcaccatctcagacgattcggagtcatccgaggaggtagagggaggaaaacttgacctgggagcggc
aggaggaggaggaggaggagaaggggagcaccttcatgatcgacattccctcaccctgccagagcttcgactcacaagta
acgggcgtaccaggctgaattcagagtccaccgcttccacgtactccagagatgaggacctcgcgcgggaagacgaggcc
ggaacccccactgatgggttggccttcaggggcagatctaagtcggcccctccggccctgtgggccgccaaaaagtacgg
ccagcagctccgacggatgagcgacgagtttgacagcctgctggataaaggggagatgaggaaggtgaggagcactgggg
cggccaaacagatgctccactccacgagctggtggaactacctcttcagccacccggaggcagaaggagagtacagccac
cacgagagccaacgcactgagtaa
>gnl|bcl2dbcds|A0A3P9ICE1_BMF-04 Bcl2 modifying factor gene OS=[Eukaryota] Oryzias latipes GN=BMF (length=510 residues).
atggacgatgaggaagacgatgtcttcgagccggaccccaacaagtggcgcacgacagccaggaagataaagtgtgaaga
ccggggcacgcagacacccggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccagac
cacttttctacggtaacgcaggttttcgattgcacttcccagcacgctttgagcttgctggggatcttgaggtgaggcgg
cacgacagggaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggcacgcagcacggaggcctgcat
tgcacagaaactccagctgataggggaccagtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccagg
ggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcgatagaggctttattgctggagcagggggtgca
ggacaaaggctatctgtcttgagtgactga
>gnl|bcl2dbcds|A0A3P9ICE1_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Oryzias latipes GN=BMF (length=543 residues).
atgtgtctatcgggcatatcaggtcactcgtcttacagtgcccccccccgtatggacgatgaggaagacgatgtcttcga
gccggaccccaacaagtggcgcacgacagccaggaagataaagtgtgaagaccggggcacgcagacacccggtcctgccc
tggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccagaccacttttctacggtaacgcaggttttcga
ttgcacttcccagcacgctttgagcttgctggggatcttgaggtgaggcggcacgacagggaagcagagcggcgcgggat
ggagcggcttccccggcagcagcctgtggcacgcagcacggaggcctgcattgcacagaaactccagctgataggggacc
agtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccaggggccggtgtggtggcgcctcgccacggct
ctcgtcagccttctattcgatagaggctttattgctggagcagggggtgcaggacaaaggtaa
>gnl|bcl2dbcds|A0A3P9K487_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Oryzias latipes GN=BMF (length=510 residues).
atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggcgcacgacagccaggaagataaagtgtgaaga
ccggggcacgcagacacccggtcctgccctggtaccaaacaacggcatgcttctctgtggactttcagaggagcccagac
cacttttctacggtaacgcaggttttcgattgcacttcccagcacgctttgagcttgctggggatcttgaggtgaggcgg
cacgacagggaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggcacgcagcacggaggcctgcat
tgcacagaaactccagctgataggggaccagtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccagg
ggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcgatagaggctttattgctggagcagggggtgca
ggacaaaggctatctgtcatgagtgactga
>gnl|bcl2dbcds|A0A3P9K487_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Oryzias latipes GN=BMF (length=492 residues).
atggacgatgaggaagacgatgtgttcgagccggaccccaacaagtggcgcacgacagccaggaagataaagtgtgaaga
ccggggcacgcagacacccggtcctgccctggtaccaaacaacggcatgcttctctgtggactttcagaggagcccagac
cacttttctacggtaacgcaggttttcgattgcacttcccagcacgctttgagcttgctggggatcttgaggtgaggcgg
cacgacagggaagcagagcggcgcgggatggagcggcttccccggcagcagcctgtggcacgcagcacggaggcctgcat
tgcacagaaactccagctgataggggaccagtttcaccgggaacgcctacaactgtatcatcgaaaccaaaggaaccagg
ggccggtgtggtggcgcctcgccacggctctcgtcagccttctattcgatagaggctttattgctggagcagggggtgca
ggacaaaggtaa
>gnl|bcl2dbcds|A0A3P9KSL7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oryzias latipes GN=BAD (length=684 residues).
atggcagcaaagttcaccatctcagacgattcggagtcatccgaggaggtagagggaggaaaacttgacctgggagcggc
agcaggaggagaaggggagcaccttcatgatcgacattccctcacactgccagagcttcgactcacaagtaacgggcgta
ccaggctgaattcagagtccaccgcttccacgtactccagagatgaggacctcgcgcgggaagacgaggccggaaccccc
actgatgggttggccttcaggggcagatccaagtcggcccctccggccctgtgggccgccaaaaagtacggccagcagct
ccgacggatgagtgacgagtttgacagcctgctggataaaggggagatgaggaaggtgaggagcactggggcggccaaac
agatgctccactccacgagctggtggaactacctcttcagccacccggaggcggaaggagagtacagccaccacgagagc
caccgcactgagaacagagaccttctggggtggttgcgttgttcttcggacattacggtcagccatgtcactgcaggctt
tcagcttccctttaccagaaactcgttatttcagggctggtggtttgatctaccagttcaagatcagaggaggcagcaac
ttcaggcaagacagaactttctagaaccttcaattagaacttga
>gnl|bcl2dbcds|A0A3P9KSL7_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oryzias latipes GN=BAD (length=651 residues).
atggcagcaaagttcaccatctcagacgattcggagtcatccgaggaggtagagggaggaaaacttgacctgggagcggc
agcaggaggagaaggggagcaccttcatgatcgacattccctcacactgccagagcttcgactcacaagtaacgggcgta
ccaggctgaattcagagtccaccgcttccacgtactccagagatgaggacctcgcgcgggaagacgaggccggaaccccc
actgatgggttggccttcaggggcagatccaagtcggcccctccggccctgtgggccgccaaaaagtacggccagcagct
ccgacggatgagtgacgagtttgacagcctgctggataaaggggagatgaggaaggtgaggagcactggggcggccaaac
agatgctccactccacgagctggtggaactacctcttcagccacccggaggcggaaggagagtacagccaccacgagagc
caccgcactgagaacagagaccttctggggtggttgcgttgttcttcggacattacggtcagccatgtcactgcaggctt
tcagcttccctttaccagaaactcgttatttcagggctggtggtttgatctaccagttcaagatcagaggaggcagcaac
ttcagagatga
>gnl|bcl2dbcds|A0A3B3BQF7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oryzias melastigma GN=BAD (length=510 residues).
atggcagcaaagttctccatctcagacaacgattcggagtcatccgaggaggtagagggaggaagacttgacctggcagc
atcaggaggagaaggaggaggaggaggaggggggcaccttcatgatcgacatgccctcaccctgccagagcttcgactta
caagtaacgggcgtaccaggctgaattcagagtccaccgtttcgacgtactccagagatgaagacctcccgcgggaagac
gaggctggaacccccaccgacgggttggccttcaggggccgatccaagtcagcccctccggccttgtgggccgccaagaa
gtacggccagcagcttcggaggatgagcgacgagttcgacagcctgctggataaaggggagatgaggaaggtgaggagcg
cgggggcgaccaaacagatgcaccactccacgagctggtggaactacctcttcagccacccggaggccgaaggagagtac
agccaccacgaaagccaccgcaccgagtag
>gnl|bcl2dbcds|A0A3B3CGR9_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Oryzias melastigma GN=BMF (length=492 residues).
atggacgatgaggaagacgatgtgttcgagccggaccccaacaactggcgcacggcggtcaggaagataaagtgtgaaga
ccggggcacgcagacgcccggtcctgccctggtaccaaacaacggcatgcttctctgtggacttgcagaggagcccagac
cacttttctacggtaacgcaggttttcgattgcacttcccagcacgcttcgagcttgctggggatcttgaggcgaggcgg
cacgacagggaagcggagcggggcgggatggagcggcttccccggcagcagcctgcggcacgcagcacggaggcctgcat
tgcacagaaactccagctgataggggaccagtttcaccgggaacgcctacaactgtatcatcaaaaccaaaggaaccagg
ggccgctgtggtggcgcctcaccacggccctcgtcagccttctattggatagaggctttattgctggaggggggggtgca
ggacaaaggtaa
>gnl|bcl2dbcds|H0WVR2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Otolemur garnettii GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctcctcagataggggcctgggccccagcccctc
aggggaccagcccctaggccccggcaagaaccgctgcacgactccaagtctcctgggggacgccagtcacctgcaggggc
agccggccagcaacacccaccatggagcaggacctggggcagtggagacccggagtcgccacagctcgtacccggcaggg
acagaggaggatgaagggattgaagagcccagccccttccggggccgctcacgctcggcgccccccaacctctgggctgc
acagcgctatggccgcgaactccggaggatgagtgacgagttcgaagactccttcaagaagggacttcctcgcccgaaga
gcgcaggcacagcgacacagatgcgacagagctccagctggacgcgtgtcattcagtcctggtgggatcggaacgtgggc
aggggaggttccgccccctgccagtga
>gnl|bcl2dbcds|H0WYH6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Otolemur garnettii GN=BMF (length=549 residues).
atggagccatcgcagtgtgtggaggaactggaggatgacgtgttccaaccagaggatggggagctggggactgggaatgt
gctctctgctgacctgtttgcccagagccagctggactgtccccttagccggcttcagctcttccctctcacccactgct
gtggccctgggctccgaccaaccagccaggaagacaaagccactcagaccctcagcccagcctccccaagccagggtgtc
atgctgccttgtggggtgactgaagaaccccagagactcttttatggtaatgttggctaccggcttcctctccctgccag
tttccctgcaggcttgcccattggggagcagccccctgaagggcaatggcaacatcgagcagaggtacagattgcccgaa
agcttcagtgcattgcagaccagtttcaccggcttcatgtgcagcaacaccagcagaaccaaaatcgtgtgtggtggcag
gtcctctttttcctacacaacctggctttgaacggagaagagaacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|H0XAE7_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Otolemur garnettii GN=BIK (length=444 residues).
atgtcagcaggaaggccagtctccatggaccactttatggagaccttcccatttgagcagctcctggagcctctgacaat
ggaggttcttggcatgactgagcccaaccccatggagtgcctggaggacagtgaccaggtggccctgcggctagcctgca
ttggggacgagatggacctgcatctcaggagcccccgactagcccagctgtccaggatgaccatgcacagcctgggtcta
tcctacaaccagactgatggccagggtgtcctcagaagtgttatcagcggtttcaccaacctcagggagaatatagcagg
gttctggagatccctgagccgcgggccctgggtgtgccctgccccggcgtgggaacaggtgctgttgctgctgttgttgc
tggtgctgctgctggcagggggcctgcacctgctgctcaagtga
>gnl|bcl2dbcds|H0XQ00_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Otolemur garnettii GN=BBC3 (length=582 residues).
atggcccgcgcacgccaagagggcagctccccggagcccgtagagggcctggctcgcgacggtccgcgccccttcccgct
cggccgcctagtgccctcggccgtgtcctgcggcctctgcgagcccggcctgcccgccgcccctgccgccccggctctgc
tgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcactgccaccctagggggcccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgcctggatggtcctcagccatcactcttgccggccgagcagcacctggagtcgcc
cgttcccagcaccccgggggccctggcgggcggtcccacccaggcggccccggaggtccggggggaggaggagcagtggg
ccagagagataggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcag
cagcgacaccgcccctcaccctggagagtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagc
ccctgagatggagcccaattag
>gnl|bcl2dbcds|H0XW23_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Otolemur garnettii GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttcagatgtaggttctgagtgtgaccgagaaggtggacaattgcaacctgcggagagacctcccca
gctcaggcctggggcccctacctctctacatacagagccccaaggtaatcccgaaggcaatccggaagtcgaaggggacc
gctgcccccaaggcagccctcagggcccactggccccaccggccagccctggtccttttgctaccagatccccgcttttc
atctttgtaagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
tgaggcagtctcaggccgaacctgcagatttgcgcccggagatgtggatcgcccaagagttgcggcgtattggagacgag
tttaacgcttactacccaacgagggtatttttgcataattaccaagcagccgaagaccaccctcaaatggttatattacg
actgttgcgttacatcgtccgcctggtgtggaggctgcactga
>gnl|bcl2dbcds|H0Y001_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Otolemur garnettii GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgtctgggtctgcgctc
gtctgccgcgcagctcacagctgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccagcgcccggcgcgctcaccacctactggccctggctgtgcgctgccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|W5P738_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Ovis aries GN=PMAIP1 (length=165 residues).
atgcctggaaggagggctcgtaggagcgcccagccgagccccacgcgggtcccggcagatcctgaagttgagtgtgccat
tcagttgaggagaattggagacaaactgaatttccggcagaaacttgtgaatctgatagccaaactcctccgctcaggaa
cttga
>gnl|bcl2dbcds|W5P8G9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Ovis aries GN=BAD (length=540 residues).
caggggcctcgttatcgggcttgggcccagagcatgttccagatcccagagtttgagcagagtgagcaggaagactccag
ccctgcagataggggcctgggccccagccccacaggggacaggcccccaggtctcagcaagcactggctaacagccccgg
gcctcctgggggaagctggtcaccagcaggggcagccggccggcagcagccaccatggaggcactggggctgtggagacc
cggagtcgtcacagctcctaccccgcggggccagaggatgacgaagggacggaggaggaggatctcggcccctttagggg
ccgctcgcgttcggcgccccccaacctctgggctgcacagcgatatggccgcgagctccgaaggatgagcgacgagtttc
acgtctccttcaaggggcttcctcgcccgaagagcgcgggcacggcaacgcaaatgcgacaaagccctagctggacgcgc
ttcctccagtcctggttgagccggaacttggggagaggaggctccgccccctctcagtga
>gnl|bcl2dbcds|W5PY58_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Ovis aries GN=BCL2L11 (length=588 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagaccaggggcccccacctctttacagacagagcggcaaggtaatcctgaaggagaaggggaccgctgcccccaag
gcagcccgcagggcccgctggccccaccggccagccccggccctttcgctaccagatccccgctcttcatcttcgtgaga
agatcctccttgctgtctcggtcctccagcgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatccacacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgcagatacacgcccagagatatggattgctcaagagctacggcgtatcggagacgagtttaatgcgtat
tatccaagaagggtcttcgtgcgtcaccaggcgattgagggccacccacaaatggtcctcctgcgcgtcttgcgctacct
ggtgcgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|W5QCU2_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Ovis aries GN=BIK (length=444 residues).
atgtatcaagcaagacccctctctaggaacctctttttgtacaccttcctacaaaaccacggcccaggcttcctggatga
ccaaggctcagggcttcccggcgtgaccagtatcttggagttccaccccatctccccctacagtgacagtccacactacc
tggccatgcagctggcctccattgccgacgagatggagctgaggttgctgctgccccagttcgttgagcccttctggatg
cccatgtacagcttgtgtttcccctacagccacgtagggctcagggatgttctgagaagctttatggttgctttcaccaa
cctcagggagaaccgaaggctctggagcttcctgactctcagggaccgggtgtcgcccagcctgtggcccgagctggcac
tgtccctgctggtggtggcgatgctcagctgggggtgccgcttc
>gnl|bcl2dbcds|W5QFV1_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Ovis aries GN=BMF (length=567 residues).
ctcacaggggagatggagccaccccagtgtgtggaggagctggaggatgacgtattccagccagaggatggggagccagg
ggcccagcccaggaggttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcagctct
tccctctcacgcactgctgtggccctgggcttcgacccaccagccaggaagacaaggctacccagactctcagcccagct
tccccgagccagggtgtcatgctgccttgtggggtgactgaggagccccagcgactcttttatggcaatgctggctaccg
gctcccccttcctgccagtttccctgcaggcttgccccttggtgagcaaccccctgaagggcagtggcaacatcgagcag
agatacagattgcccgaaaactccagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcagaaccga
aatcgcatgtggtggcagatcctcctcttcctacacaacgtggctttgaatggagatgagaacaggaatggggcaggccc
caggtga
>gnl|bcl2dbcds|A0A2R8Z688_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pan paniscus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcgggctccagcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacg
gaggacgacgaagggatgggggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggc
aggggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A2R8Z688_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pan paniscus GN=BAD (length=492 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcgggctccagcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagaacttcgtattctccttcttgggaatctgaggactctgaaaatcccagt
gcagggatgctcgcggaagcatcagcagggatgtccgccccagccgctgactcagaagcccaacacgcagagaatgtaaa
gctagaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacggaggacgacgaagggatggg
ggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|A0A2R8ZXD2_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Pan paniscus GN=BIK (length=483 residues).
atgtctgaagtaagacccctctccagagacatcttgatggagaccctcctgtatgagcagctcctggaacccccgaccat
ggaggttcttggcgtgactgagtctgaggaggacctggaccctatggaggacttcgattctttggagtgcatggagggca
gtgacgcgttggccctgcggctggcctgcatcggggacgagatggacgtgagcctcagggccccgcgcctggcccagctc
tccgacgtggccatgcacagcctgggtctggctttcatctacgaccagactgaggacatcagggatgttcttagaagttt
catggacggtttcaccacacttaaggagaacataatgaggttctggagatccccgaaccccaggtcctgggtgtcccgcg
aacaggtgctgctggcgctgctgctgctgctggcgctgctgctgccgctgctcagcgggggcctgcacctgctgctcaag
tga
>gnl|bcl2dbcds|A0A2R9AKC9_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Pan paniscus GN=PMAIP1 (length=399 residues).
atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggctccagcaggaccggcgggtacggcgaggga
ccaagccggatttgggattgggatgcagctgcgtttcaccaggggcaaaaagctcctttcctcctcttcctcctcgccac
ttgcccttccccggggccacgaggaacaagcgcaagtagctggaagtcgagtgtgctactcaactcaggagatttggaga
caaactgaacttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaacctgactgcatcaaaaacttg
catgaggggactccttcaaaagagttttctcaggaggtgcacgtttcatcaatttgaagaaagactgcattgtaattgg
>gnl|bcl2dbcds|A0A2R9AKC9_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Pan paniscus GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggctccagcagagctggaagtcgagtgtgctac
tcaactcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|A0A2R9BS98_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Pan paniscus GN=BMF (length=555 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggggagccggtgacccaacccgg
gagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaagctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctatcggcttcctctccc
tgccagtttcccagcagtcttgcccattggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccaaaatcgtgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcaggccctaggtga
>gnl|bcl2dbcds|A0A2R9BS98_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Pan paniscus GN=BMF (length=390 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggggagccggtgacccaacccgg
gagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaagctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatgcaccagcagaaccaaaatcgtgtgtggt
ggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcaggccctag
>gnl|bcl2dbcds|A0A2R9BZA9_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Pan paniscus GN=BBC3 (length=396 residues).
atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggctgcttccgtgacgtgggtcccctgcca
gatttgtggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggctctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagcagcggcaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccccgagatggagcccaattag
>gnl|bcl2dbcds|A0A2R9C366_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Pan paniscus GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|A0A2R9C366_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Pan paniscus GN=BCL2L11 (length=297 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgactccgctggatcctccctcaga
attgcccttcatagggaagttcagtggccactcaagtggttagcaaaatcaagctaa
>gnl|bcl2dbcds|A0A2I3RGH5_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Pan troglodytes GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgccgcccccgccgcccccaccctgc
tgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctggggggtccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcc
cgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcag
cagcggcaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagc
ccccgagatggagcccaattag
>gnl|bcl2dbcds|A0A2I3RGH5_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Pan troglodytes GN=BBC3 (length=396 residues).
atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggctgcttccgcgacgtgggtcccctgcca
gatttgtggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggctctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagcagcggcaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccccgagatggagcccaattag
>gnl|bcl2dbcds|A0A2I3SN61_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Pan troglodytes GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaggctgaacctgcagatatgcgaccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2I3SN61_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Pan troglodytes GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|A0A2I3SX38_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Pan troglodytes GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggctccagcagagctggaagtcgagtgtgctac
tcaactcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|A0A2I3SX38_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Pan troglodytes GN=PMAIP1 (length=402 residues).
atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggctccagcaggaccggcgggtacggcgaggga
ccaagccggatttgggattgggatgcagctgcgtttcaccaggggcaaaaagctcctttcctcctctctttcctcctggc
cacttgcccttccccgggggcacgaggaacaagtgcaagtagctggaagtcgagtgtgctactcaactcaggagatttgg
agacaaactgaacttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaacctgactgcatcaaaaac
ttgcatgaggggactccttcaaaagagttttctcaggaggtgcacgtttcatcaatttgaagaaagactgcattgtaatt
gg
>gnl|bcl2dbcds|A0A2I3TBK7_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pan troglodytes GN=BAD (length=492 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagaacttcgtattctccttcttgggaatctgaggactctgaaaatcccagt
gcagggatgcttgcggaagcatcagcagggatgtccgccccagccgctgactcagaagcccaacacgcagagaatgtaaa
gctagaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacggaggacgacgaagggatggg
ggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|A0A2I3TBK7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pan troglodytes GN=BAD (length=474 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagaagggacttcctcgcccgaagagcgcgggcacagcaacccagatgcggcaaag
ctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctcccagtgacctt
cgctccacatcccgaaactccacccgttcccactgccctgggcagccatcttgaatatgggcggaagtacttccctcagg
cctatgcaaaaagaggatccgtgctgtctcctttggagggagggctgaccccgattcccttccggtgcgtgtga
>gnl|bcl2dbcds|A0A2J8QDD5_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Pan troglodytes GN=BMF (length=390 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggggagccggtgacccaacccgg
gagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaagctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatgcaccagcagaaccaaaatcgtgtgtggt
ggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcaggccctag
>gnl|bcl2dbcds|A0A2J8QDD5_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Pan troglodytes GN=BMF (length=555 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggggagccggtgacccaacccgg
gagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaagctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctatcggcttcctctccc
tgccagtttcccagcagtcttgcccattggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccaaaatcgtgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcaggccctaggtga
>gnl|bcl2dbcds|H2Q6Y8_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Pan troglodytes GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcgaccccccggccgtgtgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccttggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|H2QLU7_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Pan troglodytes GN=BIK (length=483 residues).
atgtctgaagtaagacccctctccagagacatcttgatggagaccctcctgtatgagcagctcctggaacccccgaccat
ggaggttcttggcgtgactgactctgaagaggacctggaccctatggaggacttcgattctttggagtgcatggagggca
gtgacgcgttggccctgcggctggcctgcatcggggacgagatggacgtgagcctcagggccccacgcctggcccagctc
tccgacgtggccatgcacagcctgggtctggctttcatctacgaccagactgaggacatcagggatgttcttagaagttt
catggacggtttcaccacacttaaggagaacataatgaggttctggagatccccgaaccccgggtcctgggtgtcccgcg
aacaggtgctgctggcgctgctgctgctgctggcgctgctgctgccgctgctcagcgggggcctgcacctgctgctcaag
tga
>gnl|bcl2dbcds|A0A096MLD5_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Papio anubis GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaagccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagacgcggagtcgccacagctcctaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagc
acagcgttatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggc
aggggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A096MLD5_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Papio anubis GN=BAD (length=492 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaagccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagagcttggtattctccttcttgggaatctgaggactctgaaaatcccagt
gcaaggatgctcgcggaagcatcagcaccgatgtctgccccagccactgactcagaagcccaacacgcagagaatgtaaa
gctgaaggcgctggggctgtggagacgcggagtcgccacagctcctaccccgcggggacggaggaggacgaagggatgga
ggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|A0A096MPU8_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Papio anubis GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccaacgcgggctcaggcagagctcgaagtcgagtgtgctac
tcaactcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|A0A096MPU8_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Papio anubis GN=PMAIP1 (length=399 residues).
atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccaacgcgggctcaggcaggacaggcagggacggcagggac
ggcgagggaccaggccggatttgggattgggatgcagctgcatttcaccagaagcaaaaagctcgtctcctcctccccac
ttgcccttccgcggggccacgaggaacaagtgcaagtagctcgaagtcgagtgtgctactcaactcaggagatttggaga
caaactgaacttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaacctgactgcatcaaaaacttg
catagggggactccaaaagagactttttctcaggagatgcacacttcatcaatttgaagaaagattgcattgtaattgg
>gnl|bcl2dbcds|A0A096N944_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Papio anubis GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgtttggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgcttggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A096NKG5_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Papio anubis GN=BIK (length=483 residues).
atgtctggagttagacccatctccagagacatcttgatggagaccctcctgtatgagcagctcctggaacccctaaccat
ggaggttcttggtgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttggagtgtatggaggaca
gtgacatgttggccctgcggctggcctgcatcggggacgagatggatgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctgggtctggctttcatctacgaccagacggacgacatcagggatgttcttagaagttt
catggatggtttcaccacccttagggagaacataatgaggttctggagatccccgaatcccaggtcctgggtgtcccgtg
aacaggtgctgctggcgctgctgctgctgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctcaag
tga
>gnl|bcl2dbcds|A0A096NTE9_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Papio anubis GN=BMF (length=621 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtaactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggtggaccctaggtataaaaa
tgcaagaagatcagttaggaaattaaaggcttctagctttctcagctgccagcctgagtga
>gnl|bcl2dbcds|A0A096NTE9_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Papio anubis GN=BMF (length=390 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtaactgaggaaccccagcgactcttttacgcaccagcagaaccgaaatcgcgtgtggt
ggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggtggaccctag
>gnl|bcl2dbcds|A0A096NYC3_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Papio anubis GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A096NYC3_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Papio anubis GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgtt
gcgttacattgtccgcctggtgtggaggatgcattga
>gnl|bcl2dbcds|A0A2I3N2Z9_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Papio anubis GN=BBC3 (length=396 residues).
ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccagggcttcttctgcgacgtgggtcccctgcca
gatttgtggtcctcagccctcgctcttgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccccgaaatggagcccaattag
>gnl|bcl2dbcds|A0A3B3QC78_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Paramormyrops kingsleyae GN=BCL2L11 (length=573 residues).
atgggacaaattctattaacgatcccctgctctgtctgttctgcagaggacaaaatcacacgaatggcggagagtcgcaa
cccagtggcggaacagactccgatccaagccggtccgagaaccgccaaggtccctggtcaactgcaagcgaccccgcgat
ttagtacgctgtccgcatcgtcaagcggatatcattcactcgacatttcccttccaaactctccctttatgactcataac
aagtcgacacagacccccagtccgtctaatcatcttgtttgcatttatttgagctcagtaacgcggacgctgtcgatgct
gccggacatgcggccagagatgctggtcgcacgagagctgcggcgcatcggtgacaagttcaatgatatctacataaatg
gggtgagtatcctactctgtcctcactgtcctcttcggccaactgctatgggccaaggggcaacactgactccttaccct
ggggacaacaagaacaaagagtcacccctaagatccagatcttcctggctccatgttagaatgggggaagtggagcaaca
ggaaatagtatga
>gnl|bcl2dbcds|A0A3B3QX41_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Paramormyrops kingsleyae GN=BAD (length=510 residues).
atgtcgggtgtcaccatggcgcacatgtttaccatctccggcaatgagtcggacacttctgaatccgacacaccagatgt
cacagcaaattcacagcttggaaataacctcaaaaatacgaaaaatccaggagaggctggaggtcgtgtacggatgcggt
ccgaatcccaggtttcttcgattcgaagcgaggatctcgattttggtgaaggaggtgcatctgaggagggcggaggcgtg
tgccccggggatggcactccttttcgaggacgctcgcggtcagccccgcccgcgctgtgggcagcacagcggtatggacg
acagctgcggcgtatgagtgacgagtttgacaccctgctggacaaagggatgaagagggtgcgcagtgccggggctgccc
gacagatgcaggcgtcccccagctggttcgcctttctctggagccacaaggagagcgacgcggagatcagcggaagcttg
tcgaccgccgacagcagagctgcacagtga
>gnl|bcl2dbcds|A0A3B3RH63_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Paramormyrops kingsleyae GN=BMF (length=441 residues).
atggacgatgacgatgacgatgtgttccacacggacccgctcacctatcagcccccgttcagggatataaagtgtgagaa
tcggggcacgcagacgcccggcccagccctggtgcagggcctcaacatgctgccctgtggcgtgggccaagagccacgca
gactcttctacggtagtgcaggcttgcggctgcatttcccggcactttcggtgcccggcgggcacccgccgcaggaggag
cggcagcccgacgaccgcccgcaaccgagcgccgaggtccggattggccagaagcttcagatgattggagaccagtttca
ccaagaccaactccagttgtaccacagaaaccaaaggaatcagcagccggtgtggtggcggcttgtgatggcgctgtgtg
gcctcctcttcgagaggcgccaaagagcagagcagagatga
>gnl|bcl2dbcds|K7FRX2_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Pelodiscus sinensis GN=BMF (length=582 residues).
atggatccccccagctacctggaagaagactattctagcctggacgggctggacgatgacgtgtttcactctgatgactt
tggactcacaggtcagcctggtgagatgactcctactggcattttcacacagaaccaatcgtacagctgcctcctgggga
ggtttcaactgttcccactcacacactgctgtggtccaggtatcaggcatgctgagcagcaggacaaggcaacccaaaca
ctcagcccatcctcttccactcaggatgtcatgttgccatgtggagtcactgaagagccccagagactcttctatgggaa
tgctgggtaccgtttacatgaacccccagttggcttcgcattgaatccgcacctccaagaggagcctcgggaaggtcacc
aggaagcccgggctgaggttcagattgcacggaagttacagtgcatagcagaccagttccacaggctccacatacagagg
catcagcagaacagaaatcaagtgtggtggcagatccttcttttcctacataacttggccttaaatgtggaggcgaacag
gaaccacataggtcagaggtga
>gnl|bcl2dbcds|K7GA86_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Pelodiscus sinensis GN=BCL2L11 (length=678 residues).
atggggcgggcagggcgcgggccgggagctgcacaatcagtgcaggcgccgcgccgcgtcccagccttttgtcccgtggc
gggggggtccgagcgcgcggctgcccgattcccagctccggccggggcggactcggagcgccggggtctggctgaggaat
tgctcttggagcctgactcgcttttgttcagacaaagcctttctgcgagttactctttggacgcaggaaaaggcgaccaa
atggcaaagcaaccttctgatctgaattcagagtgcgacggagaaggtggacagtttcagtcaattgaaaggccaagtca
gcctcagcatcttagacctggggcccctacctctatacaaacacagtaccaagacaggagccctgtgcctatgagttgcg
acaagtcgacgcagactccaagtcccccttgtcaagcctttaatcattatctaagtgcaatgggtaagcaagatcatgct
tccaggtgggagtccccctcaatacgtgaagacatgcagccagaaatatggattgcacaggagctgcggcgaattggaga
tgagtttaatgcctcttactgcccaagaaggggtttcttggataatcaagcaataaaccaccaaattgttttgcgcttgt
tgcattacatcatccgcctcatttggagaatgcagtaa
>gnl|bcl2dbcds|A0A3B4B6Y3_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Periophthalmus magnuspinnatus GN=BMF (length=363 residues).
atggaggatgaggaggatgatgtgtttgagccagatctgcactgctggcacaccacattcaggcagataaagtgtgaaga
ccgggccacgcagacccctggccctgccctggcccccaacaaaggcatgcttccctgtggagtggcagaggagcctagac
cactcttttacgcacattttgaacttggtgaagatcaggaggcaagtgaatcactacaagagggagagatgcagaacggg
agggagccactccccaggcaccctgtggcagtacgcagcatggaggcctgcatcggccacaaactgcagctcataggaga
ccagttccaccgggatcacttacaacgggtgagagagcactga
>gnl|bcl2dbcds|A0A087X8P8_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Poecilia formosa GN=BAD (length=501 residues).
atggacgcaaaatttacaatttcagacagcgactcggagccatcggaagacgtagaggaaagaggaaacttgcagctaat
gcaagtaaaggagaggccgctcagtcaacgccacaccctcacgcttcctgagctccgatctacaacaggtcgggtgagac
tgaactcggagtccatcgcttccaccatctccagagaggaggagctgcaggccaggggggaagaggaagtcgggaccccc
actgagggctttccattcaggggccgatctaattcagctcccccctccctgtgggccgccaagaagtatggccggcagct
tcggaggatgagcgatgagtttgtcaacctgcttgataaaggggaaatgaggaaggtgagcagtaccgggtcgaacagac
cgatacaccactccaggagctggtggagctacctcttcagtcaccaggagacggagggagagaacaaccaccacgaaaac
cacgcctcccgcaccgagtag
>gnl|bcl2dbcds|A0A096LRV0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Poecilia formosa GN=BMF (length=483 residues).
atggaggatgaggaggatgatgtgtttgagccagatcccaactgctggcgcacgcccttcagggagataaagtgtgaaga
ccggggcacgcagacgcccggtccgggccaggcgctacacaacggcatgctgccctgtggtgttgcggaggagcccagac
gactattctacggtaacgcaggttttcgattgcacttcccagcgcattttgaacttgtcggggattttgacgcgaggcaa
caagaggagcagaacaggatggagcagttacccctgcaccagccggctgcactcagcttggaggcctgcatcgggcagaa
gcttcagctgataggcgaccagtttcaccgggaacacttacaacagtaccaacaaaaccaaaggaatcaggggccgctgt
ggtggcgcatgactgcagctcttctcagcctcctgtttcatagggggtttattgctggaggaggtggagcaggacggagg
tga
>gnl|bcl2dbcds|A0A3B3UA11_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Poecilia latipinna GN=BAD (length=501 residues).
atggacgcaaaatttacaatttcagacagcgactcggagccatcggaagacgtagaggaaagaggaaacttgcagctaat
gcaagtaaaggagaggccgctcagtcaacgccacaccctcacgcttcctgagctccgatctacaacaggtcgggtgagac
tgaactcggagtccatcgcttccaccatctccagagaggaggagctgcaggccaggggggaagaggaagtcgggaccccc
actgagggctttccattcaggggccgatctaattcagctcccccctccctgtgggccgccaagaagtacggccggcagct
tcggaggatgagcgatgagtttgtcaacctgcttgataaaggggaaatgaggaaggtgagcagtaccgggtcgaacagac
cgatacaccactccaggagctggtggagctacctcttcagtcaccaggagacggagggagagaacaaccaccacgaaaac
cacgcctcccgcaccgagtag
>gnl|bcl2dbcds|A0A3B3VNE0_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Poecilia latipinna GN=BCL2L11 (length=732 residues).
atgcactcttcaagaccgccaaatctgctcgatggctcgaccgaagtaacgccagcagaggggaccggcggagacccagc
atcgtcagcgcgaacaccacgttcctcgaagcacacagagcggagctgcgcgccgcagacgggcgcctccacagccgggg
gaggaggaggaggaggagggggaggaggaggggagccggacgcggattcgccgccgtgctccgtgagcccggccagttta
gacgtctttcgaagcaggtcgatatttcgccctccccgccgctcgtccagcggatacttctcctttgactgcgactcgct
gccgagctccccgctctctccgcacccagtgacggctgataaagccacgcagacccccagccccaccggccaggtgatga
accacgccctgcagcgaatggctgtggagcacggtggactcgggctgcacgggcactctcccaaccactatagcactatt
aacgcggcgcgggatatgcagtcagaaacctttggtcgtcaactccgtgctattggagatgactacaacaaccacctgat
ggtaaggaggatggcgagaagacaccaacggaatatagtccctctaaacctgatgccgcacatccagcaagagcctgttg
ccatgctttgtgtctgccttctgctcctcctggtcggacgaataatgtacatgcaaggcaacacaagcagccacgaccac
tctcaggtttag
>gnl|bcl2dbcds|A0A3B3WU80_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Poecilia mexicana GN=BMF (length=483 residues).
atggaggatgaggaggatgatgtgtttgagccagatcccaactgctggcgcacgcccttcagggagataaagtgtgaaga
ccggggcacgcagacgcccggtccgggccaggcgctacacaacggcatgctgccctgtggtgttgcggaggagcccagac
gactattctacggtaacgcaggttttcgattgcacttcccagcgcattttgaacttgtcggggattttgacgcgaggcaa
caagaggagcagaacaggatggagcagttacccctgcaccagccggctgcactcagcttggaggcctgcatcgggcagaa
gcttcagctgataggcgaccagtttcaccgggaacacttacaacagtaccaacaaaaccaaaggaatcaggggccgctgt
ggtggcgcatgactgcagctcttctcagcctcctgtttcatagggggtttattgctggaggaggtggagcaggacggagg
tga
>gnl|bcl2dbcds|A0A3B3YFR1_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Poecilia mexicana GN=BAD (length=501 residues).
atggacgcaaaatttacaatttcagacagcgactcggagccatcggaagacgtagaggaaagaggaaacttgcagctaat
gcaagtaaaggagaggccgctcagtcaacgccacaccctcacgcttcctgagctccgatctacaacaggtcgggtgagac
tgaactcggagtccatcgcttccaccatctccagagaggaggagctgcaggccaggggggaagaggaggtcgggaccccc
actgagggctttccattcaggggccgatctaattcagctcccccctccctgtgggccgccaagaagtatggccggcagct
tcggaggatgagcgatgagtttgtcaacctgcttgataaaggggaaatgaggaaggtgagcagtaccgggtcgaacagac
cgatacaccactccaggagctggtggagctacctcttcagtcaccaggagacggagggagagaacaaccaccacgaaaac
cacgcctcccgcaccgagtag
>gnl|bcl2dbcds|A0A3B3YII5_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Poecilia mexicana GN=BCL2L11 (length=726 residues).
atgcactctttaagaccgccaaatctgctcgatggctcgaccgaagtaacgccagcagaggggaccggcggagacccagc
atcgtcagcgcgaacaccacgttcctcgaagcacacagagcggagctgcgcgccgcaggcgggcgcctccacagccgggg
gaggaggaggagggggaggaggaggaagaggggagccggattcggactcgccgccgtgctccgtgagcccggccagttta
gacgtctttcgaagcaggtcgatatttcgccctccccgccgctcgtccagcggatacttctcctttgactgcgactcgct
gccgagctccccgctctctccgcacccagtgacggctgacaaagccacgcagacccccagccccaccggccaggtgatga
accacgccctgcagcgaatggctgtggagcacggtggactcgggctgcacgggcactctcccaaccactatagcactatt
aacgcggcgcgggatatgcagtcagaaaactttggtcgtcaactccgtgctattggagatgactacaacaaccacctgat
gaggatggcgagaagacaccaacggaatatagtccctctaaacctgatgccacacatccagcaagagcctgttgccatgc
tttgtgtctgccttctgctcctcctggtcggacgaataatgtacatgcaaggcaacacaagcagccacgaccactctcag
gtttag
>gnl|bcl2dbcds|A0A3B3YII5_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Poecilia mexicana GN=BCL2L11 (length=726 residues).
atgcactctttaagaccgccaaatctgctcgatggctcgaccgaagtaacgccagcagaggggaccggcggagacccagc
atcgtcagcgcgaacaccacgttcctcgaagcacacagagcggagctgcgcgccgcaggcgggcgcctccacagccgggg
gaggaggaggagggggaggaggaggaagaggggagccggattcggactcgccgccgtgctccgtgagcccggccagttta
gacgtctttcgaagcaggtcgatatttcgccctccccgccgctcgtccagcggatacttctcctttgactgcgactcgct
gccgagctccccgctctctccgcacccagtgacggctgacaaagccacgcagacccccagccccaccggccaggtgatga
accacgccctgcagcgaatggctgtggagcacggtggactcgggctgcacgggcactctcccaaccactatagcactatt
aacgcggcgcgggatatgcagtcagaaaactttggtcgtcaactccgtgctattggagatgactacaacaaccacctgat
gaggatggcgagaagacaccaacggaatatagtccctctaaacctgatgccacacatccagcaagagcctgttgccatgc
tttgtgtctgccttctgctcctcctggtcggacgaataatgtacatgcaaggcaacacaagcagccacgaccactctcag
gtttag
>gnl|bcl2dbcds|A0A3P9N073_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Poecilia reticulata GN=BCL2L11 (length=609 residues).
gacccagcatcgtcagcgcgaacaccacgttcctcgaagcacacagagcggagctgcgcgccgcaggcgggcgcctccac
agccgggggaggaggaggaggaggaagaggggagccggactcggactcgccgccgtgcaccgtgagcccggccagtttag
acgtctttcgaagcaggtcgatatttcgccctccccgccgctcgtccagcggatacttctcctttgactgcgactcgctg
ccgagctccccgctctctccgcacccagtgacggctgacaaaaccacgcagacccccagccccaccggccaggtgatgaa
ccacgccctgcagcgaatggctgtggagcacgaaattcccaagctcaatgtgaaaggaaaagaggaaaaagggggaagag
gaggggcattcgtcattataccaaaaagagaaacaaaccaacccattttgtcttgtgtcctcccagtgcaactgatgatt
cagcagttttctcatgcgacttccatcggtataaaaaaaagaaaaagagtaggatatgatgatgattattatcattacta
catagattgtttctttttaaaatcagtaagtaaatacgacgtggcatag
>gnl|bcl2dbcds|A0A3P9Q7C3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Poecilia reticulata GN=BAD (length=501 residues).
atggacgcaaaatttacaatttcagacagcgactctgagccatcggaagacgtagaggaaagaggaaacttgcagctaat
gcaagtaaaggagaggccgctcagtcaacgccacaccctcacgcttcctgagctccgatctacaacaggtcgggtgagac
tgaactcggagtccatcgcttccaccatctccagagaggaggagctgcaggccaggggggaagaggaggtcgggacccca
actgagggctttccattcagggtccggtctaattcagctcccccctccctgtgggccgccaagaagtacggccggcagct
tcggaggatgagcgatgagtttgtcaacctgcttgataaaggggaaatgaggaaggtgagcagtgccgggtcgaacggac
cgatccaccactccaggagctggtggagctacctcttcagtcaccaggagacggagggagagaacaaccaccacgaaaac
cacgcctcccgcaccgagtag
>gnl|bcl2dbcds|A0A3P9Q8E2_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Poecilia reticulata GN=BMF (length=483 residues).
atggaggatgaggaggatgatgtgtttgagccagatcccaactgctggcgcacgcccttcagggagataaagtgtgaaga
ccggggcacgcagacgcccggtcctggccaggcgctacacaacggcatgctgccctgtggtgttgcggaggagcccagac
gattattctacggtaacgcaggttttcgattgcacttcccagcgcattttgaacttgtcagggattttgacgcgaggcaa
caagaggagcagaacaggatggagcagttacccctgcaccagccggctgcactcagcttggaggcttgcatcgggcagaa
gcttcagctgataggcgaccagtttcaccgggaacacttacaacagtatcaacaaaaccaaaggaatcaggggccgctgt
ggtggcgtatgactgcagctcttctcagcctcctgtttgatagggggtttattgctggaggaggtggagcaggacggagg
tga
>gnl|bcl2dbcds|A0A2J8T301_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Pongo abelii GN=BMF (length=555 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggggagccggggacccaatccgg
aagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaagctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcctactggggagcagccccctgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcaggccctaggtga
>gnl|bcl2dbcds|A0A2J8TYJ3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pongo abelii GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacaggccctcaggctccagcaagcatcatcgccaggccccaggcctcctgcgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacg
gaggacgacgaagggatgggggaggagcccagcccctttcggggccgttcgcgctcggcgccccccaatctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcttccaatcctggtgggatcggaacttgggc
aggggaagctccgccccctcccagtga
>gnl|bcl2dbcds|H2NIS8_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Pongo abelii GN=HRK (length=276 residues).
atgtgcccgtgtcccctgcaccgcgaccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccagcgcgctcccaacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|H2NWG2_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Pongo abelii GN=PMAIP1 (length=165 residues).
atgcctggaaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggctccggcagagctggaagtcgagtgtgctac
tcaactcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|H2NZD3_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Pongo abelii GN=BBC3 (length=582 residues).
atggcccgcgcacggcaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggccgccgcccccgccgcccccgccctgc
tgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcc
cgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcag
cagcggcaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagc
ccccgagatggagcccaattag
>gnl|bcl2dbcds|H2P4N6_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Pongo abelii GN=BIK (length=378 residues).
atgtctgaagtaagacctatctccagagacatcctgatggagaccctcctgtatgagcagctcctggaacccccgaccat
ggaggttcttggcgtgactgactctgaagaggacctggaccctatggaggacttcagtcctttggagtgcatggagggca
gtgacgcgttggccttgcggctggcctgcatcggggacgagatggacgtgagcctcagggccccgcgccgggcccagctc
cccgaggtggccatgcacagcctgggtctggctttcatctacgaccagactgaggacatcagggatgttcttagaagttt
cacggacggtttcaccacccttaaggaaaacataatgaggttctggagctccctgtaa
>gnl|bcl2dbcds|H2P5E2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Pongo abelii GN=BCL2L11 (length=417 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcaggctgaacctgca
gatatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaacgcttactatgcaaggagggt
atttttgaataattaccaagcagccgaagaccacccacgaatggttatcttacgactgttacgttacattgtccgcctgg
tatggagaatgcattga
>gnl|bcl2dbcds|A0A2K6EM90_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Propithecus coquereli GN=PMAIP1 (length=165 residues).
atgcccgtgaagaaggcgcgtaagaacgcgcaaccgagcccgacgcggactcgggcagagatcgaagaggagtgtgccct
tcaactcaggagacttggagacaaactgcatttccagcagaaacttctgaatctgatagccaaacttttccgctcaggaa
cttga
>gnl|bcl2dbcds|A0A2K6FFN3_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Propithecus coquereli GN=BMF (length=390 residues).
atggagccatcccactgtgtggaggagctggaggatgatgtgttccagccagaggatggggagtcggggacccagcccgg
gagcgtgctctctgctgacctgtttgcccagagccagctggactgccccctcagccggcttcagctcttccctctcaccc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagcccagcctccccaagccag
ggtgtcatgctgccttgtggggtgaccgaggaaccccagagactcttttatgcaccagcagaaccaaaatcgcatgtggt
ggcagatcctcctcttcctacacaaccttgctttgaacggagaagagaacaggaacggggcaggtcccag
>gnl|bcl2dbcds|A0A2K6FFN3_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Propithecus coquereli GN=BMF (length=555 residues).
atggagccatcccactgtgtggaggagctggaggatgatgtgttccagccagaggatggggagtcggggacccagcccgg
gagcgtgctctctgctgacctgtttgcccagagccagctggactgccccctcagccggcttcagctcttccctctcaccc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagcccagcctccccaagccag
ggtgtcatgctgccttgtggggtgaccgaggaaccccagagactcttttatggcaatgctggctaccggcttcctctccc
tgccagtttccctgcaggcttgccccttggggaacagcccgctgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccaaaatcgcatgtgg
tggcagatcctcctcttcctacacaaccttgctttgaacggagaagagaacaggaacggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A2K6FM79_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Propithecus coquereli GN=BIK (length=459 residues).
atgtctgaggtgagacccgtctccacggacctcctcatggagaccttcccgttcgagcatctcctggaccctctgatcct
ggaggttctcagcatcatggacaacgaggagaatcccgacccctcggggtgcctcgaggacagtgacgaggtggccctgc
ggctagcctgcattggggatgagatggacctgtgtctcaggagcccccgcctggcctggctgcccgggatgaccatgcac
agcctggggctggcgctgtcctgtgaccagccggtccgctggggcgtgctcgggagccttagcgacggtttcgccaacct
cagggagtacgtggccaggctctggaggtcgctcagcccccggccctgggtgtgccccgccccggcgtgggagcaggtgc
tgctgctgctgctggtgctgctgctgctgggcgggggcctgcacctgctgctcaagtga
>gnl|bcl2dbcds|A0A2K6FQZ1_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Propithecus coquereli GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cggccgcctggtgccctcggccgtgtcctgcggcctctgcgagcccggcctgcccgctgcccccgccgcccccgccctgc
tacccgctgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccgaccccgaggcccgcgcccggacggtcctcagccatcactctcgctggcagagcagcacctggagtcgcc
cgtccccagcgccccgggggccctggcgggcggtcccacccaggcggccccgggagtccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggcagacgacctcaatgcgcagtacgagcggcggagacaagaggagcag
cagagacaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagc
ccctgagatggagcccaattag
>gnl|bcl2dbcds|A0A2K6FQZ1_BBC3-04 BCL2 binding component 3 gene OS=[Eukaryota] Propithecus coquereli GN=BBC3 (length=396 residues).
atgaaatttggtgcggggtctgcccgggcatgtccctgccaggtgcccgggacttccttctcatggtgggtcctgggcca
tattcctggtcctcagccatcactctcgctggcagagcagcacctggagtcgcccgtccccagcgccccgggggccctgg
cgggcggtcccacccaggcggccccgggagtccggggggaggaggagcagtgggcccgagagatcggggcccagctgcgg
cggatggcagacgacctcaatgcgcagtacgagcggcggagacaagaggagcagcagagacaccgcccctcaccctggag
ggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccctgagatggagcccaattag
>gnl|bcl2dbcds|A0A2K6GE31_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtggacagttgcaatctgtggagagacctcccca
gctcaggcctggggcccctacctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggcgaaggggacc
gctgctcccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A2K6GE31_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtggacagttgcaatctgtggagagacctcccca
gctcaggcctggggcccctacctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggcgaaggggacc
gctgctcccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatcgcgcaggagttgcggcgtattggagatgag
tttaacgcttattacccaaggagggtatttttgaataattaccaagccgacgaagaccaccctcaaatgcttatcttgcg
actgttacgttacattgtccgcctggtgtggaggaggcattga
>gnl|bcl2dbcds|A0A2K6GL98_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Propithecus coquereli GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcctgggtctgcgctc
gtccgccgcgcagctcacagccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccagcgcccggcgcgctcaccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A2K6GWV0_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Propithecus coquereli GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccaagtgagcaggaagactccagctctgcaggtaggggcctgggccccagcccctc
aggggaccggccctcaggccccggcaagcatccctgcacggctccaagcttcctgggggacgccagtcaccagcaggggc
agcccagcagcagcagccaccatggaggagctgggtctgtggagacccggagtcgccacagctcgtaccccgcggggaca
gaagaggatgaagggatggaggaagagcccagccccttccggggccgctcacgctcggcgccccccaacctctgggctgc
acagcgctatggccgcgagctccggaggatgagcgacgagttcgaggactccttcaagaagggacttcctcgcccgaaga
gcgcgggcacagcgacgcagatacggcagagctccagctggacgcgcgtcattcagtcctggtgggatcggaacgtgggc
aggggaggttccgccccctcccagtga
>gnl|bcl2dbcds|A0A3B4ETH0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Pundamilia nyererei GN=BMF (length=492 residues).
atggacgatgaggaggacgatgtgtttgagccaaaagccaactgttggcgcaccacattcagggagataaagtgtgaaca
tcgaggcacacagacacccggtcctgccctggtaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtaacgcaggttttcgattgcacttcccggcacgcttcgagctcgtcggggatcacagagcgagtcga
caaggaagcacggagcagcaaaacagcatggagcgcctgccccgccagcgacccgcggctcgcagcgtggaggcctgcat
tggacagaaactccagctcataggagaccagtttcactgggaacgcctgcaactgtatcaccgaaaccaaaggaaccagg
ggccgatgtggtggcgcctggccgcggccattctcagccttctgtttgatagggggttcatagccggaggagggggtgga
ggacggaggtga
>gnl|bcl2dbcds|A0A3B4GXJ6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pundamilia nyererei GN=BAD (length=477 residues).
atggctgcaaacttcaaaatttcagacagtgattcagaggcatcagaggaggtaggggaaggagaaaaccaacagtcagc
aggacaagctcaagaaagcaagccccagacgctttcccttcctgtaatcaaaacgacagctgctggaaggctcagggtga
actcagagtcccacacttcctcaattgccagggatgaggagctcatggctagaggggaggatgaggtttgtactcccaca
gagggagacccattcaggcgaaggtcaaagtcagctccccctgctctgtgggctgccaagaagtacggcaggcagcttcg
acgaatgagtgacgagtttgacagcttactagataaaggggagatgaaggtcaagaagctgcaccactctaaaacctggt
ggagctatctctttagtcaccaagagactgaaggagagaacaaccatcttgaaaaccacaaccaacgcactgagtaa
>gnl|bcl2dbcds|A0A3B4BVX1_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Pygocentrus nattereri GN=BCL2L11 (length=492 residues).
atgcagaacagtaattactgctgttttgagcagggggagagtggtcagagcagcggagcagcctcctcccgggccgccga
gcagtgcgagcagcctgagcccggcgagggggacccggttaggggagggattacaatgcctaatagccttctgggttacc
agtcgcgttcgcctctcttccgaacactatccaggtcctcaagcggatacttttcgtttgagagcgagcccagctctccg
ctcctgacctctccttctctgtctgtgtgttccacagaattatggcccctctataaccaccatccgccccacggagcagc
gcctgcgggggacatgcgaccggagtcgtacgtggcgcaagagctgcggcgcatcggcgatgagtttaacgagctttatt
ttcacggggtgagtcagctgcatgggtgcgttgctggtatgcaagcgttgagtgctcgagatctgcacgatcaaatgttt
gctttaagctaa
>gnl|bcl2dbcds|A0A3B4BVX1_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Pygocentrus nattereri GN=BCL2L11 (length=660 residues).
cttctgtccgccagaaaagctcgtttcagtgtttgcccgtgttcttctccggaggaccgtatacatcaccttcctcatta
tctgcggtcaaaccgggccggccgcccagccttcttaaaggagcagggggagagtggtcagagcagcggagcagcctcct
cccgggccgccgagcagtgcgagcagcctgagcccggcgagggggacccggttaggggagggattacaatgcctaatagc
cttctgggttaccagtcgcgttcgcctctcttccgaacactatccaggtcctcaagcggatacttttcgtttgagagcga
gcccagctctccgctcgtgacgcacagcgcgtccacgcagacccccagcccgtctagtcaagtaatcactcacgccctgc
agcgcattgctgaggcgcgagggaacgctcagactttcgaattatggcccctctataaccaccatccgccccacggagca
gcgcctgcgggggacatgcgaccggagtcgtacgtggcgcaagagctgcggcgcatcggcgatgagtttaacgagcttta
ttttcacggggtgagtcagctgcatgggtgcgttgctggtatgcaagcgttgagtaatcctgttgccttttcaatcctgg
ggctttttcgtggacactga
>gnl|bcl2dbcds|A0A3B4CNJ8_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Pygocentrus nattereri GN=BMF (length=468 residues).
atggatgaagatgaagatgatgtttttgtgatggatacacaatattggcgttcctcaatcagggagataaagcaggagga
gcgtggcactcagactccggggcggccgccagctcggcccaacggcatgctgccctgtggagtgtctgaggagccaagac
gcctattctacggtagcgcaggattgctactactagcaccatctgtccgtcctgaacacgttgagggtgccatgcttcag
gaggaccagctcgccatggaacctcggagacggcccccacacagtgtggaggcccgtatcggtcagaagctccagatgat
cggagatcagttctatcaagagcacatgctgcaacacagaaaccaaaggaaccagcagcccttttggttgcgtttggcat
cagcgttgtacacgctcctgtttgagagagagccggtggctaatgggaggagagtggaccagaggtga
>gnl|bcl2dbcds|A0A3B4CPH6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pygocentrus nattereri GN=BAD (length=477 residues).
atggctcatatgttcacattatcggacgactcagacacatctgaagatctaggagacgcagaccagccagaagccagtaa
gagagctgagctgtcacagtctgggcagcacccacttgttccagagagattcagagagtcaaggcagaggaatcactcta
tgaatgaggatgcccttcaggaatctggggctgtgagacatggagatggagctgcagatggagactctttccgccgtcgc
tgtcgctcggctccccctgctctgtgggcagcaaagaaatatggcagacagctgaggaagatgagtgacgagttcgacac
cttgctggacaaagggatgaagagagtgaggagtgcaggtgcagcccgtcagatgcacgcttcccccagctggttcacct
tcttatggagccacaaagagtcagactctgaggccagcagcagtctaacagctccagacacccgtccggcagagtga
>gnl|bcl2dbcds|A0A3B4DUY7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pygocentrus nattereri GN=BAD (length=621 residues).
atgagcaatcaatatctgcagaaactgaggagagctcgttttaattgcgaagaggagcgatataagaaagtaattaaaac
actgactggagagaaaggaacgccttttaacccattgtgctggaattcattaagaaccacagcttgcgcaatggaaaagc
acagtgaagatggcataagtaccatggatgaccaagatgaatccaattggtcagagacggtcaagaatggtgactctcca
cagctggacagtcagcacagcatggcaagcaacatatcaccagcttccccagacgaactgtcagaggttgggtgtcgtgt
tcggctgtactctgagtcccaggtgtacacggtcagccgctggcaggacaatgaggatgggcttttagcggaggacggtg
gagcaggggatggagctccattccgaggccgatcccagtcggctcctgctgcactgtggaaagccaagaaatatgggcgg
cagctgaggaggatgagtgatgaatttgacacctggctggataaaggggacacaagaagagcgagcagccctgggaagca
gacgaaccgaggatggttctcttttctctggggttccaaagaagaagaaggaagagaataa
>gnl|bcl2dbcds|O35147_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Rattus norvegicus GN=BAD (length=618 residues).
atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtccgatcccggaatccggagcct
ggggagcgacgcgggaggaaggcggtggagaccagcagcccagagtatgttccagatcccagagtttgagccgagtgagc
aggaagacgctagtactacagataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
ctcctggggagcatcgttcagcagcagccgggacaggcagccaataacagtcatcatggaggcgctgggactatggagac
ccggagtcgccacagttcgtacccagcggggactgaggaagatgaagggatggaggaggagcttagcccttttcgaggac
gctcgcgctcggctccccccaatctctgggcagcgcagcgctatggccgtgagctccgaagaatgagcgatgaatttgag
ggttccttcaagggacttcctcgcccaaagagcgcaggcactgcaacacagatgcgacaaagcgccagttggacgcgcat
tatccagtcctggtgggatcgaaatttggggaaaggaggctccactccctcccagtga
>gnl|bcl2dbcds|O88498_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L11 (length=591 residues).
atggccaagcaaccttctgatgtaaattctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaatcgcaaggtaatcccgacggcgaaggggaccgctgcccccacg
gcagccctcagggcccgctggccccaccggccagccctggtccttttgctaccagatccccacttttcatctttgtgaga
agatcttctctgctgtcccggtcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caagtcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccataaggcagtctc
aggaggaacctgaagatctgcgcccagagatacggatcgcacaggagctgcggcggatcggagacgagttcaatgagact
tacacgaggagggcgtttgcaaacgattaccgagaggcggaagaccacccgcaaatggttatcttacaactgttacgatt
catcttccgtctggtctggagaaggcactga
>gnl|bcl2dbcds|P62817_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Rattus norvegicus GN=HRK (length=279 residues).
atgtgcccgtgtccccggcatcgcggccgcgggcccccggccgtgtgcggttgcggcgacgctcgccccgggctgcgctg
ggcggcggcgcaggtgaccgcgctgcggctgcaggcgctgggcgacgagctgcaccgacgcgccatgaggcgtcgcgcgc
ggccccgggacccgctgcccgcgctgctgcccgcgctccgcgcccgctggccctggctgtgcgcggccgcgcaggtggcg
gcgctggcggcctggctgctcggcaggcggagcgcgtag
>gnl|bcl2dbcds|Q5U777_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Rattus norvegicus GN=PMAIP1 (length=318 residues).
atgcccgggagaaaggcgcgtcggaacgcgccattgaacccaacgcgggcagagttaccgcctgaattcgcagctcagct
caggaagattggagataaagtgtactgcacgtggagtgcaccggacataactgcggttctggcgcagatgcctggcaaga
agtcgcgaaagagcacgatgagaagaagcccaagcccaacccgggtgccagcagacctgaaggacgagtgtgatcaactg
cggagaattggagacaaagtgaatttacggcagaaacttctgaattttatttccaagctcttcaatttaataacctga
>gnl|bcl2dbcds|Q6P7C5_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Rattus norvegicus GN=BAD (length=345 residues).
atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtccgatcccggaatccggagcct
ggggagcgacgcgggaggaaggcggtggagaccagcagcccagagtatgttccagatcccagagtttgagccgagtgagc
aggaagacgctagtactacagataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
ctcctggggagcatcgttcagcagcagccgggacaggcagccaataacagtcatcatggaggtaggttcctcacttccat
cattttcctgtcccatgtcccctga
>gnl|bcl2dbcds|Q80ZG6_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Rattus norvegicus GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctctccggagcccgtagagggcctagcccgcgacagcccgcgtcctttcccgct
cggccgcctgatgccctccgctgtatcctgcggcctctgcgagcccggcctgcccgctgcccctgctgcccctgccttgc
tgccggccgcctacctctgcgcccccaccgccccgcctgccgtcaccgccgccctggggggcccccgctggcctgggggt
caccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctgtcaccagcccagcagcacctagagtcgcc
cgtgcccagcgccccggaggccctggcgggaggccccacccaagctgccccgggagtgcgtgtggaggaggaggagtggg
cccgggagatcggggcccagctgcggaggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaagagcaa
catcgacaccgaccctcgccctggagggtcatgtataatctcttcatgggactcctccccttacccagggatcctggagc
cccagaaatggagcccaactag
>gnl|bcl2dbcds|Q8K589_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Rattus norvegicus GN=BMF (length=558 residues).
atggagccacctcagtgtgtggaggaactagaagatgatgtgttccagccagaggatggggagccagggacacagcctgg
gagcttgctctctgctgacctgtttgcccagagccagctggattgtcccctcagtcggcttcagctcttcccgcttaccc
actgctgtggtcctgggctccggcctgtaagccaggaagacaaggccacccagaccctcagcccagcctccccaagccag
ggtgtcatgctgccttgtggggtgacagaggaaccccagagactcttttacggcaacgctggctacaggcttcctctccc
tgccagtttccccgcaggctcagcccttggggagcagccccctgaaggacagttccttcagcaccgagcagaggtacaga
tcgccagaaagcttcagtgcattgcagaccagttccatcggcttcatatgcaacaacaccagcagaaccgagaccgagca
tggcggcaggtcttcctcttccttcaaaacctggccttgaacagacgagaaaacagggaaggggtgggtccctggtga
>gnl|bcl2dbcds|Q925D2_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Rattus norvegicus GN=BIK (length=477 residues).
atgtcagaggcgagactaatggccagagacattatcaagactcttctacacgaccaggtcccccaacctgcagtggtctc
tggggctcccagcatgaaggagcctgtgggggttgaggacgtcagtcctgtgagagacttggatttcatgaggtgcctgg
agagcagaaaccaggtggccctgaggctagcctgcatcggcgatgagatggaccggtgtcttcggagcccccgtctggtc
cagctgcctgggattgctatgcacagacttgctgccacctacagccagacgggtgtcagaggtattttcagaagcttgat
tggaagcctcaccaacctcagggaaaatatctggtcctggagagtcttcactcctggcgcctgggtgtcacctgaccagg
accctgggcagctgtttcccatggtgctgctggtcttcttgctgctgggtggggcctggcatttgcagcttcagtga
>gnl|bcl2dbcds|A0A2K6KJF1_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Rhinopithecus bieti GN=PMAIP1 (length=165 residues).
atgcctggaaagaaggcgcgcaagaacgcgcaaccgagcccagcgcgggctcaggcagagctcgaagtcgagtgtgctac
tcaactcaggagatttggagacaaactgaacttccggcagaaacttttgaatctgatagccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|A0A2K6KJF1_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Rhinopithecus bieti GN=PMAIP1 (length=399 residues).
atgcctggaaagaaggcgcgcaagaacgcgcaaccgagcccagcgcgggctcaggcaggacctgcagggacggcagggac
ggcgagggaccaagccggattagggattgggatgcagctgcatttcaccagaggcaaaaagctcctctcctcctccccac
ttgcccttccgcggggccacgaggaacaagtgcaagtagctcgaagtcgagtgtgctactcaactcaggagatttggaga
caaactgaacttccggcagaaacttttgaatctgatagccaaactcttctgctcaggaacctgactgcatcaaaaacttg
cataaggggactccaaacgagaatttttctcaggaggtgcacgtttcatcaatttgaagaaagattgcattgtaattgg
>gnl|bcl2dbcds|A0A2K6KJP8_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2K6KJP8_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2L11 (length=354 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcatcctagaggatataggtgat
acttcattgtggtttggatttatatttactggcttagatttgtatgtggtttggatttatatttaccaccacagtcaaga
tacagaacaactcaaccacagggatttctcatga
>gnl|bcl2dbcds|A0A2K6KS56_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Rhinopithecus bieti GN=BBC3 (length=261 residues).
ctggcggagcgcacctggagtcgcggtgccagccccggggccctggcggccccgggagtcgcggggaggaggcgaagtgg
gccgggaatcggggcccagctgcggcggatggcgagacgactcaacgcgcagtacagacggcggagacaagaggagcagc
agcgacaccgcccctcgccctggagggtcctgtacaatctcattatgggactcctgcccttacccaggggccacagagcc
cccgaaatggagcccaattag
>gnl|bcl2dbcds|A0A2K6L919_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Rhinopithecus bieti GN=BMF (length=555 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccgggggcccaacctgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcggcccagcctcccccagccaa
ggtgttatgctgccttgtggggtaactgaggaaccccagcgactgttttatggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaataggaacggggcgggccctaggtga
>gnl|bcl2dbcds|A0A2K6L919_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Rhinopithecus bieti GN=BMF (length=615 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccgggggcccaacctgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcggcccagcctcccccagccaa
ggtgttatgctgccttgtggggtaactgaggaaccccagcgactgttttatggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaataggaacggggcgggccctaggcccttgac
ctggaatgggggccgttgtcaaacactgttgaaggggaggctgatgtgtctgtga
>gnl|bcl2dbcds|A0A2K6L919_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Rhinopithecus bieti GN=BMF (length=555 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccgggggcccaacctgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcggcccagcctcccccagccaa
ggtgttatgctgccttgtggggtaactgaggaaccccagcgactgttttatggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaataggaacggggcgggccctaggtga
>gnl|bcl2dbcds|A0A2K6MCW0_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Rhinopithecus bieti GN=BIK (length=474 residues).
atgtctggagtaagacccgtctccagagacatcttgatggagaccctcctgtatgagcagctcctggaacccctaaccat
ggaggttcttggtgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttggagtgtatggaggaca
gtgacatgttggccctgcggctggcctgcatcggggatgagatggacgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctaggtctggctttcatctacgaccagaccgacgacatcagggatgttcttacaagttt
catggacggcttcaccacccttaaggagaacataatgaggttctggagatccctgaatcccgggtcccaggtgtcccgcg
aacaggtgctgctggcgctgctgctgctgctggcggcgctgctcagcgggggcctgcacctgctgctcaagtga
>gnl|bcl2dbcds|A0A2K6N196_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Rhinopithecus bieti GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcccggc
aggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccctaacctctgggcagc
acagcgatatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A2K6N196_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Rhinopithecus bieti GN=BAD (length=489 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcccggc
aggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagagcttggtattatcctgctgaatctgaggactctgaaaatcccagtgca
aggatgctcgcggaagcatcagcagggatgtctgccccagccactgactcagaagcccaactcgcagagaatgtaaagct
ggaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacggaggaggacgaagggatggagga
ggagcccagcccctttcggggccgctcgcgctccgcgccccctaacctctgggcagcacagcgatatggccgcgagctcc
ggaggatga
>gnl|bcl2dbcds|A0A2K6NC45_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=PMAIP1 (length=399 residues).
atgcctggaaagaaggcgcgcaagaacgcgcaaccgagcccagcgcgggctcaggcaggacctgcagggacggcagggac
ggcgagggaccaagccggattagggattgggatgcagctgcatttcaccagaggcaaaaagctcctctcctcctccccac
ttgcccttccgcggggccacgaggaacaagtgcaagtagctcgaagtcgagtgtgctactcaactcaggagatttggaga
caaactgaacttccggcagaaacttttgaatctgatagccaaactcttctgctcaggaacctgactgcatcaaaaacttg
cataaggggactccaaacgagaatttttctcaggaggtgcacgtttcatcaatttgaagaaagattgcattgtaattgg
>gnl|bcl2dbcds|A0A2K6NC45_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=PMAIP1 (length=165 residues).
atgcctggaaagaaggcgcgcaagaacgcgcaaccgagcccagcgcgggctcaggcagagctcgaagtcgagtgtgctac
tcaactcaggagatttggagacaaactgaacttccggcagaaacttttgaatctgatagccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|A0A2K6PUL3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Rhinopithecus roxellana GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcccggc
aggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccctaacctctgggcagc
acagcgatatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggtacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A2K6PUL3_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Rhinopithecus roxellana GN=BAD (length=489 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcccggc
aggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagagcttggtattatcctgctgaatctgaggactctgaaaatcccagtgca
aggatgctcgcggaagcatcagcagggatgtctgccccagccactgactcagaagcccaactcgcagagaatgtaaagct
ggaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacggaggaggacgaagggatggagga
ggagcccagcccctttcggggccgctcgcgctccgcgccccctaacctctgggcagcacagcgatatggccgcgagctcc
ggaggatga
>gnl|bcl2dbcds|A0A2K6QIL2_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|A0A2K6QIL2_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A2K6QK74_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Rhinopithecus roxellana GN=BIK (length=474 residues).
atgtctggagtaagacccgtctccagagacatcttgatggagaccctcctgtatgagcagctcctggaacccctaaccat
ggaggttcttggtgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttggagtgtatggaggaca
gtgacatgttggccctgcggctggcctgcatcggggatgagatggacgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctaggtctggctttcatctacgaccagaccgacgacatcagggatgttcttacaagttt
catggacggcttcaccacccttaaggagaacataatgaggttctggagatccctgaatcccgggtcccaggtgtcccgcg
aacaggtgctgctggcgctgctgctgctgctggcggcgctgctcagcgggggcctgcacctgctgctcaagtga
>gnl|bcl2dbcds|A0A2K6QZT2_BBC3-04 BCL2 binding component 3 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BBC3 (length=396 residues).
ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccagggcttcttctgcgacgtgggtcccctgcca
gatttgtggtcctcagccctcgctctcgctggcggagcagcacctggagtcgccggtgcccagcgccccgggggccctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctggag
ggtcctgtacaatctcattatgggactcctgcccttacccaggggccacagagcccccgaaatggagcccaattag
>gnl|bcl2dbcds|A0A2K6QZT2_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgccacccccgctgcccccgccctgc
tgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccggccccgaggcccacgcccggacggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcc
ggtgcccagcgccccgggggccctggcgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcag
cagcgacaccgcccctcgccctggagggtcctgtacaatctcattatgggactcctgcccttacccaggggccacagagc
ccccgaaatggagcccaattag
>gnl|bcl2dbcds|A0A2K6RAW1_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Rhinopithecus roxellana GN=BMF (length=555 residues).
atggagccatctcggtgtgtggaggagctggaagatgatgtgttccagccggaggacggggagccgggggcccaacctgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcggcccagcctcccccagccaa
ggtgttatgctgccttgtggggtaactgaggaaccccagcgactgttttatggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaataggaacggggcgggccctaggtga
>gnl|bcl2dbcds|A0A2K6RAW1_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Rhinopithecus roxellana GN=BMF (length=372 residues).
atggagccatctcggtgtgtggaggagctggaagatgatgtgttccagccggaggacggggagccgggggcccaacctgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcggcccagcctcccccagccaa
ggtgttatgctgccttgtggggtaactgaggaaccccagcgactgttttatgcaccagcagaaccgaaatcgcgtgtggt
ggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaatag
>gnl|bcl2dbcds|A0A2K6S6C4_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagagcgcgcaaccgagccccgcgcgggctccagcagaccttgaagtcgagtgtgccat
tcaactcaggagatttggagacaaactgaatttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|A0A2K6STD6_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BBC3 (length=396 residues).
atgaaatgtggcatggggtctgcctgggcatgtccatgccaagtgcccagggcttcttccttgacgtgggtcccctgcca
gatgtgtggttctcagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggagcagtgggctcgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaagagcagccgcaacaccgcccctcaccctggag
ggtcctgtacaatctcatcatgggactcctgccctttcccaggggccacagagccccagagatggagcccaattag
>gnl|bcl2dbcds|A0A2K6TBD7_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BIK (length=468 residues).
atgtctgaagacagacccctctccagcgacatcttgatggagactctcctgtgtgagcagtttgtggatcccctgaccat
ggaggttgtcggtgggagtgaccctgaagaggacccggactctgtggaggaccctttggaatgcatggagaacagtgacg
cactggccctgcagctggcctgcatcgcggaccagatggatgtgagcctcagggcccggaggctggcccagctctacgag
gtggccacgtacagcccgggtctcgctttcatccttgaccggaccgacatcagggatgttcttagcggtgtcgtggatgt
tttcgctgacttccaggaggacatagtgaggctctggagatccctgagctctgggtcctgggtgtccggcaaacaggccg
tgctgctggcgctcctggcgctgctgctggcgatgttcagcgggggtctgcgcctgctgctcaagtga
>gnl|bcl2dbcds|A0A2K6TG62_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BAD (length=504 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacagccccccaggctctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcaccagcagggac
agccaaccagcagcagccaccatggaggcgctggagccgtggagacacggagtcgccacagctcgtaccccgcagggacg
gagggggacgaagggatggaggaggagcccagcccttttcggggccgttcgcgctcggcaccccccaacctctgggcagc
acagcgatatggccgcgagctccggaggatgagtgacgagtttgtggactccttcaagggacttcctcgcccgaagagcg
cgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcatccagtcctggtgggatcggaacttgggcagg
ggaggctccgctccctcccagtga
>gnl|bcl2dbcds|A0A2K6TG62_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BAD (length=450 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacagccccccaggctctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcaccagcagggac
agccaaccagcagcagccaccatggagagaatcccagtgcaaagatgctctcgaaagcatcagcagggatgtctgcccca
gccactgactcagaagcccaacacacagagaatgtaaagctggaggcgctggagccgtggagacacggagtcgccacagc
tcgtaccccgcagggacggagggggacgaagggatggaggaggagcccagcccttttcggggccgttcgcgctcggcacc
ccccaacctctgggcagcacagcgatatggccgcgagctccggaggatga
>gnl|bcl2dbcds|A0A2K6TRU4_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L11 (length=291 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacagttgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgaggccactggatcctcccttgcc
cttcgtagggaggttcagtgcccacttgagtggttagcaaaatcaagctga
>gnl|bcl2dbcds|A0A2K6TRU4_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacagttgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctgact
gggactag
>gnl|bcl2dbcds|A0A2K6TW78_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BMF (length=390 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccagggacccaacccgg
gagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccggcttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatgcaccagcagaaccgaaatcgtgtgtggt
ggcaggtcctcctcttcctgcacaacctggctttgaatggagaagaaaacaggaatggggcaggtccgag
>gnl|bcl2dbcds|A0A2K6TW78_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BMF (length=555 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccagggacccaacccgg
gagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccggcttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgccccttggggagcagccccctgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccgaaatcgtgtgtgg
tggcaggtcctcctcttcctgcacaacctggctttgaatggagaagaaaacaggaatggggcaggtccgaggtga
>gnl|bcl2dbcds|A0A2K6TW78_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BMF (length=555 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccagggacccaacccgg
gagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccggcttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgccccttggggagcagccccctgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccgaaatcgtgtgtgg
tggcaggtcctcctcttcctgcacaacctggctttgaatggagaagaaaacaggaatggggcaggtccgaggtga
>gnl|bcl2dbcds|B5X1T1_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Salmo salar GN=BAD (length=471 residues).
atggaccacacacatgattgtgtggatgacaacccagaaaccatgaatgaacatgatgagtctgaccactcaggaaccac
acactacccagaatttcagcgccattatgtctccactaggacgggcatcagaccacgaccaggtgggcgagtgcggctct
actccgagtcccaggtgtgctcccaggttggcagaagggacaacacagagtttcaggatgtgatgactcctactgaggag
ggcggtggcgatggggctcctttccgaagccgatcacagtctgctcctcctacactgtgggctgcaaagaaatatggccg
ccagctgaggaggatgagtgatgaatttgacacctggctcgacaaaggggaacccaagagagggataagcccaggagggg
tcaagcaggaggtctcccgaggatggttctctttcctctggagtccaaaaaaggctgaaggcagggagtga
>gnl|bcl2dbcds|B5XEF1_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Salmo salar GN=BAD (length=444 residues).
atggactacacacatgattgtgtggatgaatgtgagtctgatcactcaggaaccacacgcaactcagaattccagctcca
tgtctcaactacaatgagcaacagaccaagaccaggtgagcgagtccggctctactcagagtcccaggtgcgctcccagg
ttggcaaaagggaagacacagagtttcaggatgtgatgactcctactgaggagggtgggggtgatggggcttcattccga
ggtcgatcacagtctgctcctcctgcactatgggctgcaaagaaatatggctgccagctgaggaggatgagtgatgaatt
tgacacctggctcgacaaaggggtgcccaagagagggattatcccaagaggaggcaagcagaaagtctcccgaggatggt
tctctttcctctggagtccaaaggaggcggaaggcagggagtga
>gnl|bcl2dbcds|G3VRY3_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Sarcophilus harrisii GN=BAD (length=522 residues).
atgttccagatatccgagtttgagcccagtgagcccggagaagacccttctgcctccactgcccccagcctcgccccgct
caggccaggaccccgagcagcacctggagcccaccaccatgagaaggggggagcccagaagtcccagacccatgtctcaa
aagagctcaaagcctctgctagtcaagggagattaggaaaaggcagtttcgagggtagggagggctcccgggaggcgagc
cccgaagcggaggccgaggcagagcagtccgagggggaggaagagcgcggcctcttccggggccgctccagctcagcgcc
ccctatcctctgggcggcgcggcattatggcagcgagctgcgcaggatgagcgacgagttccactgcaccttcaagggac
ttccccgcccgaagagcgcaggcactgcgagccagatgcgtcggagccatggctggacccgcaccttccagtcttggttc
gggcggaatttggggaaagggagcgtcggtccttcccactga
>gnl|bcl2dbcds|G3VRY3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Sarcophilus harrisii GN=BAD (length=474 residues).
atgttccagatatccgagtttgagcccagtgagcccggagaagacccttctgcctccactgcccccagcctcgccccgct
caggccaggaccccgagcagcacctggagcccaccaccatgagggcgccggcgcggggaggcctcgcctgatctcctacc
ccccgctaagggagggctcccgggaggcgagccccgaagcggaggccgaggcagagcagtccgagggggaggaagagcgc
ggcctcttccggggccgctccagctcagcgccccctatcctctgggcggcgcggcattatggcagcgagctgcgcaggat
gagcgacgagttccactgcaccttcaagggacttccccgcccgaagagcgcaggcactgcgagccagatgcgtcggagcc
atggctggacccgcaccttccagtcttggttcgggcggaatttggggaaagggagcgtcggtccttcccactga
>gnl|bcl2dbcds|G3W979_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2L11 (length=603 residues).
atggcaaagcaaccgtcagatctaaattctgagtgtgaccgtgaaggtggacaattgcagcctacagaaaggcctactca
acctcaactcagaccaggggcccctacctctatacaaacacaatatcaaggtaattcaggtgaaggggacagctgctcac
ctagcagccctcagggaccgtttgcaccacccactagccctagcccgtttgctaccagatccccacttttcatctttgta
agaagatccccactgctgcctcgatcttctagtgggtatttctcttttgacacagacaggagtccagcgcctatgagttg
tgataaatctacacaaactccaagccctccttgtcaagccttcaatcattatctaagtgcaatggatacagcttccatga
ggcagtctcagtcaatacctgcagatatgcgaccagaaatttggattgcacaagaattgcgacgtattggagatgaattt
aatgcttcttatccaagaaggggttttttggataataactatcaagcagcagatgatcatcaccaaatggttattttacg
gctattacattacatcatccgccttgtttggagaatgcagtga
>gnl|bcl2dbcds|G3WDQ2_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Sarcophilus harrisii GN=BMF (length=555 residues).
atggagtctcctcattatgtggaagagctggaggacgatgtgttccacccagaggactcagagcctggtgctcagccagg
gggcctgacctcgccagctctgtttgcccagagccagcctgactatatgctggatgggctgcagcttttccctcttaccc
actgctgtggcccagggcttcgctcagttggccaggaagacaaggccactcagaccctcagtccagcctccccaagccag
ggtgtcatgctgccttgtggagttaccgaagaaccccaccgactcttttatggcaacgctggatatcgacttcccctccc
agctaattttccttcgagcctgaggcttggagcggagcctcccgaggagcagtgggagcatcgagctgaggtgcagattg
cccgaaagcttcagtgcatcgcggaccagttccacaggctccacatgcagcggcaccagcagaaccaaaaccatgtgtgg
tggcagatcctcctcttccttcacaatttggccttgaacagagaggagaacaggaatggggcaggccctaggtga
>gnl|bcl2dbcds|A0A2U9BAC9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Scophthalmus maximus GN=BAD (length=504 residues).
atggcggcaaacttcacaatatcagacagtgagtcagagccatcggaggaggtggaggaaggagaagtgagccaaccgtg
gaccgggccaggggagcaggttcctccgcgccacaccctcgccctccctgagctgcgaatggcagcaaccggtcgaatcc
ggctgaactcggagtccaacgcttccactctctcacgagacgaggagctcctgaccaggtgggacgaggaagccggtacg
cccaccgacggagctccattccgggggaggtccaagtcggctcctcctgcgctgtgggcggccatgaaatacggccagaa
gctccggcggatgagtgacgagtttgacagcctgctagacaaaggggagatgaggaaggtgaagagcgccgggacggcca
gacagatgcaccactctcaaagctggtggagctacctctttagtcaccaggagatggaaggagaaaacaaccaccacgag
aaccacactcaacgcaacgagtag
>gnl|bcl2dbcds|A0A2U9CJH3_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Scophthalmus maximus GN=BMF (length=654 residues).
atggacgatgaggaggatgatgtctttgagccagacccccactgctggcgcaccacattcagggagataaagtgtgaaga
ccggggcacacagacacctggccctgccctggcactgaacaacggcatgctgccctgtggagttgcagaggagcccagac
cactcttctacggcaacgcgggttttcgattgcacttcccggcacactttgagctttttggggatcaggaagtgagggga
cacgagagcgaagaggagcgaagcgggatggagcagctaccgcggcagcagcagcctgtggcgcacagcgtggaggcctg
cattggccagaaactccagctgataggagaccagtttcaccgggaacacctacaactgtatcatcgaaaccaaaggaacc
aggggccgctgtggtggcgcctggccgcagctctgctcagccttctgtttgacagggggttccttgctggaggaggtgga
gcgggacggaggcaggcgcacacaaaacgcagggcgaaagcctccgggccgcagaaccgggccagttcagtggagaggac
ggtccaggcgatgaccaaccagttcacctcactgccgcctcagcagctgccacctccagccaacggtcggcttccctgcg
cgctgattggctaa
>gnl|bcl2dbcds|A0A3B4U5H8_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Seriola dumerili GN=BMF (length=492 residues).
atggacgatgaggaggatgatgtgtttgagccagacccccactgctggcgcaccacattcagggagataaagtgtgaaga
ccggggcacacaaacacctggcccagccctggcactgaacaacggcatgctgccctgtggagtcgcaaaggagcccagac
cactcttctacggcaacgcaggttttcgattgcacttcccggcacattttgagcttgttggggatcaggaagcgaggcga
caaggaagcggagaggagcgaaacgggatggagcagctaccccggcagcagcctgtggcgcgcagtgtggaggcctgcat
tggtcagaaactccagctgataggagaccagtttcaccgggaacacctacaactgtatcatcaaaaccaaaggaaccagg
ggccgctgtggtggcgcctggccgtagctctgctcagccttctgtttgacagggggttaattgctggaggaggtggagca
ggacggaggtga
>gnl|bcl2dbcds|A0A3B4UNJ0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Seriola dumerili GN=BMF (length=420 residues).
atggatgatgaggaggaggacatgtcacagcccatctcgcacctctggggaacgtcctttagggacgtcaaatacgaaga
ccgagccacaccgattgcagccggacaggcccttactgccgtcaccgctgctcctctcattctttttgtttggtgggttc
ctcattgggaactgtcccccagtaccaaaatgaatatgttaagattctcagagaataggcccgaggagcaggcaggggtg
agcgtcgaggcgcaaattggccgtaaacttcgggagattggagacaagttccaacaggatcatttcatgaggcaccagag
acaaaacctgcctgcctggatgcgccttacgatggccctgtttggctttctgtttccaagacaggctctcgtcccccgcc
tgagaggagagcagagatga
>gnl|bcl2dbcds|A0A3B4V919_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Seriola dumerili GN=BCL2L11 (length=519 residues).
atgaaagcccaggctgacggtgccgctctattcatccaacagaccacaaaaccggtccgatggctcgaccgcagtaacgg
caagaggggagagcgaaggggatccaccactcgtcggtgccgctggagccccagcgcaaaaccccagttcgaaagacagc
ggcgagcggagccttggccacctcggctccaccggagaaggagagccagactcgccgccccggtgcagaaccatagccac
ctctcctgtcaacacttctctcgtcgctcgtccagtggatatttctccttcgacagcgactcgctaccgagctccccgct
ctccccgaggccagccacggttgaacgaaccacgcagaccccgagccccaccagccaggtgatgaaacacgccttgcagc
gcatggcggaggcgcacggcggaggagcgaggatgcagcagcagcacggtgagctaaaacctgcgcttctaaaacacact
aagatgacttctcagtgctgccaaacccatttctgctga
>gnl|bcl2dbcds|A0A3B4VFC5_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Seriola dumerili GN=BAD (length=504 residues).
atggctgcaaacttcaccatttcagacagtgagtcagagccatcggaggaggtagacgaaggagaaatgagccaatcact
aactgggcaagagcaggagctttctcaacgccacaccctcaccttgcctgaactccgaggggcagcgaccggtcgaacga
ggctgaactcagagtcccacacttccactgtctccagagacgaagagttccaggccaggggggaggaggaagccggcacg
cccaccgaaggagctccattcaggggacggtccaagtcagctccccctgcactgtgggcggccaagaaatacggccagaa
gctcagaaggatgagcgacgaatttgacagcctgctagacaaaggggagatgaggaaggtgaagagcgctgggacagcca
aacagatgcaccactctaaaagctggtggagctacctctttagtcaccaggagacagaaggagaaaacaaccaccatgaa
aaccacactcaccgcactgagtag
>gnl|bcl2dbcds|A0A3B4W9T1_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Seriola lalandi dorsalis GN=BAD (length=504 residues).
atggctgcaaacttcaccatttcagacagtgagtcagagccatcggaggaggtagacgaaggagaaatgagccaatcact
aactgggcaagagcaggagctttctcaacgccacaccctcaccttgcctgaactccgaggggcagcgaccggtcgaacga
ggctgaactcagagtcccacacttccactgtctccagagatgaggagttccaggccaggggggaggaggaagccggcacg
cccaccgaaggagctccattcaggggacggtccaagtcagctccccctgcactgtgggcggcgaagaaatacggccagaa
gctcagaaggatgagcgatgaatttgacagcctgctagacaaaggggagatgaggaaggtgaagagcgctgggacagcca
aacagatgcaccactctaaaagctggtggagctacctctttagtcaccaggagacagaaggagaaaacaaccaccatgaa
aaccacactcaccgcactgagtag
>gnl|bcl2dbcds|A0A3B4WM88_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Seriola lalandi dorsalis GN=BMF (length=492 residues).
atggacgatgaggaggatgatgtgtttgagccagacccccactgctggcgcaccacattcagggagataaagtgtgaaga
ccggggcacacaaacacctggcccagccctggcactgaacaacggcatgctgccctgtggagtcgcaaaggagcccagac
cactcttctacggcaacgcaggttttcgattgcacttcccggcacattttgagcttgttggggatcaggaagcgaggcga
caaggaagcggagaggagcgaaacgggatggagcagctaccccggcagcagcctgtggcgcgcagtgtggaggcctgcat
tggtcagaaactccagctgataggagaccagtttcaccgggaacacctacaactgtatcatcaaaaccaaaggaaccacg
ggccgctgtggtggcgcctggccgcagctctgctcagccttctgtttgacagggggttaattgctggaggaggtggagca
ggacggaggtga
>gnl|bcl2dbcds|A0A3B4XZH1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Seriola lalandi dorsalis GN=BCL2L11 (length=651 residues).
atgaaagcccaggctgacggtgccgctctattcatccaacagaccacaaaaccggtccgatggctcgaccgcagtaacgg
caagaggggagagcgaaggggatccaccactcgtcggtgccgctggagccccggcgcaaaaccccagttcgaaagacagc
ggcgagcggaaaccatagccacctctcctggcaacagcctaggcgtgtttcaaaagaggtctatattcagctaccctcgt
cgctcgtccagtggatatttctccttcgacagcgactcgctaccgacctccccgctctccccgaggccagccacggctga
acgaaccacgcagaccccgagccccaccagccaggtgatgaaacacgccttgcagcgcatggcggaggcgcacggcggag
gagcgaggatgcagcagcagcagcacggtgagcacaggcactttgcatcaggggacatgcaggcggaggcagtcggacaa
gagctccgacgcatcggagacgactttaatagacttctcctgttaagggtcagtcatcacagatggtgtgtgtgtgtgtg
tgtgtgtgtgtgtgcgtgcgggtgtgtgtgtgcgtgcgggtgtgtgtgcgggtgtgtgcgggtgtgtggtggtggagggg
gggtagagtag
>gnl|bcl2dbcds|A0A3B5B8F6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Stegastes partitus GN=BMF (length=495 residues).
atggacgatgaggaggatgatgtttttgagccagacccccactgctggcgcacaacattcagggagataaagtgtgaaga
ccggggcacacagactcctggtcctgccctgcaaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtaacgcaggttttcgattgcacttcccagcacgctttgagcttattggggatcaccaagcgaggcaa
caacaaggaagtgaaatggagcaaaacgggatggagcagctgccccggcagcaacctgtggcgcgcagcgtggaggcttg
cattggacagaaactccagctgataggagaccagtttcaccgggaacacctacaactgtatcatcgaaaccaaaggaacc
aggggccgctgtggtggcgcctggccgcagccctactcagccttctgtttgacagggggttcattgctggaggaggtggt
gcaggacggaggtga
>gnl|bcl2dbcds|A0A3B5BAL2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Stegastes partitus GN=BAD (length=501 residues).
atggctgcacaattctctattagtggcagcgagtccgacccggaggaggtagaagagggagaaaacaaccatccaccagc
agaacagccgatgcatgtcttcgagcgccgcaacctcgccttacctgaactcagaaccccagccgccggccggatcaggc
tgaactcagagtcccacgcgaccacggtctccagagacgaggagctccaggccaggggggaagaggaggccggcacgccc
actgacggagctccgttcaggggacggtctaagtcggctccacctgcactgtgggccgccaagaagtacggccagaagct
gcgaaggatgagcgacgagtttgacagcctgctagataaaggggagatgaagagggtgaggagtgcagggacggccaaac
agatgcaccactctaaaagctggtggagctacctctttagtcaccaggagctggagggagagaacaaccaccatgaaaac
cacacacatcgcaatgagtag
>gnl|bcl2dbcds|A0A287AEF3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Sus scrofa GN=BAD (length=630 residues).
atgggcatcccagaaaatccctcatctgcttccacacacacccaaggaataaggaagtccggagctgaaccagggacccc
ggaggaaggcggtgggcggggccggagccgtagcggccccgcctcccagagcatgttccagatcccagagtttgagcaga
gtgagcaggaagactccagccctgcagacaggggcctgggccccagccccacagggacagacccccagccctggcgcacg
gccccaggccacctgggggaagctggtcaccagcaggggcagccggccagcagcagccaccatggaggcgctggggctgt
ggagacccggagtcgccacagctcttacccagaggggaccgaggaggatgaagggactgaggatgaggagctcagcccct
tccgcggccgatcgctctcggcgccccccatcctctgggctgcacagcgttatggccgcgagctccggaggatgagtgac
gagttccagggttccttcaagaagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagccccag
ctggaagcgcttcctccagtcctggtggtaccggaactcggggagaggaggccccgccccctcccaatga
>gnl|bcl2dbcds|A0A287AIU8_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Sus scrofa GN=BMF (length=507 residues).
atggagccacctcagtgtgtggaggagctggaggatgatgtgttccagccagaggaaggggagccggggacccagcccag
gagggtctctgctgacccgtttgtccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgcact
gctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagactctcagtccagcctccccgagccagggt
gtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcttgccccttggcgaacagccccccgaagg
gcagtggcaacatcgagcagaggtacagattgcccgaaaacttcagtgcattgcagaccagttccatcggcttcatatgc
agcagcaccagcagaaccaaaatcgtgtgtggtggcaaatcctcctgtttctacacaacctcgctttgcatggagatgag
aacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A287AIU8_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Sus scrofa GN=BMF (length=552 residues).
atggagccacctcagtgtgtggaggagctggaggatgatgtgttccagccagaggaaggggagccggggacccagcccag
gagggtctctgctgacccgtttgtccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgcact
gctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagactctcagtccagcctccccgagccagggt
gtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccctgc
cggtttccccgcaggcttgccccttggcgaacagccccccgaagggcagtggcaacatcgagcagaggtacagattgccc
gaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcagcaccagcagaaccaaaatcgtgtgtggtgg
caaatcctcctgtttctacacaacctcgctttgcatggagatgagaacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|C1KGB6_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=1215 residues).
gaaactcccgatatagagccagggctctcggggctcctgaggctttccgcgggcggcagcggcggggtctggtttacact
gtattcggagcgccccctctgttccacgcgcactcctaggccaccgctggttggggaagaggagaggttacactttgagt
tgggggatgggtgcgcactgagccatccgcagccaagtcactccagtaaacacgcccggcgggggcagggcggtaggcgc
gcgcagcggggaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtcagcggctgcagcggcgcgga
ggcggggctttccagcccgcgcgctgggcgggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgcagcctccaggtctcgagcttgcaggagcgt
ttggtcccacgtcgccgccgccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacagtcgccctgcg
cgtcctgttctctgcggccagcatcgcttcagactgctgggttcgccccgctcccgccgccgccactcactcggcgccct
tcccctggccctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaaaaaaagaccaaatggcaaag
caaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
tggggcccccacctctctacaaacagagcggcaaggtaatccggaaggagaaggggaccgctgcccccaaggcagccccc
agggcccactggccccaccgaccagccctggcccctttgctaccagatccccgcttttcatcttcgtgagaagatcctcc
ctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtgacaaatcaac
acaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctcaggctgaac
ccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaagg
aggttagaacaatag
>gnl|bcl2dbcds|C1KGB6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=1302 residues).
gaaactcccgatatagagccagggctctcggggctcctgaggctttccgcgggcggcagcggcggggtctggtttacact
gtattcggagcgccccctctgttccacgcgcactcctaggccaccgctggttggggaagaggagaggttacactttgagt
tgggggatgggtgcgcactgagccatccgcagccaagtcactccagtaaacacgcccggcgggggcagggcggtaggcgc
gcgcagcggggaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtcagcggctgcagcggcgcgga
ggcggggctttccagcccgcgcgctgggcgggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgcagcctccaggtctcgagcttgcaggagcgt
ttggtcccacgtcgccgccgccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacagtcgccctgcg
cgtcctgttctctgcggccagcatcgcttcagactgctgggttcgccccgctcccgccgccgccactcactcggcgccct
tcccctggccctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaaaaaaagaccaaatggcaaag
caaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
tggggcccccacctctctacaaacagagcggcaaggtaatccggaaggagaaggggaccgctgcccccaaggcagccccc
agggcccactggccccaccgaccagccctggcccctttgctaccagatccccgcttttcatcttcgtgagaagatcctcc
ctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtgacaaatcaac
acaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctcaggctgaac
ccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaagg
agggtctttctgaataattaccaagcagccgaagcccaccctcagatggttatcttacgactgttacgctacatcgcccg
tctggtgtggaggatgcagtga
>gnl|bcl2dbcds|C1KGB6_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=1095 residues).
gaaactcccgatatagagccagggctctcggggctcctgaggctttccgcgggcggcagcggcggggtctggtttacact
gtattcggagcgccccctctgttccacgcgcactcctaggccaccgctggttggggaagaggagaggttacactttgagt
tgggggatgggtgcgcactgagccatccgcagccaagtcactccagtaaacacgcccggcgggggcagggcggtaggcgc
gcgcagcggggaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtcagcggctgcagcggcgcgga
ggcggggctttccagcccgcgcgctgggcgggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgcagcctccaggtctcgagcttgcaggagcgt
ttggtcccacgtcgccgccgccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacagtcgccctgcg
cgtcctgttctctgcggccagcatcgcttcagactgctgggttcgccccgctcccgccgccgccactcactcggcgccct
tcccctggccctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaaaaaaagaccaaatggcaaag
caaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
tggggcccccacctctctacaaacagagcggcaagacaggagcccagcacccatgagttgtgacaaatcaacacaaaccc
caagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctcaggctgaacccgcagat
atgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaaggagggtaat
gctgttttctttaccccccttttcccctcacaccctccctcccccttacatttaa
>gnl|bcl2dbcds|C1KGB8_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=294 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacagacagagcggcaagcttccatgaggcagtctcaggctgaacccgcagata
tgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaaggagggtaatg
ctgttttctttaccccccttttcccctcacaccctccctcccccttacatttaa
>gnl|bcl2dbcds|F1RM01_BBC3-04 BCL2 binding component 3 gene OS=[Eukaryota] Sus scrofa GN=BBC3 (length=1086 residues).
atgaccgtgtttgtgggaggttgtgctggccagccagtgccttgggtcagcccccccaccatggggggggcgtgtctctt
ggggccttctcacctgcctcccctccatctgggccttgtgtgtgttgtgggtgccagccctgggcttccctgcctgccac
gtgtcctcatgcctgggttcaagagtggggtgccctgtgtaccccagggaggggggtgccctgggggccggcctgatgcc
ccctgcacttctcagctgaccgtgcccctctgtcctgtcctgcaggccccagggagcgccatggcccgagcacgccagga
gggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgtcccttccccctcagccgcctggtgccctccg
ccgtgtcctgcggcctctgcgaacccggtctgcctgccgcccccgccgcccccaccctgctgcccgctgcctacctctgc
gcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagccggccccgagg
cccgcgccccgacggtcctcagccctcactctcgccggcggagcagcacctggaatcgccagtgcccagcgctccggggg
ccctggcgggcggccccacccaagcagccccgggaatccggggggaggaggagcagtgggcccgagagatcggggcccag
ctgcggcggatggctgacgatctcaacgcgctgtacgagcggcgggtgagtgctgggggaggggtagacggcaggtggga
cttcccgcggggagggggttgggggcgacccagccagatgtgcggcagctgctgccctgcgcggcggggtcgcgctgggg
acaggcaggtgggaggggcggcctgtccgcggagccaccgtaaggcccgcgctgcggctggcaccaccgggtcgagggcc
agggccggggcagcctcgagcgttacggtgtgcccgcggccggcggccggcggccggcggccgcgagaactgagggcggc
gctcagccgagcggctcatatatcccaggctatttatagccggtga
>gnl|bcl2dbcds|F1RM01_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Sus scrofa GN=BBC3 (length=651 residues).
atggcttctggagcgtgtcccatcagtgggccagtgagcaggaacctgtcacaggccccagggagcgccatggcccgagc
acgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgtcccttccccctcagccgcctgg
tgccctccgccgtgtcctgcggcctctgcgaacccggtctgcctgccgcccccgccgcccccaccctgctgcccgctgcc
tacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagccg
gccccgaggcccgcgccccgacggtcctcagccctcactctcgccggcggagcagcacctggaatcgccagtgcccagcg
ctccgggggccctggcgggcggccccacccaagcagccccgggaatccggggggaggaggagcagtgggcccgagagatc
ggggcccagctgcggcggatggctgacgatctcaacgcgctgtacgagcggcggagacaagaggagcagcagcgacaccg
cccctcgccctggagggttctgtacaatctcatcatgggacttctgcccttacccaggggccgtggagcccccgagatgg
agcctaattag
>gnl|bcl2dbcds|F1RM01_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Sus scrofa GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgtcccttccccct
cagccgcctggtgccctccgccgtgtcctgcggcctctgcgaacccggtctgcctgccgcccccgccgcccccaccctgc
tgcccgctgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgccccgacggtcctcagccctcactctcgccggcggagcagcacctggaatcgcc
agtgcccagcgctccgggggccctggcgggcggccccacccaagcagccccgggaatccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggctgacgatctcaacgcgctgtacgagcggcggagacaagaggagcag
cagcgacaccgcccctcgccctggagggttctgtacaatctcatcatgggacttctgcccttacccaggggccgtggagc
ccccgagatggagcctaattag
>gnl|bcl2dbcds|F1SMU1_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Sus scrofa GN=PMAIP1 (length=366 residues).
gcgcgggcagcggcgggagcgccaacctcagaggcttttgggcgttcagggtgttgcttttctagctctctcccgcttgc
tcgcttctgcccgaccgccccgcgcgcagcctgctacctgcagagccaaggtgctcgggtccggggactgagttctcgga
gttttgcggcaaagttccggctgctgtttgcggagatgcctggaaggaggtctcgtaggaacactcagacgaaccctacg
cgggtggccctcccgccagatcctgaagtcgagtgtgccattcagttcagaaggattggagacaaactgaacttccggca
gaaacttctgaatctgatagccaaactcttccgcctaggaacctga
>gnl|bcl2dbcds|Q9GL49_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Sus scrofa GN=PMAIP1 (length=531 residues).
atgcgttcttccggatcgcttggctctaggattcgggggctgttggaatcggcaggatgggaggaattggtaagaagcca
gccccgggcacatcaaggtctcaccagtggccggtgtgggcagacgaggcgggaggagcttcgtggttccttcggtccgc
ctcccgctgccgtccgaggaaaccaaccaacctcagaggcttttgggcgttcagggtgttgcttttctagctctctcccg
cttgctcgcttctgcccgaccgccccgcgcgcagcctgctacctgcagagccaaggtgctcgggtccggggactgagttc
tcggagttttgcggcaaagttccggctgctgtttgcggagatgcctggaaggaggtctcgtaggaacactcagacgaacc
ctacgcgggtggccctcccgccagatcctgaagtcgagtgtgccattcagttcagaaggattggagacaaactgaacttc
cggcagaaacttctgaatctgatagccaaactcttccgtctaggaacctga
>gnl|bcl2dbcds|A0A1U7T0R1_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Tarsius syrichta GN=BCL2L11 (length=516 residues).
atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaagggggacaattgcagcctgccgagaggcctcccca
actcaggcctggggcccctacctccctacagacagagccgcaaggtaatcctgaaggcagtcccggaggcgaaggggacc
gctgcccccacggcagccctcagggcccactggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccctgccaggccttcaaccactatctcagtgcaatggagtcca
tgaggcagtctcaggctgaacctccagatatgcgcccggagatatggatcgcacaggagttgcggcgtatcggagacgag
tttaacgcttattatccgaggaggttagagaaatag
>gnl|bcl2dbcds|A0A1U7T0R1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Tarsius syrichta GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaagggggacaattgcagcctgccgagaggcctcccca
actcaggcctggggcccctacctccctacagacagagccgcaaggtaatcctgaaggcagtcccggaggcgaaggggacc
gctgcccccacggcagccctcagggcccactggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccctgccaggccttcaaccactatctcagtgcaatggagtcca
tgaggcagtctcaggctgaacctccagatatgcgcccggagatatggatcgcacaggagttgcggcgtatcggagacgag
tttaacgcttattatccgaggagggcttatttgaataataaccaagcagccgaagatcacccacaaatggttctcttacg
actgttacgttacattgtccgcctggtatggagaatgtattga
>gnl|bcl2dbcds|A0A1U7T0R1_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Tarsius syrichta GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaagggggacaattgcagcctgccgagaggcctcccca
actcaggcctggggcccctacctccctacagacagagccgcaaggtaatcctgaaggcagtcccggaggcgaaggggacc
gctgcccccacggcagccctcagggcccactggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccctgccaggccttcaaccactatctcagtgcaatgggcttat
ttgaataa
>gnl|bcl2dbcds|A0A1U7T0R1_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Tarsius syrichta GN=BCL2L11 (length=525 residues).
atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaagggggacaattgcagcctgccgagaggcctcccca
actcaggcctggggcccctacctccctacagacagagccgcaaggtaatcctgaaggcagtcccggaggcgaaggggacc
gctgcccccacggcagccctcagggcccactggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccctgccaggccttcaaccactatctcagtgcaatggagtcca
tgaggcagtctcaggctgaacctccagatatgcgcccggagatatggatcgcacaggagttgcggcgtatcggagacgag
tttaacgcttattatccgaggaggatgccctttccacctgattaa
>gnl|bcl2dbcds|A0A1U7T0R1_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Tarsius syrichta GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaagggggacaattgcagcctgccgagaggcctcccca
actcaggcctggggcccctacctccctacagacagagccgcaaggtaatcctgaaggcagtcccggaggcgaaggggacc
gctgcccccacggcagccctcagggcccactggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccctgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A1U7T0R1_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Tarsius syrichta GN=BCL2L11 (length=264 residues).
atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaagggggacaattgcagcctgccgagaggcctcccca
actcaggcctggggcccctacctccctacagacagagccgcaagagtccatgaggcagtctcaggctgaacctccagata
tgcgcccggagatatggatcgcacaggagttgcggcgtatcggagacgagtttaacgcttattatccgaggaggctggca
aaaaacctagcatcctcctcttga
>gnl|bcl2dbcds|H3D8J8_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Tetraodon nigroviridis GN=BAD (length=420 residues).
atggctgcaaagttcagtctgtgcagcgacagcgactcagagccatcagaggaggtggaagaaggagagaggggcagttt
ttcaacaagcggtcggatcagggtcaactcggaatcccaagcatccgccgtctccagagacgaggagctccagggcaacg
gggacgacgaggccgggacgcccaccgacggagccccgttcagggggaggtccagatcggctccccccgccttgtgggct
gccaagaaatacggccggcagctccggagaatgagcgacgagttcgacagcctgctggataaagggggaatgaggaagac
cagcagcgccggctcggccaggcagatgcaccactcccgcagctggtggagctacctgttcagccaccaggagacggaga
gcgagaacaaccaccacgac
>gnl|bcl2dbcds|A0A452QUG1_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Ursus americanus GN=BIK (length=441 residues).
tttcacaccacccgcaggtgcgctcagcgggtggtagcaccctccctccaccaccagcaccccgcaggggaaggtgctgt
cctgacaggtgcgggtggcatatgtcaggccacgggccctttgtgcaacaaccccgacgatgtggccatgcggctggcct
tcatcggggacgagatggaagtgagatggatgcttccccgcgttggcgagctccccgggatggccatgtacagcttggct
tttacctacaaccagacaggcctgagaggtgttcttcgaagtctcatggacggactcactaacctcagggagaacataag
gatttggagcttcctgaccttcaggaacagggtgtccccccacccggggcgcaggctggtgctgtccctgctgctgctgc
tggggctgctgctaggctgggggttccgcctcctccagtga
>gnl|bcl2dbcds|A0A452RJM6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Ursus americanus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcccagtgagcaggaagactccagccctgcagataggggcctgggccccagccccac
aggggaccagcccccaggccctggcaagcaccggcagacagccccaggcctcctaggggaagctgctcaaccccaggggc
agccggccagcagcaaccaccatggaggcgctggggctgtggagccccggagtcgccacagctcgtaccccgcggggacc
gaagaggatgaagggttggaggaggaagagctcagccctttccgggggcgctcgagctcagcgccccccaacctctgtgc
tgcactgcgctatggccgcgagctccggaggatgagcgacgagttccagggctccttcaagggacttcctcgcccgaaga
gcgcgggcacagcgacgcagatgcgacaaagccccagctggacgcgcgtcatccagtcctggtgggatcggaacttgggg
agaggaggctccgccccctcccaatga
>gnl|bcl2dbcds|A0A452SBG5_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Ursus americanus GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggatgta
cctgccgatatgcgcccggagatttggattgcgcaagagttgcggcgtattggagacgaatttaatgcatattacccaag
gagggtctttttgaataattaccaagcagccgaagcccacccccaaatgattatcttgcgactgttacgttacatcatcc
gcctggtgtggagattgcagtga
>gnl|bcl2dbcds|A0A452SED0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Ursus americanus GN=BMF (length=555 residues).
atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggacggggagccggggacccagcctgg
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcatctcttccctctcaccc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagaccctgagcccggcctccccgagtcag
ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatggcaacgcaggctaccggctccctctccc
tgccagtttccctgcaggcttgccccttggggagcagcccccagaagggccgtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcacatgcagcaacaccagcaaaaccaaaatcgagtgtgg
tggcagatcctgctcttcttacacaacctcgctttgaacgcagatgagaacagggatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A452STA4_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Ursus americanus GN=PMAIP1 (length=165 residues).
atgcctgggaagaaagcgcgtaagagcgcgcaggcgagccctgcgcggaccccggcagagcccgaagtggagtgtgccat
tcaactcaggagatttggagacaaactgaatttccggcagaaacttctgaatctgatatccaaactcttccgctcaggaa
cctga
>gnl|bcl2dbcds|A0A384D070_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Ursus maritimus GN=BMF (length=555 residues).
atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgg
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcatctcttccctctcaccc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagaccctgagcccggcctccccgagtcag
ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatggcaacgcaggctaccggctccctctccc
tgccagtttccctgcaggcttgccccttggggagcagcccccagaagggccgtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcacatgcagcaacaccagcaaaaccaaaatcgagtgtgg
tggcagatcctgctcttcttacacaacctcgctttgaacgcagatgagaacagggatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A384DJL2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Ursus maritimus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcccagtgagcaggaagactccagccctgcagataggggcctgggccccagccccac
aggggaccagcccccaggccctggcaagcaccggcagacagccccaggcctcctaggggaagctgctcacccccaggggc
agccggccagcagcaaccaccatggaggcgctggggctgtggagccccggagtcgccacagctcgtaccccgcggggacc
gaagaggatgaagggttggaggaggaagagctcagccctttccgggggcgctcgagctcagcgccccccaacctctgtgc
tgcactgcgctatggccgcgagctccggaggatgagcgacgagttccagggctccttcaagggacttcctcgcccgaaga
gcgcgggcacagcgacgcagatgcgacaaagccccagctggacgcgcgtcatccagtcctggtgggatcggaacttgggg
agaggaggctccgccccctcccaatga
>gnl|bcl2dbcds|A0A452TE71_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Ursus maritimus GN=PMAIP1 (length=162 residues).
tggggctccctgctcagtggggagcctgcttctccctctccctctgctgcaccccctcccgaagtggagtgtgccattca
actcaggagatttggagacaaactgaatttccggcagaaacttctgaatctgatatccaaactcttccgctcaggaacct
ga
>gnl|bcl2dbcds|A0A452U4S4_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Ursus maritimus GN=BCL2L11 (length=255 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggatctttggaccgtggagagacatctg
gaaaccgcactgtga
>gnl|bcl2dbcds|A0A452V3L2_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Ursus maritimus GN=BIK (length=534 residues).
atggcttggagctcagaagaagctaggtcaagagaagaaatgtcccacacaggacccctctccaggaacctctttttgag
caccttcctgcaggagcatggcccggaagttctggaggttccgggcatgactgatctcgtggagtactatgatccggggc
cctcccctaacagcaacaaccccgacgatgtggccatgcggctggccttcatcggggacgagatggaagtgagatggatg
cttccccgcgttggcgagctgcccgggatggccatgtacagcttggcttttacctacaaccagacaggcctgagaggtgt
tcttcgaagtctcatggacggactcactaacctcagggagaacataaggatctggagcttcctgaccttcaggaacaggg
gcctggatttggagccttccctgcccgccacccagccccagagccgatccagcagatgcagtgactcaccacctccggcc
gggctggtcaggtcctgcccactcccagctgccccgtccggccctcacgactga
>gnl|bcl2dbcds|A3KND0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Xenopus laevis GN=BMF (length=354 residues).
atggatgagttagatgatgatgtgttttatcctgatgcatttggatacccagatcagaccataacttcctcctcattatt
caaccagagccagtcctacacatgcctgctcggccgctttcacctcttcccattttctcactgttgtggccctggatgca
ggggcacagacaacgaggacaaggctacacagactctggggtcaccttctcaggacatcatgctaccatgtggggtgtct
gaaactcctcaaagacttttttatggtaaggaggccttatcagagatataccgtatgtttaatgcttcaatcccacatga
atctcatagattccatagactttttcaagtatga
>gnl|bcl2dbcds|A0A3B5L9R9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Xiphophorus couchianus GN=BAD (length=450 residues).
atggacacaaaatttacaatttcagacggtgagtcggacccatcggaagacgtagaggaaagaggagacttgcagctaat
gcaagaaaaggagaagccgctcagtcaacgccacaccctcacgcttcctgagctccgatctacaaaggtggagctgcagg
ccaggggggaagaggaggtcgggacccccactgagggctttccattcaggggccgatctttatcagctcctccctccctg
tgggctgccaagaagtacggccggcagcttcggaggatgagcgatgagtttgtcaacctgcttgataaaggggaaatgag
gaatgtgagcagtgatgggtcgaacagaccgattcaccactccaggagctggtggagctacctcttcagtcaccaggaga
cagagggagagaacaaccaccacgaaaaccacgcctcccgcaccgagtag
>gnl|bcl2dbcds|A0A3B5M375_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Xiphophorus couchianus GN=BCL2L11 (length=630 residues).
atgctcacggtgacgctctgttcatccaacagaccgccaaatctgctcgatggctcgaccgaagtaacgccagcagaggg
gaccggcggagacccagcatcctcagcgcgaacaccacgttcctcgaagcacacagagcggagccgcgcgccgcaggcgg
gcgcctccacagccgggggaggaggaggaggagaaggagaaggacgaagaggggagccggactcggactcgccgccttgc
tccgtgagcccggccagtttagacgtctttcgaagcaggtcgatatttcgccctacccgccgctcatccagcggatactt
ctcctttgactgcgactcgctgccgagctccccgctctctccgcacccagtgacggctgacaaagccacgcagaccccca
gcctcaccggccaggtgatgaaccacgccctgcagcgaatggctgtggagcacggtggactcgggctgcagggtgagcaa
acttcagtcctccctcctcccccttctgaaacatcaacaacatgggaacaaatagctgttaatatcggcccagttttatt
tatcaggccgataccgatgttagtgccgatatatcatgcatccacgttaagaatctcagctctcgagtaa
>gnl|bcl2dbcds|A0A3B5Q2N7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Xiphophorus maculatus GN=BAD (length=501 residues).
atggacacaaaatttacaatttcagacggtgagtcggacccatcggaagacgtagaggaaagaggagacttgcagctaat
gcaagaaaaggagaagccgctcagtcaacgccacaccctcacgcttcctgagctccgatctacaacaggtcgggtgagac
tgaactcggagtccatcgcttccaccatctccagagaggtggagctgcaggcaaggggggaagaggaggttgggaccccc
actgagggctttccattcaggggccgatctttatcagctcctccctccttgtgggctgccaagaagtacggccggcagct
tcggaggatgagtgatgagtttgtcaacctgcttgataaaggggaaatgaggaatgtgagcagtgatgggtcgaacagac
cgattcaccactccaggagctggtggagctacctcttcagtcaccaggagacagagggagagaacaaccaccacgaaaac
cacgcctcccgcaccgagtag
>gnl|bcl2dbcds|A0A3B5QAM1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Xiphophorus maculatus GN=BCL2L11 (length=735 residues).
atgcactctttaagaccgccaaatctgctcgatggctcgaccgaagtaacgccagcagaggggaccggcggagacccagc
atcctcagcgcgaacaccacgttcctcgaagcacacagagcggagccgcgcgccgcaggcgggcgcctccacagccgggg
gaggaggaggaggagagggaggaggacgaagaggggagccggactcggactcgccgccttgctccgtgagcccggccagt
ttagacgtctttcgaagcaggtcgatatttcgccctccccgccgctcgtccagcggatacttctcctttgactgcgactc
gctgccgagctccccgctctctccgcacccagtgacggctgacaaagccacgcagacccccagcctcaccggccaggtga
tgaaccacgccctgcagcgaatggctgtggagcacggtggactcggcctgcacgggcagtctcccaaccactatagcact
attaacgcggcacgggatatgcagtcagaaacctatggtcgtcaactccgtgctattggagatgagtacaacaacctcct
gatgggaaggaggatggcgagaggacaccaacggaatatagtccctctaaacctgatgccgcacatccagcaagagcctg
ttgccatgctttgtgtctgccttctgctcctcctggtcggacgaataatgtacatgcaaggcaacacaagcagccatgac
cactctcaggtttag
>gnl|bcl2dbcds|A0A3B5QAM1_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Xiphophorus maculatus GN=BCL2L11 (length=753 residues).
atgctcacggtgacgctctgttcatccaacagaccgccaaatctgctcgatggctcgaccgaagtaacgccagcagaggg
gaccggcggagacccagcatcctcagcgcgaacaccacgttcctcgaagcacacagagcggagccgcgcgccgcaggcgg
gcgcctccacagccgggggaggaggaggaggagagggaggaggacgaagaggggagccggactcggactcgccgccttgc
tccgtgagcccggccagtttagacgtctttcgaagcaggtcgatatttcgccctccccgccgctcgtccagcggatactt
ctcctttgactgcgactcgctgccgagctccccgctctctccgcacccagtgacggctgacaaagccacgcagaccccca
gcctcaccggccaggtgatgaaccacgccctgcagcgaatggctgtggagcacggtggactcggcctgcacgggcagtct
cccaaccactatagcactattaacgcggcacgggatatgcagtcagaaacctatggtcgtcaactccgtgctattggaga
tgagtacaacaacctcctgatgggaaggaggatggcgagaggacaccaacggaatatagtccctctaaacctgatgccgc
acatccagcaagagcctgttgccatgctttgtgtctgccttctgctcctcctggtcggacgaataatgtacatgcaaggc
aacacaagcagccatgaccactctcaggtttag
>gnl|bcl2dbcds|A0A3B5QK08_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Xiphophorus maculatus GN=BMF (length=483 residues).
atggaggatgaggaggatgatgtgtttgagccagatcccaactgctggcgcacacccttcagggagataaagtgcgaaga
ccggggcacgcagacgcccggtcctggccaggcactacacaacggcatgctgccctgtggtgttgtggaggagcccagac
gactattctacggtaacgcaggttttcgattgcacttcccagcgcattttgaacttgtcggggattttgacgcgaggcaa
caagaggagcagaacaggatggagcagttacccctgcaccagccggctgcactcagcttggaggcctccatcgggcagaa
acttcagctgataggcgaccagtttcaccgggaacacttacaacagtatcaacaaaaccaaaggaatcaggggccgctgt
ggtggcgcatgactgcagctcttctcagcctcctgtttgatagggggtttattgctggaggaggtggagcaggacggagg
tga
>gnl|bcl2dbcds|A0A3B5QK08_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Xiphophorus maculatus GN=BMF (length=483 residues).
atggaggatgaggaggatgatgtgtttgagccagatcccaactgctggcgcacacccttcagggagataaagtgcgaaga
ccggggcacgcagacgcccggtcctggccaggcactacacaacggcatgctgccctgtggtgttgtggaggagcccagac
gactattctacggtaacgcaggttttcgattgcacttcccagcgcattttgaacttgtcggggattttgacgcgaggcaa
caagaggagcagaacaggatggagcagttacccctgcaccagccggctgcactcagcttggaggcctccatcgggcagaa
acttcagctgataggcgaccagtttcaccgggaacacttacaacagtatcaacaaaaccaaaggaatcaggggccgctgt
ggtggcgcatgactgcagctcttctcagcctcctgtttgatagggggtttattgctggaggaggtggagcaggacggagg
tga
>gnl|bcl2dbcds|A0A3B5RFA9_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Xiphophorus maculatus GN=PMAIP1 (length=123 residues).
cttcctgccgctgctgagctctgcgctcgcgagctgcggcaagttggagataaattgtactggagatacaaactcctgga
aatgctgctcaagaactatgagactctcaacaaaataaaatga
© 1998-2020Legal notice