Dataset for CDS classical BH3-containing proteins of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

567 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


O61667_EGL1-01          --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3B1K1X5_BMF-01       --------------------------------------------------
A0A3B4CNJ8_BMF-01       --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
A0A3P9A5G8_BAD-02       --------------------------------------------------
A0A3P9A5G8_BAD-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A0A3B1JLM2_BAD-01       --------------------------------------------------
A0A3B4DUY7_BAD-01       --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
A0A3Q2Y0E4_BAD-01       --------------------------------------------------
A0A3B3BQF7_BAD-01       --------------------------------------------------
A0A3P9HNZ2_BAD-01       --------------------------------------------------
A0A3B3HDU2_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-02       --------------------------------------------------
A0A3Q3AEL8_BAD-01       --------------------------------------------------
A0A3Q3AEL8_BAD-02       --------------------------------------------------
A0A3Q2QC80_BAD-01       --------------------------------------------------
A0A3Q2D5S0_BAD-01       --------------------------------------------------
A0A3B5L9R9_BAD-01       --------------------------------------------------
A0A3B5Q2N7_BAD-01       --------------------------------------------------
A0A3P9Q7C3_BAD-01       --------------------------------------------------
A0A3B3YFR1_BAD-01       --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A3B3UA11_BAD-01       --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A3P9B2E4_BAD-01       --------------------------------------------------
A0A3Q4GGN3_BAD-01       --------------------------------------------------
A0A3P8QRJ7_BAD-01       --------------------------------------------------
A0A3Q3C680_BAD-01       --------------------------------------------------
A0A3B4GXJ6_BAD-01       --------------------------------------------------
A0A3Q0QNQ2_BAD-02       --------------------------------------------------
A0A3Q0QNQ2_BAD-01       --------------------------------------------------
A0A3Q3WTY4_BAD-01       --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
A0A3P8WI83_BAD-02       --------------------------------------------------
A0A3P8WI83_BAD-01       --------------------------------------------------
A0A3Q3FKT9_BAD-03       --------------------------------------------------
A0A3Q3FKT9_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-02       --------------------------------------------------
A0A3Q3R5S3_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-02       --------------------------------------------------
A0A3B5BAL2_BAD-01       --------------------------------------------------
A0A3Q1GWH9_BAD-01       --------------------------------------------------
A0A3Q1CPU7_BAD-01       --------------------------------------------------
A0A3P8TWH6_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
A0A3B4VFC5_BAD-01       --------------------------------------------------
A0A3B4W9T1_BAD-01       --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8ZIE7_BMF-01       --------------------------------------------------
A0A3B4B6Y3_BMF-01       --------------------------------------------------
A0A3Q2CXC4_BMF-02       --------------------------------------------------
A0A3Q2CXC4_BMF-01       --------------------------------------------------
A0A3B5QK08_BMF-02       --------------------------------------------------
A0A3B5QK08_BMF-01       --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
A0A3B3WU80_BMF-01       --------------------------------------------------
A0A3P9Q8E2_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-02       --------------------------------------------------
A0A3Q2PJX9_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-03       --------------------------------------------------
A0A3Q2YCX7_BMF-01       --------------------------------------------------
A0A3Q2YCX7_BMF-02       --------------------------------------------------
A0A3B3CGR9_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-04       --------------------------------------------------
A0A3P9K487_BMF-02       --------------------------------------------------
A0A3P9K487_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-03       --------------------------------------------------
A0A3B3HAU1_BMF-02       --------------------------------------------------
A0A3B3HAU1_BMF-04       --------------------------------------------------
A0A3Q3GUU5_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-02       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A3Q4G1I4_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-02       --------------------------------------------------
A0A3B4ETH0_BMF-01       --------------------------------------------------
A0A3Q3C5V2_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-03       --------------------------------------------------
A0A3P8UA78_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-02       --------------------------------------------------
A0A3Q3VLX6_BMF-01       --------------------------------------------------
A0A3Q2ZA20_BMF-01       --------------------------------------------------
A0A3Q3RVI2_BMF-02       --------------------------------------------------
A0A3Q3RVI2_BMF-01       --------------------------------------------------
A0A3Q1IPR4_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-02       --------------------------------------------------
A0A3Q1FVH7_BMF-01       --------------------------------------------------
A0A3Q1FVH7_BMF-02       --------------------------------------------------
A0A3B5B8F6_BMF-01       --------------------------------------------------
A0A3Q1D1K3_BMF-01       --------------------------------------------------
A0A3P8RKY9_BMF-01       --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
A0A3B4U5H8_BMF-01       --------------------------------------------------
A0A3B4WM88_BMF-01       --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A452QUG1_BIK-01       --------------------------------------------------
A0A452V3L2_BIK-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
A0A452H3N6_BMF-01       --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
A0A493T7X1_BMF-01       --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-02       --------------------------------------------------
A0A3Q2UCA0_BMF-01       --------------------------------------------------
A0A493T7X1_BMF-02       --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-03       --------------------------------------------------
A0A3Q2UCA0_BMF-04       --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           --------------------------------------------------
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A286XXB0_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-03       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           --------------------------------------------------
G1PAU1_BMF-01           --------------------------------------------------
L8IXF5_BMF-01           --------------------------------------------------
Q05KI3_BMF-02           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
A0A452F2E0_BMF-02       --------------------------------------------------
A0A452F2E0_BMF-01       --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
A0A287CXH0_BMF-01       --------------------------------------------------
A0A287CXH0_BMF-02       --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       --------------------------------------------------
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       --------------------------------------------------
M3YAD5_BMF-01           --------------------------------------------------
U6CSY8_BMF-01           --------------------------------------------------
A0A452SED0_BMF-01       --------------------------------------------------
A0A384D070_BMF-01       --------------------------------------------------
J9PB65_BMF-04           --------------------------------------------------
J9PB65_BMF-03           --------------------------------------------------
J9PB65_BMF-02           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
A0A2K5KGP2_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
F7CM09_BMF-03           --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
F7CM09_BMF-01           --------------------------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K5Z4A9_BMF-02       --------------------------------------------------
A0A2K5MJW4_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K5Z4A9_BMF-01       --------------------------------------------------
A0A2K5KGP2_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-03       --------------------------------------------------
A0A2K6L919_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-02       --------------------------------------------------
A0A2K6TW78_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-03       --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-02       --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-01       --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-01       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
G3VRY3_BAD-02           --------------------------------------------------
G3VRY3_BAD-01           --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
Q61337_BAD-01           --------------------------------------------------
Q61337_BAD-05           --------------------------------------------------
O35147_BAD-01           --------------------------------------------------
Q6P7C5_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A8MXU7_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2K5VCA9_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K5M0A7_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
A0A452ER54_BAD-01       --------------------------------------------------
A0A452ER54_BAD-02       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
A0A287CT05_BAD-02       --------------------------------------------------
A0A287CT05_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2R8Z688_BAD-03       --------------------------------------------------
A8MXU7_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A2K5VCA9_BAD-03       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K5HKU7_BAD-02       --------------------------------------------------
A0A2K6N196_BAD-02       --------------------------------------------------
A0A2K6PUL3_BAD-02       --------------------------------------------------
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2K5HKU7_BAD-01       --------------------------------------------------
A0A2K6N196_BAD-01       --------------------------------------------------
A0A2K6PUL3_BAD-01       --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
A0A2R8Z688_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
A0A452RJM6_BAD-01       --------------------------------------------------
G1MI17_BAD-01           --------------------------------------------------
A0A384DJL2_BAD-01       --------------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
F7FUT7_BIK-02           --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
G3UH24_HRK-01           --------------------------------------------------
A0A452DXE5_HRK-01       --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          atgggtgtgcggccccgcggcgccccctggcgcccggagccggcgggggg
F7G1G0_HRK-01           --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-03          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          --------------------------------------------------
F1RM01_BBC3-02          --------------------------------------------------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B1IH05_BAD-01       --------------------------------------------------
A0A3B4CPH6_BAD-01       --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
A0A3B4UNJ0_BMF-01       --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B3QX41_BAD-01       --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
A0A3P8Y761_BAD-01       --------------------------------------------------
A0A3B3RH63_BMF-01       --------------------------------------------------
A0A452IFQ4_BAD-01       --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       gaaactcccgatatagagccagggctctcggggctcctgaggctttccgc
C1KGB6_BCL2L11-01       gaaactcccgatatagagccagggctctcggggctcctgaggctttccgc
C1KGB6_BCL2L11-02       gaaactcccgatatagagccagggctctcggggctcctgaggctttccgc
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3B1K1X5_BMF-01       --------------------------------------------------
A0A3B4CNJ8_BMF-01       --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
A0A3P9A5G8_BAD-02       --------------------------------------------------
A0A3P9A5G8_BAD-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A0A3B1JLM2_BAD-01       --------------------------------------------------
A0A3B4DUY7_BAD-01       --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
A0A3Q2Y0E4_BAD-01       --------------------------------------------------
A0A3B3BQF7_BAD-01       --------------------------------------------------
A0A3P9HNZ2_BAD-01       --------------------------------------------------
A0A3B3HDU2_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-02       --------------------------------------------------
A0A3Q3AEL8_BAD-01       --------------------------------------------------
A0A3Q3AEL8_BAD-02       --------------------------------------------------
A0A3Q2QC80_BAD-01       --------------------------------------------------
A0A3Q2D5S0_BAD-01       --------------------------------------------------
A0A3B5L9R9_BAD-01       --------------------------------------------------
A0A3B5Q2N7_BAD-01       --------------------------------------------------
A0A3P9Q7C3_BAD-01       --------------------------------------------------
A0A3B3YFR1_BAD-01       --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A3B3UA11_BAD-01       --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A3P9B2E4_BAD-01       --------------------------------------------------
A0A3Q4GGN3_BAD-01       --------------------------------------------------
A0A3P8QRJ7_BAD-01       --------------------------------------------------
A0A3Q3C680_BAD-01       --------------------------------------------------
A0A3B4GXJ6_BAD-01       --------------------------------------------------
A0A3Q0QNQ2_BAD-02       --------------------------------------------------
A0A3Q0QNQ2_BAD-01       --------------------------------------------------
A0A3Q3WTY4_BAD-01       --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
A0A3P8WI83_BAD-02       --------------------------------------------------
A0A3P8WI83_BAD-01       --------------------------------------------------
A0A3Q3FKT9_BAD-03       --------------------------------------------------
A0A3Q3FKT9_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-02       --------------------------------------------------
A0A3Q3R5S3_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-02       --------------------------------------------------
A0A3B5BAL2_BAD-01       --------------------------------------------------
A0A3Q1GWH9_BAD-01       --------------------------------------------------
A0A3Q1CPU7_BAD-01       --------------------------------------------------
A0A3P8TWH6_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
A0A3B4VFC5_BAD-01       --------------------------------------------------
A0A3B4W9T1_BAD-01       --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8ZIE7_BMF-01       --------------------------------------------------
A0A3B4B6Y3_BMF-01       --------------------------------------------------
A0A3Q2CXC4_BMF-02       --------------------------------------------------
A0A3Q2CXC4_BMF-01       --------------------------------------------------
A0A3B5QK08_BMF-02       --------------------------------------------------
A0A3B5QK08_BMF-01       --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
A0A3B3WU80_BMF-01       --------------------------------------------------
A0A3P9Q8E2_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-02       --------------------------------------------------
A0A3Q2PJX9_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-03       --------------------------------------------------
A0A3Q2YCX7_BMF-01       --------------------------------------------------
A0A3Q2YCX7_BMF-02       --------------------------------------------------
A0A3B3CGR9_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-04       --------------------------------------------------
A0A3P9K487_BMF-02       --------------------------------------------------
A0A3P9K487_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-03       --------------------------------------------------
A0A3B3HAU1_BMF-02       --------------------------------------------------
A0A3B3HAU1_BMF-04       --------------------------------------------------
A0A3Q3GUU5_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-02       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A3Q4G1I4_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-02       --------------------------------------------------
A0A3B4ETH0_BMF-01       --------------------------------------------------
A0A3Q3C5V2_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-03       --------------------------------------------------
A0A3P8UA78_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-02       --------------------------------------------------
A0A3Q3VLX6_BMF-01       --------------------------------------------------
A0A3Q2ZA20_BMF-01       --------------------------------------------------
A0A3Q3RVI2_BMF-02       --------------------------------------------------
A0A3Q3RVI2_BMF-01       --------------------------------------------------
A0A3Q1IPR4_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-02       --------------------------------------------------
A0A3Q1FVH7_BMF-01       --------------------------------------------------
A0A3Q1FVH7_BMF-02       --------------------------------------------------
A0A3B5B8F6_BMF-01       --------------------------------------------------
A0A3Q1D1K3_BMF-01       --------------------------------------------------
A0A3P8RKY9_BMF-01       --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
A0A3B4U5H8_BMF-01       --------------------------------------------------
A0A3B4WM88_BMF-01       --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A452QUG1_BIK-01       --------------------------------------------------
A0A452V3L2_BIK-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
A0A452H3N6_BMF-01       --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
A0A493T7X1_BMF-01       --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-02       --------------------------------------------------
A0A3Q2UCA0_BMF-01       --------------------------------------------------
A0A493T7X1_BMF-02       --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-03       --------------------------------------------------
A0A3Q2UCA0_BMF-04       --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           --------------------------------------------------
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A286XXB0_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-03       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           --------------------------------------------------
G1PAU1_BMF-01           --------------------------------------------------
L8IXF5_BMF-01           --------------------------------------------------
Q05KI3_BMF-02           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
A0A452F2E0_BMF-02       --------------------------------------------------
A0A452F2E0_BMF-01       --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
A0A287CXH0_BMF-01       --------------------------------------------------
A0A287CXH0_BMF-02       --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       --------------------------------------------------
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       --------------------------------------------------
M3YAD5_BMF-01           --------------------------------------------------
U6CSY8_BMF-01           --------------------------------------------------
A0A452SED0_BMF-01       --------------------------------------------------
A0A384D070_BMF-01       --------------------------------------------------
J9PB65_BMF-04           --------------------------------------------------
J9PB65_BMF-03           --------------------------------------------------
J9PB65_BMF-02           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
A0A2K5KGP2_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
F7CM09_BMF-03           --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
F7CM09_BMF-01           --------------------------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K5Z4A9_BMF-02       --------------------------------------------------
A0A2K5MJW4_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K5Z4A9_BMF-01       --------------------------------------------------
A0A2K5KGP2_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-03       --------------------------------------------------
A0A2K6L919_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-02       --------------------------------------------------
A0A2K6TW78_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-03       --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-02       --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-01       --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-01       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
G3VRY3_BAD-02           --------------------------------------------------
G3VRY3_BAD-01           --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
Q61337_BAD-01           --------------------------------------------------
Q61337_BAD-05           --------------------------------------------------
O35147_BAD-01           --------------------------------------------------
Q6P7C5_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A8MXU7_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2K5VCA9_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K5M0A7_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
A0A452ER54_BAD-01       --------------------------------------------------
A0A452ER54_BAD-02       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
A0A287CT05_BAD-02       --------------------------------------------------
A0A287CT05_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2R8Z688_BAD-03       --------------------------------------------------
A8MXU7_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A2K5VCA9_BAD-03       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K5HKU7_BAD-02       --------------------------------------------------
A0A2K6N196_BAD-02       --------------------------------------------------
A0A2K6PUL3_BAD-02       --------------------------------------------------
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2K5HKU7_BAD-01       --------------------------------------------------
A0A2K6N196_BAD-01       --------------------------------------------------
A0A2K6PUL3_BAD-01       --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
A0A2R8Z688_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
A0A452RJM6_BAD-01       --------------------------------------------------
G1MI17_BAD-01           --------------------------------------------------
A0A384DJL2_BAD-01       --------------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
F7FUT7_BIK-02           --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
G3UH24_HRK-01           --------------------------------------------------
A0A452DXE5_HRK-01       --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          cggcggggctgggggccgggcgaggggcacggccgggcgggcgcgtgcca
F7G1G0_HRK-01           -atgt---------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          -atgc------------------aggggctgcccgggcatgtccctgtc-
J9NTK9_BBC3-03          -at-----------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      -atgaaattgagtgt--------gggggctgcccgggcatgttcgtgcc-
A0A3Q2GWE8_BBC3-01      -gtgagagtcagcgc--------aggggctgcccgggcatgtctgtgcc-
A0A3Q2GWE8_BBC3-02      -gtgagagtcagcgc--------aggggctgcccgggcatgtctgtgcc-
F1RM01_BBC3-04          -atgaccgtgtttgt-------gggaggttgtgctggccagccagtgcct
F1RM01_BBC3-02          --------------------------------------------------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          -atgccctgtgtgac-----------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      -atgaaatttggtgc--------ggggtctgcccgggcatgtccctgcc-
A0A2K6STD6_BBC3-02      -atgaaatgtggcat--------ggggtctgcctgggcatgtccatgcc-
A0A2K5F6X4_BBC3-02      ----aaatgtggcgt--------ggggtctgcctgggcatgtccatgcc-
A0A2R8MW85_BBC3-02      -atgaaatgtggcgt--------ggggtctgcctgggcatgtccatgcc-
A0A2K5QNS7_BBC3-02      -atgaaatgtggcgt--------ggggtctgcctgggcatgtccatgcc-
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      -ataaaatttggcgt--------ggggtctgcccgggcatgtccatgcc-
A0A2K5P2T8_BBC3-03      -ataaaatttggcgt--------ggggtctgcccgggcatgtccatgcc-
A0A2K5V8J3_BBC3-03      -ataaaatttggcgt--------ggggtctgcccgggcatgtccatgcc-
A0A2K6ASP2_BBC3-03      -ataaaatttggcgt--------ggggtctgcccgggcatgtccatgcc-
A0A2I3N2Z9_BBC3-03      -ataaaatttggcgt--------ggggtctgcccgggcatgtccatgcc-
A0A2R8MW85_BBC3-03      -aggaagccgcccgccctccaccgccgccccctccggcgtgttcatgccc
A0A2I3HWI8_BBC3-03      -atgaaatttggcat--------ggggtctgcccgggcatgtccatgcc-
A0A2R9BZA9_BBC3-01      -atgaaatttggcat--------ggggtctgcccaggcatgtccatgcc-
A0A2I3RGH5_BBC3-03      -atgaaatttggcat--------ggggtctgcccaggcatgtccatgcc-
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          -atgaaatttggcat--------ggggtctgcccaggcatgtccatgcc-
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          -atgaaatttggcat--------ggggtctgcccaggcatgtccatgcc-
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B1IH05_BAD-01       --------------------------------------------------
A0A3B4CPH6_BAD-01       --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
A0A3B4UNJ0_BMF-01       --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B3QX41_BAD-01       --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
A0A3P8Y761_BAD-01       --------------------------------------------------
A0A3B3RH63_BMF-01       --------------------------------------------------
A0A452IFQ4_BAD-01       --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       gggcggcagcggcggggtctggtttacactgtattcggagcgccccctct
C1KGB6_BCL2L11-01       gggcggcagcggcggggtctggtttacactgtattcggagcgccccctct
C1KGB6_BCL2L11-02       gggcggcagcggcggggtctggtttacactgtattcggagcgccccctct
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3B1K1X5_BMF-01       --------------------------------------------------
A0A3B4CNJ8_BMF-01       --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
A0A3P9A5G8_BAD-02       --------------------------------------------------
A0A3P9A5G8_BAD-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A0A3B1JLM2_BAD-01       --------------------------------------------------
A0A3B4DUY7_BAD-01       --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
A0A3Q2Y0E4_BAD-01       --------------------------------------------------
A0A3B3BQF7_BAD-01       --------------------------------------------------
A0A3P9HNZ2_BAD-01       --------------------------------------------------
A0A3B3HDU2_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-02       --------------------------------------------------
A0A3Q3AEL8_BAD-01       --------------------------------------------------
A0A3Q3AEL8_BAD-02       --------------------------------------------------
A0A3Q2QC80_BAD-01       --------------------------------------------------
A0A3Q2D5S0_BAD-01       --------------------------------------------------
A0A3B5L9R9_BAD-01       --------------------------------------------------
A0A3B5Q2N7_BAD-01       --------------------------------------------------
A0A3P9Q7C3_BAD-01       --------------------------------------------------
A0A3B3YFR1_BAD-01       --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A3B3UA11_BAD-01       --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A3P9B2E4_BAD-01       --------------------------------------------------
A0A3Q4GGN3_BAD-01       --------------------------------------------------
A0A3P8QRJ7_BAD-01       --------------------------------------------------
A0A3Q3C680_BAD-01       --------------------------------------------------
A0A3B4GXJ6_BAD-01       --------------------------------------------------
A0A3Q0QNQ2_BAD-02       --------------------------------------------------
A0A3Q0QNQ2_BAD-01       --------------------------------------------------
A0A3Q3WTY4_BAD-01       --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
A0A3P8WI83_BAD-02       --------------------------------------------------
A0A3P8WI83_BAD-01       --------------------------------------------------
A0A3Q3FKT9_BAD-03       --------------------------------------------------
A0A3Q3FKT9_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-02       --------------------------------------------------
A0A3Q3R5S3_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-02       --------------------------------------------------
A0A3B5BAL2_BAD-01       --------------------------------------------------
A0A3Q1GWH9_BAD-01       --------------------------------------------------
A0A3Q1CPU7_BAD-01       --------------------------------------------------
A0A3P8TWH6_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
A0A3B4VFC5_BAD-01       --------------------------------------------------
A0A3B4W9T1_BAD-01       --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8ZIE7_BMF-01       --------------------------------------------------
A0A3B4B6Y3_BMF-01       --------------------------------------------------
A0A3Q2CXC4_BMF-02       --------------------------------------------------
A0A3Q2CXC4_BMF-01       --------------------------------------------------
A0A3B5QK08_BMF-02       --------------------------------------------------
A0A3B5QK08_BMF-01       --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
A0A3B3WU80_BMF-01       --------------------------------------------------
A0A3P9Q8E2_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-02       --------------------------------------------------
A0A3Q2PJX9_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-03       --------------------------------------------------
A0A3Q2YCX7_BMF-01       --------------------------------------------------
A0A3Q2YCX7_BMF-02       --------------------------------------------------
A0A3B3CGR9_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-04       --------------------------------------------------
A0A3P9K487_BMF-02       --------------------------------------------------
A0A3P9K487_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-03       --------------------------------------------------
A0A3B3HAU1_BMF-02       --------------------------------------------------
A0A3B3HAU1_BMF-04       --------------------------------------------------
A0A3Q3GUU5_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-02       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A3Q4G1I4_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-02       --------------------------------------------------
A0A3B4ETH0_BMF-01       --------------------------------------------------
A0A3Q3C5V2_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-03       --------------------------------------------------
A0A3P8UA78_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-02       --------------------------------------------------
A0A3Q3VLX6_BMF-01       --------------------------------------------------
A0A3Q2ZA20_BMF-01       --------------------------------------------------
A0A3Q3RVI2_BMF-02       --------------------------------------------------
A0A3Q3RVI2_BMF-01       --------------------------------------------------
A0A3Q1IPR4_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-02       --------------------------------------------------
A0A3Q1FVH7_BMF-01       --------------------------------------------------
A0A3Q1FVH7_BMF-02       --------------------------------------------------
A0A3B5B8F6_BMF-01       --------------------------------------------------
A0A3Q1D1K3_BMF-01       --------------------------------------------------
A0A3P8RKY9_BMF-01       --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
A0A3B4U5H8_BMF-01       --------------------------------------------------
A0A3B4WM88_BMF-01       --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A452QUG1_BIK-01       --------------------------------------------------
A0A452V3L2_BIK-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
A0A452H3N6_BMF-01       --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
A0A493T7X1_BMF-01       --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-02       --------------------------------------------------
A0A3Q2UCA0_BMF-01       --------------------------------------------------
A0A493T7X1_BMF-02       --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-03       --------------------------------------------------
A0A3Q2UCA0_BMF-04       --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           --------------------------------------------------
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A286XXB0_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-03       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           --------------------------------------------------
G1PAU1_BMF-01           --------------------------------------------------
L8IXF5_BMF-01           --------------------------------------------------
Q05KI3_BMF-02           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
A0A452F2E0_BMF-02       --------------------------------------------------
A0A452F2E0_BMF-01       --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
A0A287CXH0_BMF-01       --------------------------------------------------
A0A287CXH0_BMF-02       --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       --------------------------------------------------
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       --------------------------------------------------
M3YAD5_BMF-01           --------------------------------------------------
U6CSY8_BMF-01           --------------------------------------------------
A0A452SED0_BMF-01       --------------------------------------------------
A0A384D070_BMF-01       --------------------------------------------------
J9PB65_BMF-04           --------------------------------------------------
J9PB65_BMF-03           --------------------------------------------------
J9PB65_BMF-02           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
A0A2K5KGP2_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
F7CM09_BMF-03           --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
F7CM09_BMF-01           --------------------------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K5Z4A9_BMF-02       --------------------------------------------------
A0A2K5MJW4_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K5Z4A9_BMF-01       --------------------------------------------------
A0A2K5KGP2_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-03       --------------------------------------------------
A0A2K6L919_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-02       --------------------------------------------------
A0A2K6TW78_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-03       --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-02       --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-01       --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-01       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
G3VRY3_BAD-02           --------------------------------------------------
G3VRY3_BAD-01           --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
Q61337_BAD-01           --------------------------------------------------
Q61337_BAD-05           --------------------------------------------------
O35147_BAD-01           --------------------------------------------------
Q6P7C5_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A8MXU7_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2K5VCA9_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K5M0A7_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
A0A452ER54_BAD-01       --------------------------------------------------
A0A452ER54_BAD-02       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
A0A287CT05_BAD-02       --------------------------------------------------
A0A287CT05_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2R8Z688_BAD-03       --------------------------------------------------
A8MXU7_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A2K5VCA9_BAD-03       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K5HKU7_BAD-02       --------------------------------------------------
A0A2K6N196_BAD-02       --------------------------------------------------
A0A2K6PUL3_BAD-02       --------------------------------------------------
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2K5HKU7_BAD-01       --------------------------------------------------
A0A2K6N196_BAD-01       --------------------------------------------------
A0A2K6PUL3_BAD-01       --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
A0A2R8Z688_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
A0A452RJM6_BAD-01       --------------------------------------------------
G1MI17_BAD-01           --------------------------------------------------
A0A384DJL2_BAD-01       --------------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
F7FUT7_BIK-02           --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
G3UH24_HRK-01           --------------------------------------------------
A0A452DXE5_HRK-01       --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          ctgggcgtgttgttttccaggggctcggcgtgggcctccgcagtggtgag
F7G1G0_HRK-01           --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-03          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          tgggtcagcccccccaccatggggggggcgtgtctcttggggccttctca
F1RM01_BBC3-02          -----------------------------atggcttctggagc-------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      ccggggtgagtgtgcgcgccctgaatcctcgccggcggcgatcggccagg
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B1IH05_BAD-01       --------------------------------------------------
A0A3B4CPH6_BAD-01       --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
A0A3B4UNJ0_BMF-01       --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B3QX41_BAD-01       --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
A0A3P8Y761_BAD-01       --------------------------------------------------
A0A3B3RH63_BMF-01       --------------------------------------------------
A0A452IFQ4_BAD-01       --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       gttccacgcgcactcctaggccaccgctggttggggaagaggagaggtta
C1KGB6_BCL2L11-01       gttccacgcgcactcctaggccaccgctggttggggaagaggagaggtta
C1KGB6_BCL2L11-02       gttccacgcgcactcctaggccaccgctggttggggaagaggagaggtta
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3B1K1X5_BMF-01       --------------------------------------------------
A0A3B4CNJ8_BMF-01       --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
A0A3P9A5G8_BAD-02       --------------------------------------------------
A0A3P9A5G8_BAD-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A0A3B1JLM2_BAD-01       --------------------------------------------------
A0A3B4DUY7_BAD-01       --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
A0A3Q2Y0E4_BAD-01       --------------------------------------------------
A0A3B3BQF7_BAD-01       --------------------------------------------------
A0A3P9HNZ2_BAD-01       --------------------------------------------------
A0A3B3HDU2_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-02       --------------------------------------------------
A0A3Q3AEL8_BAD-01       --------------------------------------------------
A0A3Q3AEL8_BAD-02       --------------------------------------------------
A0A3Q2QC80_BAD-01       --------------------------------------------------
A0A3Q2D5S0_BAD-01       --------------------------------------------------
A0A3B5L9R9_BAD-01       --------------------------------------------------
A0A3B5Q2N7_BAD-01       --------------------------------------------------
A0A3P9Q7C3_BAD-01       --------------------------------------------------
A0A3B3YFR1_BAD-01       --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A3B3UA11_BAD-01       --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A3P9B2E4_BAD-01       --------------------------------------------------
A0A3Q4GGN3_BAD-01       --------------------------------------------------
A0A3P8QRJ7_BAD-01       --------------------------------------------------
A0A3Q3C680_BAD-01       --------------------------------------------------
A0A3B4GXJ6_BAD-01       --------------------------------------------------
A0A3Q0QNQ2_BAD-02       --------------------------------------------------
A0A3Q0QNQ2_BAD-01       --------------------------------------------------
A0A3Q3WTY4_BAD-01       --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
A0A3P8WI83_BAD-02       --------------------------------------------------
A0A3P8WI83_BAD-01       --------------------------------------------------
A0A3Q3FKT9_BAD-03       --------------------------------------------------
A0A3Q3FKT9_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-02       --------------------------------------------------
A0A3Q3R5S3_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-02       --------------------------------------------------
A0A3B5BAL2_BAD-01       --------------------------------------------------
A0A3Q1GWH9_BAD-01       --------------------------------------------------
A0A3Q1CPU7_BAD-01       --------------------------------------------------
A0A3P8TWH6_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
A0A3B4VFC5_BAD-01       --------------------------------------------------
A0A3B4W9T1_BAD-01       --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8ZIE7_BMF-01       --------------------------------------------------
A0A3B4B6Y3_BMF-01       --------------------------------------------------
A0A3Q2CXC4_BMF-02       --------------------------------------------------
A0A3Q2CXC4_BMF-01       --------------------------------------------------
A0A3B5QK08_BMF-02       --------------------------------------------------
A0A3B5QK08_BMF-01       --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
A0A3B3WU80_BMF-01       --------------------------------------------------
A0A3P9Q8E2_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-02       --------------------------------------------------
A0A3Q2PJX9_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-03       --------------------------------------------------
A0A3Q2YCX7_BMF-01       --------------------------------------------------
A0A3Q2YCX7_BMF-02       --------------------------------------------------
A0A3B3CGR9_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-04       --------------------------------------------------
A0A3P9K487_BMF-02       --------------------------------------------------
A0A3P9K487_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-03       --------------------------------------------------
A0A3B3HAU1_BMF-02       --------------------------------------------------
A0A3B3HAU1_BMF-04       --------------------------------------------------
A0A3Q3GUU5_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-02       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A3Q4G1I4_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-02       --------------------------------------------------
A0A3B4ETH0_BMF-01       --------------------------------------------------
A0A3Q3C5V2_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-03       --------------------------------------------------
A0A3P8UA78_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-02       --------------------------------------------------
A0A3Q3VLX6_BMF-01       --------------------------------------------------
A0A3Q2ZA20_BMF-01       --------------------------------------------------
A0A3Q3RVI2_BMF-02       --------------------------------------------------
A0A3Q3RVI2_BMF-01       --------------------------------------------------
A0A3Q1IPR4_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-02       --------------------------------------------------
A0A3Q1FVH7_BMF-01       --------------------------------------------------
A0A3Q1FVH7_BMF-02       --------------------------------------------------
A0A3B5B8F6_BMF-01       --------------------------------------------------
A0A3Q1D1K3_BMF-01       --------------------------------------------------
A0A3P8RKY9_BMF-01       --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
A0A3B4U5H8_BMF-01       --------------------------------------------------
A0A3B4WM88_BMF-01       --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A452QUG1_BIK-01       --------------------------------------------------
A0A452V3L2_BIK-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
A0A452H3N6_BMF-01       --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
A0A493T7X1_BMF-01       --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-02       --------------------------------------------------
A0A3Q2UCA0_BMF-01       --------------------------------------------------
A0A493T7X1_BMF-02       --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-03       --------------------------------------------------
A0A3Q2UCA0_BMF-04       --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           --------------------------------------------------
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A286XXB0_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-03       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           --------------------------------------------------
G1PAU1_BMF-01           --------------------------------------------------
L8IXF5_BMF-01           --------------------------------------------------
Q05KI3_BMF-02           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
A0A452F2E0_BMF-02       --------------------------------------------------
A0A452F2E0_BMF-01       --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
A0A287CXH0_BMF-01       --------------------------------------------------
A0A287CXH0_BMF-02       --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       --------------------------------------------------
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       --------------------------------------------------
M3YAD5_BMF-01           --------------------------------------------------
U6CSY8_BMF-01           --------------------------------------------------
A0A452SED0_BMF-01       --------------------------------------------------
A0A384D070_BMF-01       --------------------------------------------------
J9PB65_BMF-04           --------------------------------------------------
J9PB65_BMF-03           --------------------------------------------------
J9PB65_BMF-02           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
A0A2K5KGP2_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
F7CM09_BMF-03           --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
F7CM09_BMF-01           --------------------------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K5Z4A9_BMF-02       --------------------------------------------------
A0A2K5MJW4_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K5Z4A9_BMF-01       --------------------------------------------------
A0A2K5KGP2_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-03       --------------------------------------------------
A0A2K6L919_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-02       --------------------------------------------------
A0A2K6TW78_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-03       --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-02       --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-01       --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-01       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
G3VRY3_BAD-02           --------------------------------------------------
G3VRY3_BAD-01           --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
Q61337_BAD-01           --------------------------------------------------
Q61337_BAD-05           --------------------------------------------------
O35147_BAD-01           --------------------------------------------------
Q6P7C5_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A8MXU7_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2K5VCA9_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K5M0A7_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
A0A452ER54_BAD-01       --------------------------------------------------
A0A452ER54_BAD-02       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
A0A287CT05_BAD-02       --------------------------------------------------
A0A287CT05_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2R8Z688_BAD-03       --------------------------------------------------
A8MXU7_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A2K5VCA9_BAD-03       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K5HKU7_BAD-02       --------------------------------------------------
A0A2K6N196_BAD-02       --------------------------------------------------
A0A2K6PUL3_BAD-02       --------------------------------------------------
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2K5HKU7_BAD-01       --------------------------------------------------
A0A2K6N196_BAD-01       --------------------------------------------------
A0A2K6PUL3_BAD-01       --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
A0A2R8Z688_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
A0A452RJM6_BAD-01       --------------------------------------------------
G1MI17_BAD-01           --------------------------------------------------
A0A384DJL2_BAD-01       --------------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
F7FUT7_BIK-02           --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
G3UH24_HRK-01           --------------------------------------------------
A0A452DXE5_HRK-01       --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          tgtgcgccgcggctgggggtgcgcgtgccgtgccgtgagcgggggccgct
F7G1G0_HRK-01           --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-03          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          cctgcctcccctccatctgggccttgtgtgtgttgtgggtgccagccctg
F1RM01_BBC3-02          --------------------------------------------------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      ccgggtgggctccctggaggaggtgacaggagtgcaggcggcgagcagtg
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B1IH05_BAD-01       --------------------------------------------------
A0A3B4CPH6_BAD-01       --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
A0A3B4UNJ0_BMF-01       --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B3QX41_BAD-01       --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
A0A3P8Y761_BAD-01       --------------------------------------------------
A0A3B3RH63_BMF-01       --------------------------------------------------
A0A452IFQ4_BAD-01       --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       cactttgagttgggggatgggtgcgcactgagccatccgcagccaagtca
C1KGB6_BCL2L11-01       cactttgagttgggggatgggtgcgcactgagccatccgcagccaagtca
C1KGB6_BCL2L11-02       cactttgagttgggggatgggtgcgcactgagccatccgcagccaagtca
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3B1K1X5_BMF-01       --------------------------------------------------
A0A3B4CNJ8_BMF-01       --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
A0A3P9A5G8_BAD-02       --------------------------------------------------
A0A3P9A5G8_BAD-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A0A3B1JLM2_BAD-01       --------------------------------------------------
A0A3B4DUY7_BAD-01       --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
A0A3Q2Y0E4_BAD-01       --------------------------------------------------
A0A3B3BQF7_BAD-01       --------------------------------------------------
A0A3P9HNZ2_BAD-01       --------------------------------------------------
A0A3B3HDU2_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-02       --------------------------------------------------
A0A3Q3AEL8_BAD-01       --------------------------------------------------
A0A3Q3AEL8_BAD-02       --------------------------------------------------
A0A3Q2QC80_BAD-01       --------------------------------------------------
A0A3Q2D5S0_BAD-01       --------------------------------------------------
A0A3B5L9R9_BAD-01       --------------------------------------------------
A0A3B5Q2N7_BAD-01       --------------------------------------------------
A0A3P9Q7C3_BAD-01       --------------------------------------------------
A0A3B3YFR1_BAD-01       --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A3B3UA11_BAD-01       --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A3P9B2E4_BAD-01       --------------------------------------------------
A0A3Q4GGN3_BAD-01       --------------------------------------------------
A0A3P8QRJ7_BAD-01       --------------------------------------------------
A0A3Q3C680_BAD-01       --------------------------------------------------
A0A3B4GXJ6_BAD-01       --------------------------------------------------
A0A3Q0QNQ2_BAD-02       --------------------------------------------------
A0A3Q0QNQ2_BAD-01       --------------------------------------------------
A0A3Q3WTY4_BAD-01       --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
A0A3P8WI83_BAD-02       --------------------------------------------------
A0A3P8WI83_BAD-01       --------------------------------------------------
A0A3Q3FKT9_BAD-03       --------------------------------------------------
A0A3Q3FKT9_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-02       --------------------------------------------------
A0A3Q3R5S3_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-02       --------------------------------------------------
A0A3B5BAL2_BAD-01       --------------------------------------------------
A0A3Q1GWH9_BAD-01       --------------------------------------------------
A0A3Q1CPU7_BAD-01       --------------------------------------------------
A0A3P8TWH6_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
A0A3B4VFC5_BAD-01       --------------------------------------------------
A0A3B4W9T1_BAD-01       --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8ZIE7_BMF-01       --------------------------------------------------
A0A3B4B6Y3_BMF-01       --------------------------------------------------
A0A3Q2CXC4_BMF-02       --------------------------------------------------
A0A3Q2CXC4_BMF-01       --------------------------------------------------
A0A3B5QK08_BMF-02       --------------------------------------------------
A0A3B5QK08_BMF-01       --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
A0A3B3WU80_BMF-01       --------------------------------------------------
A0A3P9Q8E2_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-02       --------------------------------------------------
A0A3Q2PJX9_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-03       --------------------------------------------------
A0A3Q2YCX7_BMF-01       --------------------------------------------------
A0A3Q2YCX7_BMF-02       --------------------------------------------------
A0A3B3CGR9_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-04       --------------------------------------------------
A0A3P9K487_BMF-02       --------------------------------------------------
A0A3P9K487_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-03       --------------------------------------------------
A0A3B3HAU1_BMF-02       --------------------------------------------------
A0A3B3HAU1_BMF-04       --------------------------------------------------
A0A3Q3GUU5_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-02       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A3Q4G1I4_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-02       --------------------------------------------------
A0A3B4ETH0_BMF-01       --------------------------------------------------
A0A3Q3C5V2_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-03       --------------------------------------------------
A0A3P8UA78_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-02       --------------------------------------------------
A0A3Q3VLX6_BMF-01       --------------------------------------------------
A0A3Q2ZA20_BMF-01       --------------------------------------------------
A0A3Q3RVI2_BMF-02       --------------------------------------------------
A0A3Q3RVI2_BMF-01       --------------------------------------------------
A0A3Q1IPR4_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-02       --------------------------------------------------
A0A3Q1FVH7_BMF-01       --------------------------------------------------
A0A3Q1FVH7_BMF-02       --------------------------------------------------
A0A3B5B8F6_BMF-01       --------------------------------------------------
A0A3Q1D1K3_BMF-01       --------------------------------------------------
A0A3P8RKY9_BMF-01       --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
A0A3B4U5H8_BMF-01       --------------------------------------------------
A0A3B4WM88_BMF-01       --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A452QUG1_BIK-01       --------------------------------------------------
A0A452V3L2_BIK-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
A0A452H3N6_BMF-01       --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
A0A493T7X1_BMF-01       --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-02       --------------------------------------------------
A0A3Q2UCA0_BMF-01       --------------------------------------------------
A0A493T7X1_BMF-02       --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-03       --------------------------------------------------
A0A3Q2UCA0_BMF-04       --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           --------------------------------------------------
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A286XXB0_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-03       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           --------------------------------------------------
G1PAU1_BMF-01           --------------------------------------------------
L8IXF5_BMF-01           --------------------------------------------------
Q05KI3_BMF-02           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
A0A452F2E0_BMF-02       --------------------------------------------------
A0A452F2E0_BMF-01       --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
A0A287CXH0_BMF-01       --------------------------------------------------
A0A287CXH0_BMF-02       --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       --------------------------------------------------
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       --------------------------------------------------
M3YAD5_BMF-01           --------------------------------------------------
U6CSY8_BMF-01           --------------------------------------------------
A0A452SED0_BMF-01       --------------------------------------------------
A0A384D070_BMF-01       --------------------------------------------------
J9PB65_BMF-04           --------------------------------------------------
J9PB65_BMF-03           --------------------------------------------------
J9PB65_BMF-02           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
A0A2K5KGP2_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
F7CM09_BMF-03           --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
F7CM09_BMF-01           --------------------------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K5Z4A9_BMF-02       --------------------------------------------------
A0A2K5MJW4_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K5Z4A9_BMF-01       --------------------------------------------------
A0A2K5KGP2_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-03       --------------------------------------------------
A0A2K6L919_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-02       --------------------------------------------------
A0A2K6TW78_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-03       --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-02       --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-01       --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-01       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
G3VRY3_BAD-02           --------------------------------------------------
G3VRY3_BAD-01           --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
Q61337_BAD-01           --------------------------------------------------
Q61337_BAD-05           --------------------------------------------------
O35147_BAD-01           --------------------------------------------------
Q6P7C5_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A8MXU7_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2K5VCA9_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K5M0A7_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
A0A452ER54_BAD-01       --------------------------------------------------
A0A452ER54_BAD-02       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
A0A287CT05_BAD-02       --------------------------------------------------
A0A287CT05_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2R8Z688_BAD-03       --------------------------------------------------
A8MXU7_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A2K5VCA9_BAD-03       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K5HKU7_BAD-02       --------------------------------------------------
A0A2K6N196_BAD-02       --------------------------------------------------
A0A2K6PUL3_BAD-02       --------------------------------------------------
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2K5HKU7_BAD-01       --------------------------------------------------
A0A2K6N196_BAD-01       --------------------------------------------------
A0A2K6PUL3_BAD-01       --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
A0A2R8Z688_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
A0A452RJM6_BAD-01       --------------------------------------------------
G1MI17_BAD-01           --------------------------------------------------
A0A384DJL2_BAD-01       --------------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
F7FUT7_BIK-02           --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
G3UH24_HRK-01           --------------------------------------------------
A0A452DXE5_HRK-01       --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          gtcaccgcgctgctgctgccgctgtgagtgcggggccggactggggaaac
F7G1G0_HRK-01           --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          ---------------------------------------------aggtg
J9NTK9_BBC3-03          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      ---------------------------------------------aggtg
A0A3Q2GWE8_BBC3-01      ---------------------------------------------aggcg
A0A3Q2GWE8_BBC3-02      ---------------------------------------------aggcg
F1RM01_BBC3-04          ggcttccctgcctgccacgtgtcctcatgcctgggttcaagagtggggtg
F1RM01_BBC3-02          --------------------------------------------------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      ---------------------------------------------aggtg
A0A2K6STD6_BBC3-02      ---------------------------------------------aagtg
A0A2K5F6X4_BBC3-02      ---------------------------------------------aagtg
A0A2R8MW85_BBC3-02      ---------------------------------------------aagtg
A0A2K5QNS7_BBC3-02      ---------------------------------------------aagtg
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      ---------------------------------------------aggtg
A0A2K5P2T8_BBC3-03      ---------------------------------------------aggtg
A0A2K5V8J3_BBC3-03      ---------------------------------------------aggtg
A0A2K6ASP2_BBC3-03      ---------------------------------------------aggtg
A0A2I3N2Z9_BBC3-03      ---------------------------------------------aggtg
A0A2R8MW85_BBC3-03      cgggcgccctgcctccccacactgcgcctccccacaaaccccacgaggga
A0A2I3HWI8_BBC3-03      ---------------------------------------------aggtg
A0A2R9BZA9_BBC3-01      ---------------------------------------------aggtg
A0A2I3RGH5_BBC3-03      ---------------------------------------------aggtg
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          ---------------------------------------------aggtg
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          ---------------------------------------------aggtg
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B1IH05_BAD-01       --------------------------------------------------
A0A3B4CPH6_BAD-01       --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
A0A3B4UNJ0_BMF-01       --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B3QX41_BAD-01       --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
A0A3P8Y761_BAD-01       --------------------------------------------------
A0A3B3RH63_BMF-01       --------------------------------------------------
A0A452IFQ4_BAD-01       --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       ctccagtaaacacgcccggcgggggcagggcggtaggcgcgcgcagcggg
C1KGB6_BCL2L11-01       ctccagtaaacacgcccggcgggggcagggcggtaggcgcgcgcagcggg
C1KGB6_BCL2L11-02       ctccagtaaacacgcccggcgggggcagggcggtaggcgcgcgcagcggg
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       ------acacgcccggcggggggccgggccggcggcgcgcgcaggggaac
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3B1K1X5_BMF-01       --------------------------------------------------
A0A3B4CNJ8_BMF-01       --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
A0A3P9A5G8_BAD-02       --------------------------------------------------
A0A3P9A5G8_BAD-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A0A3B1JLM2_BAD-01       --------------------------------------------------
A0A3B4DUY7_BAD-01       --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
A0A3Q2Y0E4_BAD-01       --------------------------------------------------
A0A3B3BQF7_BAD-01       --------------------------------------------------
A0A3P9HNZ2_BAD-01       --------------------------------------------------
A0A3B3HDU2_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-02       --------------------------------------------------
A0A3Q3AEL8_BAD-01       --------------------------------------------------
A0A3Q3AEL8_BAD-02       --------------------------------------------------
A0A3Q2QC80_BAD-01       --------------------------------------------------
A0A3Q2D5S0_BAD-01       --------------------------------------------------
A0A3B5L9R9_BAD-01       --------------------------------------------------
A0A3B5Q2N7_BAD-01       --------------------------------------------------
A0A3P9Q7C3_BAD-01       --------------------------------------------------
A0A3B3YFR1_BAD-01       --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A3B3UA11_BAD-01       --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A3P9B2E4_BAD-01       --------------------------------------------------
A0A3Q4GGN3_BAD-01       --------------------------------------------------
A0A3P8QRJ7_BAD-01       --------------------------------------------------
A0A3Q3C680_BAD-01       --------------------------------------------------
A0A3B4GXJ6_BAD-01       --------------------------------------------------
A0A3Q0QNQ2_BAD-02       --------------------------------------------------
A0A3Q0QNQ2_BAD-01       --------------------------------------------------
A0A3Q3WTY4_BAD-01       --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
A0A3P8WI83_BAD-02       --------------------------------------------------
A0A3P8WI83_BAD-01       --------------------------------------------------
A0A3Q3FKT9_BAD-03       --------------------------------------------------
A0A3Q3FKT9_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-02       --------------------------------------------------
A0A3Q3R5S3_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-02       --------------------------------------------------
A0A3B5BAL2_BAD-01       --------------------------------------------------
A0A3Q1GWH9_BAD-01       --------------------------------------------------
A0A3Q1CPU7_BAD-01       --------------------------------------------------
A0A3P8TWH6_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
A0A3B4VFC5_BAD-01       --------------------------------------------------
A0A3B4W9T1_BAD-01       --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8ZIE7_BMF-01       --------------------------------------------------
A0A3B4B6Y3_BMF-01       --------------------------------------------------
A0A3Q2CXC4_BMF-02       --------------------------------------------------
A0A3Q2CXC4_BMF-01       --------------------------------------------------
A0A3B5QK08_BMF-02       --------------------------------------------------
A0A3B5QK08_BMF-01       --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
A0A3B3WU80_BMF-01       --------------------------------------------------
A0A3P9Q8E2_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-02       --------------------------------------------------
A0A3Q2PJX9_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-03       --------------------------------------------------
A0A3Q2YCX7_BMF-01       --------------------------------------------------
A0A3Q2YCX7_BMF-02       --------------------------------------------------
A0A3B3CGR9_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-04       --------------------------------------------------
A0A3P9K487_BMF-02       --------------------------------------------------
A0A3P9K487_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-03       --------------------------------------------------
A0A3B3HAU1_BMF-02       --------------------------------------------------
A0A3B3HAU1_BMF-04       --------------------------------------------------
A0A3Q3GUU5_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-02       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A3Q4G1I4_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-02       --------------------------------------------------
A0A3B4ETH0_BMF-01       --------------------------------------------------
A0A3Q3C5V2_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-03       --------------------------------------------------
A0A3P8UA78_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-02       --------------------------------------------------
A0A3Q3VLX6_BMF-01       --------------------------------------------------
A0A3Q2ZA20_BMF-01       --------------------------------------------------
A0A3Q3RVI2_BMF-02       --------------------------------------------------
A0A3Q3RVI2_BMF-01       --------------------------------------------------
A0A3Q1IPR4_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-02       --------------------------------------------------
A0A3Q1FVH7_BMF-01       --------------------------------------------------
A0A3Q1FVH7_BMF-02       --------------------------------------------------
A0A3B5B8F6_BMF-01       --------------------------------------------------
A0A3Q1D1K3_BMF-01       --------------------------------------------------
A0A3P8RKY9_BMF-01       --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
A0A3B4U5H8_BMF-01       --------------------------------------------------
A0A3B4WM88_BMF-01       --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A452QUG1_BIK-01       --------------------------------------------------
A0A452V3L2_BIK-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
A0A452H3N6_BMF-01       --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
A0A493T7X1_BMF-01       --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-02       --------------------------------------------------
A0A3Q2UCA0_BMF-01       --------------------------------------------------
A0A493T7X1_BMF-02       --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-03       --------------------------------------------------
A0A3Q2UCA0_BMF-04       --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           --------------------------------------------------
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A286XXB0_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-03       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           --------------------------------------------------
G1PAU1_BMF-01           --------------------------------------------------
L8IXF5_BMF-01           --------------------------------------------------
Q05KI3_BMF-02           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
A0A452F2E0_BMF-02       --------------------------------------------------
A0A452F2E0_BMF-01       --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
A0A287CXH0_BMF-01       --------------------------------------------------
A0A287CXH0_BMF-02       --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       --------------------------------------------------
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       --------------------------------------------------
M3YAD5_BMF-01           --------------------------------------------------
U6CSY8_BMF-01           --------------------------------------------------
A0A452SED0_BMF-01       --------------------------------------------------
A0A384D070_BMF-01       --------------------------------------------------
J9PB65_BMF-04           --------------------------------------------------
J9PB65_BMF-03           --------------------------------------------------
J9PB65_BMF-02           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
A0A2K5KGP2_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
F7CM09_BMF-03           --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
F7CM09_BMF-01           --------------------------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K5Z4A9_BMF-02       --------------------------------------------------
A0A2K5MJW4_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K5Z4A9_BMF-01       --------------------------------------------------
A0A2K5KGP2_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-03       --------------------------------------------------
A0A2K6L919_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-02       --------------------------------------------------
A0A2K6TW78_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-03       --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-02       --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-01       --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-01       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
G3VRY3_BAD-02           --------------------------------------------------
G3VRY3_BAD-01           --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
Q61337_BAD-01           --------------------------------------------------
Q61337_BAD-05           --------------------------------------------------
O35147_BAD-01           --------------------------------------------------
Q6P7C5_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A8MXU7_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2K5VCA9_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K5M0A7_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
A0A452ER54_BAD-01       --------------------------------------------------
A0A452ER54_BAD-02       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
A0A287CT05_BAD-02       --------------------------------------------------
A0A287CT05_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2R8Z688_BAD-03       --------------------------------------------------
A8MXU7_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A2K5VCA9_BAD-03       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K5HKU7_BAD-02       --------------------------------------------------
A0A2K6N196_BAD-02       --------------------------------------------------
A0A2K6PUL3_BAD-02       --------------------------------------------------
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2K5HKU7_BAD-01       --------------------------------------------------
A0A2K6N196_BAD-01       --------------------------------------------------
A0A2K6PUL3_BAD-01       --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
A0A2R8Z688_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
A0A452RJM6_BAD-01       --------------------------------------------------
G1MI17_BAD-01           --------------------------------------------------
A0A384DJL2_BAD-01       --------------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
F7FUT7_BIK-02           --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
G3UH24_HRK-01           --------------------------------------------------
A0A452DXE5_HRK-01       --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          tgaggcggggccgggcccgaggggtggcaccgccgctcacctgctccgcc
F7G1G0_HRK-01           --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          ctcggggtttccttctggccctgtgggtccc-------------------
J9NTK9_BBC3-03          -----------------gccctgtgtgactc-------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      cccagggttgcctcc--tgtgggtgggcccacgccctatttgtgtggagc
A0A3Q2GWE8_BBC3-01      cctggggcttccttc--tcaccctgggtccc-------------------
A0A3Q2GWE8_BBC3-02      cctggggcttccttc--tcaccctgggtccc-------------------
F1RM01_BBC3-04          ccctgtgtaccccag--ggaggggggtgccctgggggccggcctgatgcc
F1RM01_BBC3-02          ----gtgtcccatca--gtgggccagtgagcaggaacctgtc--------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          -------------tc--ccaggctgggcccc-------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      cccgggacttccttc--tcatggtgggtcct-------------------
A0A2K6STD6_BBC3-02      cccagggcttcttcc--ttgacgtgggtccc-------------------
A0A2K5F6X4_BBC3-02      cctagggcttcttcc--tcgacgtgggtccc-------------------
A0A2R8MW85_BBC3-02      cccagggcttcttcc--tcggtgtgggtccc-------------------
A0A2K5QNS7_BBC3-02      cccagggcttcttcc--tcggtgtgggttcc-------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      cccagggcttcttct--gcgacgtgggtccc-------------------
A0A2K5P2T8_BBC3-03      cccagggctgcttct--gcgacgtgggtcct-------------------
A0A2K5V8J3_BBC3-03      cccagggcttcttct--gcgacgtgggtccc-------------------
A0A2K6ASP2_BBC3-03      cccagggcttcttct--gcgacgtgggtccc-------------------
A0A2I3N2Z9_BBC3-03      cccagggcttcttct--gcgacgtgggtccc-------------------
A0A2R8MW85_BBC3-03      ccctgggctggggtc--gcggggagggaggcggctcggcgttggggcgcc
A0A2I3HWI8_BBC3-03      cccagggcttcttcc--gtgacgtgggtccc-------------------
A0A2R9BZA9_BBC3-01      cccagggctgcttcc--gtgacgtgggtccc-------------------
A0A2I3RGH5_BBC3-03      cccagggctgcttcc--gcgacgtgggtccc-------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          cccagggctgcttcc--acgacgtgggtccc-------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          cccagggctgcttcc--acgacgtgggtccc-------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B1IH05_BAD-01       --------------------------------------------------
A0A3B4CPH6_BAD-01       --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
A0A3B4UNJ0_BMF-01       --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B3QX41_BAD-01       --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
A0A3P8Y761_BAD-01       --------------------------------------------------
A0A3B3RH63_BMF-01       --------------------------------------------------
A0A452IFQ4_BAD-01       --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       gaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtc
C1KGB6_BCL2L11-01       gaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtc
C1KGB6_BCL2L11-02       gaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtc
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       -----------------------------atgttcccggcggcggcggcc
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       ccgtccgggccacccccgcctttacctgttggagcctgagcgcgccagcc
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3B1K1X5_BMF-01       --------------------------------------------------
A0A3B4CNJ8_BMF-01       --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
A0A3P9A5G8_BAD-02       --------------------------------------------------
A0A3P9A5G8_BAD-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A0A3B1JLM2_BAD-01       --------------------------------------------------
A0A3B4DUY7_BAD-01       --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
A0A3Q2Y0E4_BAD-01       --------------------------------------------------
A0A3B3BQF7_BAD-01       --------------------------------------------------
A0A3P9HNZ2_BAD-01       --------------------------------------------------
A0A3B3HDU2_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-02       --------------------------------------------------
A0A3Q3AEL8_BAD-01       --------------------------------------------------
A0A3Q3AEL8_BAD-02       --------------------------------------------------
A0A3Q2QC80_BAD-01       --------------------------------------------------
A0A3Q2D5S0_BAD-01       --------------------------------------------------
A0A3B5L9R9_BAD-01       --------------------------------------------------
A0A3B5Q2N7_BAD-01       --------------------------------------------------
A0A3P9Q7C3_BAD-01       --------------------------------------------------
A0A3B3YFR1_BAD-01       --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A3B3UA11_BAD-01       --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A3P9B2E4_BAD-01       --------------------------------------------------
A0A3Q4GGN3_BAD-01       --------------------------------------------------
A0A3P8QRJ7_BAD-01       --------------------------------------------------
A0A3Q3C680_BAD-01       --------------------------------------------------
A0A3B4GXJ6_BAD-01       --------------------------------------------------
A0A3Q0QNQ2_BAD-02       --------------------------------------------------
A0A3Q0QNQ2_BAD-01       --------------------------------------------------
A0A3Q3WTY4_BAD-01       --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
A0A3P8WI83_BAD-02       --------------------------------------------------
A0A3P8WI83_BAD-01       --------------------------------------------------
A0A3Q3FKT9_BAD-03       --------------------------------------------------
A0A3Q3FKT9_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-02       --------------------------------------------------
A0A3Q3R5S3_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-02       --------------------------------------------------
A0A3B5BAL2_BAD-01       --------------------------------------------------
A0A3Q1GWH9_BAD-01       --------------------------------------------------
A0A3Q1CPU7_BAD-01       --------------------------------------------------
A0A3P8TWH6_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
A0A3B4VFC5_BAD-01       --------------------------------------------------
A0A3B4W9T1_BAD-01       --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8ZIE7_BMF-01       --------------------------------------------------
A0A3B4B6Y3_BMF-01       --------------------------------------------------
A0A3Q2CXC4_BMF-02       --------------------------------------------------
A0A3Q2CXC4_BMF-01       --------------------------------------------------
A0A3B5QK08_BMF-02       --------------------------------------------------
A0A3B5QK08_BMF-01       --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
A0A3B3WU80_BMF-01       --------------------------------------------------
A0A3P9Q8E2_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-02       --------------------------------------------------
A0A3Q2PJX9_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-03       --------------------------------------------------
A0A3Q2YCX7_BMF-01       --------------------------------------------------
A0A3Q2YCX7_BMF-02       --------------------------------------------------
A0A3B3CGR9_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-04       --------------------------------------------------
A0A3P9K487_BMF-02       --------------------------------------------------
A0A3P9K487_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-03       --------------------------------------------------
A0A3B3HAU1_BMF-02       --------------------------------------------------
A0A3B3HAU1_BMF-04       --------------------------------------------------
A0A3Q3GUU5_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-02       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A3Q4G1I4_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-02       --------------------------------------------------
A0A3B4ETH0_BMF-01       --------------------------------------------------
A0A3Q3C5V2_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-03       --------------------------------------------------
A0A3P8UA78_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-02       --------------------------------------------------
A0A3Q3VLX6_BMF-01       --------------------------------------------------
A0A3Q2ZA20_BMF-01       --------------------------------------------------
A0A3Q3RVI2_BMF-02       --------------------------------------------------
A0A3Q3RVI2_BMF-01       --------------------------------------------------
A0A3Q1IPR4_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-02       --------------------------------------------------
A0A3Q1FVH7_BMF-01       --------------------------------------------------
A0A3Q1FVH7_BMF-02       --------------------------------------------------
A0A3B5B8F6_BMF-01       --------------------------------------------------
A0A3Q1D1K3_BMF-01       --------------------------------------------------
A0A3P8RKY9_BMF-01       --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
A0A3B4U5H8_BMF-01       --------------------------------------------------
A0A3B4WM88_BMF-01       --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A452QUG1_BIK-01       --------------------------------------------------
A0A452V3L2_BIK-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
A0A452H3N6_BMF-01       --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
A0A493T7X1_BMF-01       --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-02       --------------------------------------------------
A0A3Q2UCA0_BMF-01       --------------------------------------------------
A0A493T7X1_BMF-02       --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-03       --------------------------------------------------
A0A3Q2UCA0_BMF-04       --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           --------------------------------------------------
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A286XXB0_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-03       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           --------------------------------------------------
G1PAU1_BMF-01           --------------------------------------------------
L8IXF5_BMF-01           --------------------------------------------------
Q05KI3_BMF-02           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
A0A452F2E0_BMF-02       --------------------------------------------------
A0A452F2E0_BMF-01       --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
A0A287CXH0_BMF-01       --------------------------------------------------
A0A287CXH0_BMF-02       --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       --------------------------------------------------
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       --------------------------------------------------
M3YAD5_BMF-01           --------------------------------------------------
U6CSY8_BMF-01           --------------------------------------------------
A0A452SED0_BMF-01       --------------------------------------------------
A0A384D070_BMF-01       --------------------------------------------------
J9PB65_BMF-04           --------------------------------------------------
J9PB65_BMF-03           --------------------------------------------------
J9PB65_BMF-02           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
A0A2K5KGP2_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
F7CM09_BMF-03           --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
F7CM09_BMF-01           --------------------------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K5Z4A9_BMF-02       --------------------------------------------------
A0A2K5MJW4_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K5Z4A9_BMF-01       --------------------------------------------------
A0A2K5KGP2_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-03       --------------------------------------------------
A0A2K6L919_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-02       --------------------------------------------------
A0A2K6TW78_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-03       --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-02       --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-01       --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-01       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
G3VRY3_BAD-02           --------------------------------------------------
G3VRY3_BAD-01           --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
Q61337_BAD-01           --------------------------------------------------
Q61337_BAD-05           --------------------------------------------------
O35147_BAD-01           --------------------------------------------------
Q6P7C5_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A8MXU7_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2K5VCA9_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K5M0A7_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
A0A452ER54_BAD-01       --------------------------------------------------
A0A452ER54_BAD-02       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
A0A287CT05_BAD-02       --------------------------------------------------
A0A287CT05_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2R8Z688_BAD-03       --------------------------------------------------
A8MXU7_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A2K5VCA9_BAD-03       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K5HKU7_BAD-02       --------------------------------------------------
A0A2K6N196_BAD-02       --------------------------------------------------
A0A2K6PUL3_BAD-02       --------------------------------------------------
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2K5HKU7_BAD-01       --------------------------------------------------
A0A2K6N196_BAD-01       --------------------------------------------------
A0A2K6PUL3_BAD-01       --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
A0A2R8Z688_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
A0A452RJM6_BAD-01       --------------------------------------------------
G1MI17_BAD-01           --------------------------------------------------
A0A384DJL2_BAD-01       --------------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
F7FUT7_BIK-02           --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
G3UH24_HRK-01           --------------------------------------------------
A0A452DXE5_HRK-01       --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          cacctgtctgtgtccctccgcaggctccctccccactggggc--------
F7G1G0_HRK-01           --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          -----------------------------ccgtcagatctgt--------
J9NTK9_BBC3-03          -----------------------------cca------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      ctggctaggtgtgcacagtctggagtatgtcctgccagtggg--------
A0A3Q2GWE8_BBC3-01      -----------------------------ccagcagactcgt--------
A0A3Q2GWE8_BBC3-02      -----------------------------ccagcagactcgt--------
F1RM01_BBC3-04          ccctgcacttctcagctgaccgtgcccctctgtcctgtcctg--------
F1RM01_BBC3-02          -----------------------------------------a--------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      -----------------------------gggccatattcct--------
A0A2K6STD6_BBC3-02      -----------------------------ctgccagatgtgt--------
A0A2K5F6X4_BBC3-02      -----------------------------ctgccagatgtgt--------
A0A2R8MW85_BBC3-02      -----------------------------ctgccagatgtgt--------
A0A2K5QNS7_BBC3-02      -----------------------------ttgccagatgtgt--------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      -----------------------------ctgccagatttgt--------
A0A2K5P2T8_BBC3-03      -----------------------------ctgccagatttgt--------
A0A2K5V8J3_BBC3-03      -----------------------------ctgccagatttgt--------
A0A2K6ASP2_BBC3-03      -----------------------------ctgccagatttgt--------
A0A2I3N2Z9_BBC3-03      -----------------------------ctgccagatttgt--------
A0A2R8MW85_BBC3-03      tggtctgggcgcacaggtgcctcggcggtctggcgggtttgtttacaaac
A0A2I3HWI8_BBC3-03      -----------------------------ctgccagatttgt--------
A0A2R9BZA9_BBC3-01      -----------------------------ctgccagatttgt--------
A0A2I3RGH5_BBC3-03      -----------------------------ctgccagatttgt--------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          -----------------------------ctgccagatttgt--------
B4DQK3_BBC3-01          ----------------------------------------at--------
Q9BXH1_BBC3-03          -----------------------------ctgccagatttgt--------
A0A0D9S2H2_BBC3-01      ----------------------------------------ca--------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B1IH05_BAD-01       --------------------------------------------------
A0A3B4CPH6_BAD-01       --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
A0A3B4UNJ0_BMF-01       --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B3QX41_BAD-01       --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
A0A3P8Y761_BAD-01       --------------------------------------------------
A0A3B3RH63_BMF-01       --------------------------------------------------
A0A452IFQ4_BAD-01       --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       agcggctgcagcggcgcggaggcggggctttccagcccgcgcgctgggcg
C1KGB6_BCL2L11-01       agcggctgcagcggcgcggaggcggggctttccagcccgcgcgctgggcg
C1KGB6_BCL2L11-02       agcggctgcagcggcgcggaggcggggctttccagcccgcgcgctgggcg
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       ggggcagcgcgggccagaggcgcggcgcgcggagccctcggctgccggac
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       gctgcggcgcggcggggcggggcggggcgtcgggcccgcgcggcggggcg
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3B1K1X5_BMF-01       --------------------------------------------------
A0A3B4CNJ8_BMF-01       --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
A0A3P9A5G8_BAD-02       --------------------------------------------------
A0A3P9A5G8_BAD-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A0A3B1JLM2_BAD-01       --------------------------------------------------
A0A3B4DUY7_BAD-01       --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
A0A3Q2Y0E4_BAD-01       --------------------------------------------------
A0A3B3BQF7_BAD-01       --------------------------------------------------
A0A3P9HNZ2_BAD-01       --------------------------------------------------
A0A3B3HDU2_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-02       --------------------------------------------------
A0A3Q3AEL8_BAD-01       --------------------------------------------------
A0A3Q3AEL8_BAD-02       --------------------------------------------------
A0A3Q2QC80_BAD-01       --------------------------------------------------
A0A3Q2D5S0_BAD-01       --------------------------------------------------
A0A3B5L9R9_BAD-01       --------------------------------------------------
A0A3B5Q2N7_BAD-01       --------------------------------------------------
A0A3P9Q7C3_BAD-01       --------------------------------------------------
A0A3B3YFR1_BAD-01       --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A3B3UA11_BAD-01       --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A3P9B2E4_BAD-01       --------------------------------------------------
A0A3Q4GGN3_BAD-01       --------------------------------------------------
A0A3P8QRJ7_BAD-01       --------------------------------------------------
A0A3Q3C680_BAD-01       --------------------------------------------------
A0A3B4GXJ6_BAD-01       --------------------------------------------------
A0A3Q0QNQ2_BAD-02       --------------------------------------------------
A0A3Q0QNQ2_BAD-01       --------------------------------------------------
A0A3Q3WTY4_BAD-01       --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
A0A3P8WI83_BAD-02       --------------------------------------------------
A0A3P8WI83_BAD-01       --------------------------------------------------
A0A3Q3FKT9_BAD-03       --------------------------------------------------
A0A3Q3FKT9_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-02       --------------------------------------------------
A0A3Q3R5S3_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-02       --------------------------------------------------
A0A3B5BAL2_BAD-01       --------------------------------------------------
A0A3Q1GWH9_BAD-01       --------------------------------------------------
A0A3Q1CPU7_BAD-01       --------------------------------------------------
A0A3P8TWH6_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
A0A3B4VFC5_BAD-01       --------------------------------------------------
A0A3B4W9T1_BAD-01       --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8ZIE7_BMF-01       --------------------------------------------------
A0A3B4B6Y3_BMF-01       --------------------------------------------------
A0A3Q2CXC4_BMF-02       --------------------------------------------------
A0A3Q2CXC4_BMF-01       --------------------------------------------------
A0A3B5QK08_BMF-02       --------------------------------------------------
A0A3B5QK08_BMF-01       --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
A0A3B3WU80_BMF-01       --------------------------------------------------
A0A3P9Q8E2_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-02       --------------------------------------------------
A0A3Q2PJX9_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-03       --------------------------------------------------
A0A3Q2YCX7_BMF-01       --------------------------------------------------
A0A3Q2YCX7_BMF-02       --------------------------------------------------
A0A3B3CGR9_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-04       --------------------------------------------------
A0A3P9K487_BMF-02       --------------------------------------------------
A0A3P9K487_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-03       --------------------------------------------------
A0A3B3HAU1_BMF-02       --------------------------------------------------
A0A3B3HAU1_BMF-04       --------------------------------------------------
A0A3Q3GUU5_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-02       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A3Q4G1I4_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-02       --------------------------------------------------
A0A3B4ETH0_BMF-01       --------------------------------------------------
A0A3Q3C5V2_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-03       --------------------------------------------------
A0A3P8UA78_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-02       --------------------------------------------------
A0A3Q3VLX6_BMF-01       --------------------------------------------------
A0A3Q2ZA20_BMF-01       --------------------------------------------------
A0A3Q3RVI2_BMF-02       --------------------------------------------------
A0A3Q3RVI2_BMF-01       --------------------------------------------------
A0A3Q1IPR4_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-02       --------------------------------------------------
A0A3Q1FVH7_BMF-01       --------------------------------------------------
A0A3Q1FVH7_BMF-02       --------------------------------------------------
A0A3B5B8F6_BMF-01       --------------------------------------------------
A0A3Q1D1K3_BMF-01       --------------------------------------------------
A0A3P8RKY9_BMF-01       --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
A0A3B4U5H8_BMF-01       --------------------------------------------------
A0A3B4WM88_BMF-01       --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A452QUG1_BIK-01       --------------------------------------------------
A0A452V3L2_BIK-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
A0A452H3N6_BMF-01       --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
A0A493T7X1_BMF-01       --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-02       --------------------------------------------------
A0A3Q2UCA0_BMF-01       --------------------------------------------------
A0A493T7X1_BMF-02       --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-03       --------------------------------------------------
A0A3Q2UCA0_BMF-04       --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           --------------------------------------------------
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A286XXB0_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-03       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           --------------------------------------------------
G1PAU1_BMF-01           --------------------------------------------------
L8IXF5_BMF-01           --------------------------------------------------
Q05KI3_BMF-02           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
A0A452F2E0_BMF-02       --------------------------------------------------
A0A452F2E0_BMF-01       --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
A0A287CXH0_BMF-01       --------------------------------------------------
A0A287CXH0_BMF-02       --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       --------------------------------------------------
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       --------------------------------------------------
M3YAD5_BMF-01           --------------------------------------------------
U6CSY8_BMF-01           --------------------------------------------------
A0A452SED0_BMF-01       --------------------------------------------------
A0A384D070_BMF-01       --------------------------------------------------
J9PB65_BMF-04           --------------------------------------------------
J9PB65_BMF-03           --------------------------------------------------
J9PB65_BMF-02           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
A0A2K5KGP2_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
F7CM09_BMF-03           --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
F7CM09_BMF-01           --------------------------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K5Z4A9_BMF-02       --------------------------------------------------
A0A2K5MJW4_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K5Z4A9_BMF-01       --------------------------------------------------
A0A2K5KGP2_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-03       --------------------------------------------------
A0A2K6L919_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-02       --------------------------------------------------
A0A2K6TW78_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-03       --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-02       --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-01       --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-01       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
G3VRY3_BAD-02           --------------------------------------------------
G3VRY3_BAD-01           --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
Q61337_BAD-01           --------------------------------------------------
Q61337_BAD-05           --------------------------------------------------
O35147_BAD-01           --------------------------------------------------
Q6P7C5_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A8MXU7_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2K5VCA9_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K5M0A7_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
A0A452ER54_BAD-01       --------------------------------------------------
A0A452ER54_BAD-02       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
A0A287CT05_BAD-02       --------------------------------------------------
A0A287CT05_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2R8Z688_BAD-03       --------------------------------------------------
A8MXU7_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A2K5VCA9_BAD-03       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K5HKU7_BAD-02       --------------------------------------------------
A0A2K6N196_BAD-02       --------------------------------------------------
A0A2K6PUL3_BAD-02       --------------------------------------------------
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2K5HKU7_BAD-01       --------------------------------------------------
A0A2K6N196_BAD-01       --------------------------------------------------
A0A2K6PUL3_BAD-01       --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
A0A2R8Z688_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
A0A452RJM6_BAD-01       --------------------------------------------------
G1MI17_BAD-01           --------------------------------------------------
A0A384DJL2_BAD-01       --------------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
F7FUT7_BIK-02           --------------------------------atggaaacccctgagtgc
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------atg---------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
G3UH24_HRK-01           --------------------------------------------------
A0A452DXE5_HRK-01       --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-03          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          --------------------------------------------------
F1RM01_BBC3-02          --------------------------------------------------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      aatggggtgcgggctcggcagcgccccctggcggccagtgcgaccccggg
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B1IH05_BAD-01       --------------------------------------------------
A0A3B4CPH6_BAD-01       --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
A0A3B4UNJ0_BMF-01       --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B3QX41_BAD-01       --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
A0A3P8Y761_BAD-01       --------------------------------------------------
A0A3B3RH63_BMF-01       --------------------------------------------------
A0A452IFQ4_BAD-01       --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       ggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
C1KGB6_BCL2L11-01       ggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
C1KGB6_BCL2L11-02       ggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       ggctcgcggcggcgggcgggctgccagtggccggctctgcgctgccccgg
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       ggacctggcgggggcggagctcgcggcgattggctgagggcgcggggccg
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3B1K1X5_BMF-01       --------------------------------------------------
A0A3B4CNJ8_BMF-01       --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
A0A3P9A5G8_BAD-02       --------------------------------------------------
A0A3P9A5G8_BAD-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A0A3B1JLM2_BAD-01       --------------------------------------------------
A0A3B4DUY7_BAD-01       --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
A0A3Q2Y0E4_BAD-01       --------------------------------------------------
A0A3B3BQF7_BAD-01       --------------------------------------------------
A0A3P9HNZ2_BAD-01       --------------------------------------------------
A0A3B3HDU2_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-02       --------------------------------------------------
A0A3Q3AEL8_BAD-01       --------------------------------------------------
A0A3Q3AEL8_BAD-02       --------------------------------------------------
A0A3Q2QC80_BAD-01       --------------------------------------------------
A0A3Q2D5S0_BAD-01       --------------------------------------------------
A0A3B5L9R9_BAD-01       --------------------------------------------------
A0A3B5Q2N7_BAD-01       --------------------------------------------------
A0A3P9Q7C3_BAD-01       --------------------------------------------------
A0A3B3YFR1_BAD-01       --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A3B3UA11_BAD-01       --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A3P9B2E4_BAD-01       --------------------------------------------------
A0A3Q4GGN3_BAD-01       --------------------------------------------------
A0A3P8QRJ7_BAD-01       --------------------------------------------------
A0A3Q3C680_BAD-01       --------------------------------------------------
A0A3B4GXJ6_BAD-01       --------------------------------------------------
A0A3Q0QNQ2_BAD-02       --------------------------------------------------
A0A3Q0QNQ2_BAD-01       --------------------------------------------------
A0A3Q3WTY4_BAD-01       --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
A0A3P8WI83_BAD-02       --------------------------------------------------
A0A3P8WI83_BAD-01       --------------------------------------------------
A0A3Q3FKT9_BAD-03       --------------------------------------------------
A0A3Q3FKT9_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-02       --------------------------------------------------
A0A3Q3R5S3_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-02       --------------------------------------------------
A0A3B5BAL2_BAD-01       --------------------------------------------------
A0A3Q1GWH9_BAD-01       --------------------------------------------------
A0A3Q1CPU7_BAD-01       --------------------------------------------------
A0A3P8TWH6_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
A0A3B4VFC5_BAD-01       --------------------------------------------------
A0A3B4W9T1_BAD-01       --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8ZIE7_BMF-01       --------------------------------------------------
A0A3B4B6Y3_BMF-01       --------------------------------------------------
A0A3Q2CXC4_BMF-02       --------------------------------------------------
A0A3Q2CXC4_BMF-01       --------------------------------------------------
A0A3B5QK08_BMF-02       --------------------------------------------------
A0A3B5QK08_BMF-01       --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
A0A3B3WU80_BMF-01       --------------------------------------------------
A0A3P9Q8E2_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-02       --------------------------------------------------
A0A3Q2PJX9_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-03       --------------------------------------------------
A0A3Q2YCX7_BMF-01       --------------------------------------------------
A0A3Q2YCX7_BMF-02       --------------------------------------------------
A0A3B3CGR9_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-04       --------------------------------------------------
A0A3P9K487_BMF-02       --------------------------------------------------
A0A3P9K487_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-03       --------------------------------------------------
A0A3B3HAU1_BMF-02       --------------------------------------------------
A0A3B3HAU1_BMF-04       --------------------------------------------------
A0A3Q3GUU5_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-02       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A3Q4G1I4_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-02       --------------------------------------------------
A0A3B4ETH0_BMF-01       --------------------------------------------------
A0A3Q3C5V2_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-03       --------------------------------------------------
A0A3P8UA78_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-02       --------------------------------------------------
A0A3Q3VLX6_BMF-01       --------------------------------------------------
A0A3Q2ZA20_BMF-01       --------------------------------------------------
A0A3Q3RVI2_BMF-02       --------------------------------------------------
A0A3Q3RVI2_BMF-01       --------------------------------------------------
A0A3Q1IPR4_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-02       --------------------------------------------------
A0A3Q1FVH7_BMF-01       --------------------------------------------------
A0A3Q1FVH7_BMF-02       --------------------------------------------------
A0A3B5B8F6_BMF-01       --------------------------------------------------
A0A3Q1D1K3_BMF-01       --------------------------------------------------
A0A3P8RKY9_BMF-01       --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
A0A3B4U5H8_BMF-01       --------------------------------------------------
A0A3B4WM88_BMF-01       --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A452QUG1_BIK-01       --------------------------------------------------
A0A452V3L2_BIK-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
A0A452H3N6_BMF-01       --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
A0A493T7X1_BMF-01       --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-02       --------------------------------------------------
A0A3Q2UCA0_BMF-01       --------------------------------------------------
A0A493T7X1_BMF-02       --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-03       --------------------------------------------------
A0A3Q2UCA0_BMF-04       --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           --------------------------------------------------
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A286XXB0_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-03       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           --------------------------------------------------
G1PAU1_BMF-01           --------------------------------------------------
L8IXF5_BMF-01           --------------------------------------------------
Q05KI3_BMF-02           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
A0A452F2E0_BMF-02       --------------------------------------------------
A0A452F2E0_BMF-01       --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
A0A287CXH0_BMF-01       --------------------------------------------------
A0A287CXH0_BMF-02       --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       ----------------------------------------atgaccagaa
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       ----------------------------------------atgaccagaa
M3YAD5_BMF-01           --------------------------------------------------
U6CSY8_BMF-01           --------------------------------------------------
A0A452SED0_BMF-01       --------------------------------------------------
A0A384D070_BMF-01       --------------------------------------------------
J9PB65_BMF-04           --------------------------------------------------
J9PB65_BMF-03           --------------------------------------------------
J9PB65_BMF-02           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
A0A2K5KGP2_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
F7CM09_BMF-03           --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
F7CM09_BMF-01           --------------------------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K5Z4A9_BMF-02       --------------------------------------------------
A0A2K5MJW4_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K5Z4A9_BMF-01       --------------------------------------------------
A0A2K5KGP2_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-03       --------------------------------------------------
A0A2K6L919_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-02       --------------------------------------------------
A0A2K6TW78_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-03       --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-02       --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-01       --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-01       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
G3VRY3_BAD-02           --------------------------------------------------
G3VRY3_BAD-01           --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
Q61337_BAD-01           --------------------------------------------------
Q61337_BAD-05           --------------------------------------------------
O35147_BAD-01           --------------------------------------------------
Q6P7C5_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A8MXU7_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2K5VCA9_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K5M0A7_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
A0A452ER54_BAD-01       --------------------------------------------------
A0A452ER54_BAD-02       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
A0A287CT05_BAD-02       --------------------------------------------------
A0A287CT05_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2R8Z688_BAD-03       --------------------------------------------------
A8MXU7_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A2K5VCA9_BAD-03       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K5HKU7_BAD-02       --------------------------------------------------
A0A2K6N196_BAD-02       --------------------------------------------------
A0A2K6PUL3_BAD-02       --------------------------------------------------
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2K5HKU7_BAD-01       --------------------------------------------------
A0A2K6N196_BAD-01       --------------------------------------------------
A0A2K6PUL3_BAD-01       --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
A0A2R8Z688_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       -atggggaccccagagaatcccttatctgctcccacacacgtcccaggcc
A0A452RJM6_BAD-01       --------------------------------------------------
G1MI17_BAD-01           -gtggggaccccagagaatccctcatctgctcccacacatggcccaggca
A0A384DJL2_BAD-01       --------------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
F7FUT7_BIK-02           gcgcccgtctcgggcgcagggaaaacagcgacgcacgagacaaagcaagt
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
G3UH24_HRK-01           --------------------------------------------------
A0A452DXE5_HRK-01       --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-03          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          --------------------------------------------------
F1RM01_BBC3-02          --------------------------------------------------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      gaagagggtcgaccccggggtgccccagcccccaaagtcagggaggggcg
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B1IH05_BAD-01       --------------------------------------------------
A0A3B4CPH6_BAD-01       --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
A0A3B4UNJ0_BMF-01       --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B3QX41_BAD-01       --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
A0A3P8Y761_BAD-01       --------------------------------------------------
A0A3B3RH63_BMF-01       --------------------------------------------------
A0A452IFQ4_BAD-01       --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       -----------------------------------ggcggcgctggtaaa
A0A3Q2U844_BCL2L11      -----------------------------------atggccaagcagccc
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------atgttcccggcggcggcg
A0A3Q2GRS5_BCL2L11      --------------------------------atgttcccggcggcggcg
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      -----------------------------atgttcccggcggctgcgacc
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgc
C1KGB6_BCL2L11-01       ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgc
C1KGB6_BCL2L11-02       ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgc
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       gggctctgaaggcgagtcccaggctttgtctcccgcgcttctttcgtgct
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       ccagtctgagcggagctgcagggctgtgcaggtttcacttcgctccgcgc
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3B1K1X5_BMF-01       --------------------------------------------------
A0A3B4CNJ8_BMF-01       --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
A0A3P9A5G8_BAD-02       --------------------------------------------------
A0A3P9A5G8_BAD-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A0A3B1JLM2_BAD-01       --------------------------------------------------
A0A3B4DUY7_BAD-01       --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
A0A3Q2Y0E4_BAD-01       --------------------------------------------------
A0A3B3BQF7_BAD-01       --------------------------------------------------
A0A3P9HNZ2_BAD-01       --------------------------------------------------
A0A3B3HDU2_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-02       --------------------------------------------------
A0A3Q3AEL8_BAD-01       --------------------------------------------------
A0A3Q3AEL8_BAD-02       --------------------------------------------------
A0A3Q2QC80_BAD-01       --------------------------------------------------
A0A3Q2D5S0_BAD-01       --------------------------------------------------
A0A3B5L9R9_BAD-01       --------------------------------------------------
A0A3B5Q2N7_BAD-01       --------------------------------------------------
A0A3P9Q7C3_BAD-01       --------------------------------------------------
A0A3B3YFR1_BAD-01       --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A3B3UA11_BAD-01       --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A3P9B2E4_BAD-01       --------------------------------------------------
A0A3Q4GGN3_BAD-01       --------------------------------------------------
A0A3P8QRJ7_BAD-01       --------------------------------------------------
A0A3Q3C680_BAD-01       --------------------------------------------------
A0A3B4GXJ6_BAD-01       --------------------------------------------------
A0A3Q0QNQ2_BAD-02       --------------------------------------------------
A0A3Q0QNQ2_BAD-01       --------------------------------------------------
A0A3Q3WTY4_BAD-01       --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
A0A3P8WI83_BAD-02       --------------------------------------------------
A0A3P8WI83_BAD-01       --------------------------------------------------
A0A3Q3FKT9_BAD-03       --------------------------------------------------
A0A3Q3FKT9_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-02       --------------------------------------------------
A0A3Q3R5S3_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-02       --------------------------------------------------
A0A3B5BAL2_BAD-01       --------------------------------------------------
A0A3Q1GWH9_BAD-01       --------------------------------------------------
A0A3Q1CPU7_BAD-01       --------------------------------------------------
A0A3P8TWH6_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
A0A3B4VFC5_BAD-01       --------------------------------------------------
A0A3B4W9T1_BAD-01       --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8ZIE7_BMF-01       --------------------------------------------------
A0A3B4B6Y3_BMF-01       --------------------------------------------------
A0A3Q2CXC4_BMF-02       --------------------------------------------------
A0A3Q2CXC4_BMF-01       --------------------------------------------------
A0A3B5QK08_BMF-02       --------------------------------------------------
A0A3B5QK08_BMF-01       --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
A0A3B3WU80_BMF-01       --------------------------------------------------
A0A3P9Q8E2_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-02       --------------------------------------------------
A0A3Q2PJX9_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-03       --------------------------------------------------
A0A3Q2YCX7_BMF-01       --------------------------------------------------
A0A3Q2YCX7_BMF-02       --------------------------------------------------
A0A3B3CGR9_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-04       --------------------------------------------------
A0A3P9K487_BMF-02       --------------------------------------------------
A0A3P9K487_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-03       --------------------------------------------------
A0A3B3HAU1_BMF-02       --------------------------------------------------
A0A3B3HAU1_BMF-04       --------------------------------------------------
A0A3Q3GUU5_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-02       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A3Q4G1I4_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-02       --------------------------------------------------
A0A3B4ETH0_BMF-01       --------------------------------------------------
A0A3Q3C5V2_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-03       --------------------------------------------------
A0A3P8UA78_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-02       --------------------------------------------------
A0A3Q3VLX6_BMF-01       --------------------------------------------------
A0A3Q2ZA20_BMF-01       --------------------------------------------------
A0A3Q3RVI2_BMF-02       --------------------------------------------------
A0A3Q3RVI2_BMF-01       --------------------------------------------------
A0A3Q1IPR4_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-02       --------------------------------------------------
A0A3Q1FVH7_BMF-01       --------------------------------------------------
A0A3Q1FVH7_BMF-02       --------------------------------------------------
A0A3B5B8F6_BMF-01       --------------------------------------------------
A0A3Q1D1K3_BMF-01       --------------------------------------------------
A0A3P8RKY9_BMF-01       --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
A0A3B4U5H8_BMF-01       --------------------------------------------------
A0A3B4WM88_BMF-01       --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A452QUG1_BIK-01       --------------------------------------------------
A0A452V3L2_BIK-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
A0A452H3N6_BMF-01       --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
A0A493T7X1_BMF-01       --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-02       --------------------------------------------------
A0A3Q2UCA0_BMF-01       --------------------------------------------------
A0A493T7X1_BMF-02       --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-03       --------------------------------------------------
A0A3Q2UCA0_BMF-04       --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           --------------atgcccggagcgggcgtattttggaaacaataccgc
A2AV74_BMF-02           --------------atgtc-------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A286XXB0_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-03       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           --------------------atgccccgagcgggggtattttggaaacaa
G1PAU1_BMF-01           --------------------------------------------------
L8IXF5_BMF-01           --------------------------------------------------
Q05KI3_BMF-02           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
A0A452F2E0_BMF-02       --------------------------------------------------
A0A452F2E0_BMF-01       --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
A0A287CXH0_BMF-01       --------------------------------------------------
A0A287CXH0_BMF-02       --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       ccagcccgggtcagaagaaaaggccaaggtgggagtggctctgggaaggc
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       ccagcccgggtcagaagaaaaggccaaggtgggagtggctctgggaaggc
M3YAD5_BMF-01           --------------------------------------------------
U6CSY8_BMF-01           --------------------------------------------------
A0A452SED0_BMF-01       --------------------------------------------------
A0A384D070_BMF-01       --------------------------------------------------
J9PB65_BMF-04           --------------------------------------------------
J9PB65_BMF-03           --------------------------------------------------
J9PB65_BMF-02           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
A0A2K5KGP2_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
F7CM09_BMF-03           --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
F7CM09_BMF-01           --------------------------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K5Z4A9_BMF-02       --------------------------------------------------
A0A2K5MJW4_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K5Z4A9_BMF-01       --------------------------------------------------
A0A2K5KGP2_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-03       --------------------------------------------------
A0A2K6L919_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-02       --------------------------------------------------
A0A2K6TW78_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-03       --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-02       --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-01       --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-01       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
G3VRY3_BAD-02           --------------------------------------------------
G3VRY3_BAD-01           --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
Q61337_BAD-01           --------------------------------------------------
Q61337_BAD-05           --------------------------------------------------
O35147_BAD-01           --------------------------------------------------
Q6P7C5_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A8MXU7_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2K5VCA9_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K5M0A7_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
A0A452ER54_BAD-01       --------------------------------------------------
A0A452ER54_BAD-02       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
A0A287CT05_BAD-02       --------------------------------------------------
A0A287CT05_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2R8Z688_BAD-03       --------------------------------------------------
A8MXU7_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A2K5VCA9_BAD-03       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K5HKU7_BAD-02       --------------------------------------------------
A0A2K6N196_BAD-02       --------------------------------------------------
A0A2K6PUL3_BAD-02       --------------------------------------------------
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2K5HKU7_BAD-01       --------------------------------------------------
A0A2K6N196_BAD-01       --------------------------------------------------
A0A2K6PUL3_BAD-01       --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
A0A2R8Z688_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       cagggatgtcgggaactgagcagcgggaggcgaggaagggacccaggacg
A0A452RJM6_BAD-01       --------------------------------------------------
G1MI17_BAD-01           aaaggaagtcgggaactgatcggcgggagacgaggaagggacccaggacg
A0A384DJL2_BAD-01       --------------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
F7FUT7_BIK-02           ttgcagaacagcagggggcagagaggccgtaaacaagccaaccggccgca
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------ccccagggcgcagttaggcactacccgtccccgcggg-----
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
G3UH24_HRK-01           --------------------------------------------------
A0A452DXE5_HRK-01       --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-03          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          --------------------------------------------------
F1RM01_BBC3-02          --------------------------------------------------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      ggggggcggcacggaggggcggccacacccagggcgcgcgcccgctgggg
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B1IH05_BAD-01       --------------------------------------------------
A0A3B4CPH6_BAD-01       --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
A0A3B4UNJ0_BMF-01       --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B3QX41_BAD-01       --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
A0A3P8Y761_BAD-01       --------------------------------------------------
A0A3B3RH63_BMF-01       --------------------------------------------------
A0A452IFQ4_BAD-01       --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
K7GA86_BCL2L11-01       -atggggcgggcagggcgcgggccgggagctgcacaatcagtgcaggcgc
U3IW89_BCL2L11-01       cacggggcggggacgggacgggacgggag--gggcgggcagcggcag---
A0A3Q2U844_BCL2L11      cccgaggcgaaggcgccccgcgaccgccg--ggccgggcggctgccgccg
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      gccggggcagcgcgggccagaggcgcggcgcgcggagccctcggctgccc
A0A3Q2GRS5_BCL2L11      gccggggcagcgcgggccagaggcgcggcgcgcggagccctcggctgccc
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      -------------------------------------atgcccgcgcgtg
A0A2R8M6L7_BCL2L11      cgggccgcgagggccagaggggcagcgcgcggagccgtcggctgcccggc
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       agcctccaggtctcgagcttgcaggagcgtttggtcccacgtcgccgccg
C1KGB6_BCL2L11-01       agcctccaggtctcgagcttgcaggagcgtttggtcccacgtcgccgccg
C1KGB6_BCL2L11-02       agcctccaggtctcgagcttgcaggagcgtttggtcccacgtcgccgccg
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       gagggtcagggagctccgggtcggcgaaggacgcgagcgggacgccgcgg
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       agcctccaggtctgggtcttgcgagagggctccgtcccgcgtcgccgccg
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3B1K1X5_BMF-01       --------------------------------------------------
A0A3B4CNJ8_BMF-01       --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
A0A3P9A5G8_BAD-02       --------------------------------------------------
A0A3P9A5G8_BAD-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A0A3B1JLM2_BAD-01       --------------------------------------------------
A0A3B4DUY7_BAD-01       --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
A0A3Q2Y0E4_BAD-01       --------------------------------------------------
A0A3B3BQF7_BAD-01       --------------------------------------------------
A0A3P9HNZ2_BAD-01       --------------------------------------------------
A0A3B3HDU2_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-02       --------------------------------------------------
A0A3Q3AEL8_BAD-01       --------------------------------------------------
A0A3Q3AEL8_BAD-02       --------------------------------------------------
A0A3Q2QC80_BAD-01       --------------------------------------------------
A0A3Q2D5S0_BAD-01       --------------------------------------------------
A0A3B5L9R9_BAD-01       --------------------------------------------------
A0A3B5Q2N7_BAD-01       --------------------------------------------------
A0A3P9Q7C3_BAD-01       --------------------------------------------------
A0A3B3YFR1_BAD-01       --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A3B3UA11_BAD-01       --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A3P9B2E4_BAD-01       --------------------------------------------------
A0A3Q4GGN3_BAD-01       --------------------------------------------------
A0A3P8QRJ7_BAD-01       --------------------------------------------------
A0A3Q3C680_BAD-01       --------------------------------------------------
A0A3B4GXJ6_BAD-01       --------------------------------------------------
A0A3Q0QNQ2_BAD-02       --------------------------------------------------
A0A3Q0QNQ2_BAD-01       --------------------------------------------------
A0A3Q3WTY4_BAD-01       --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
A0A3P8WI83_BAD-02       --------------------------------------------------
A0A3P8WI83_BAD-01       --------------------------------------------------
A0A3Q3FKT9_BAD-03       ------------------------------------------------at
A0A3Q3FKT9_BAD-01       ------------------------------------------------at
A0A3Q3RXS8_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-02       --------------------------------------------------
A0A3Q3R5S3_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-02       --------------------------------------------------
A0A3B5BAL2_BAD-01       --------------------------------------------------
A0A3Q1GWH9_BAD-01       --------------------------------------------------
A0A3Q1CPU7_BAD-01       --------------------------------------------------
A0A3P8TWH6_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
A0A3B4VFC5_BAD-01       --------------------------------------------------
A0A3B4W9T1_BAD-01       --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        -----------------------------------------atgcgttct
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8ZIE7_BMF-01       --------------------------------------------------
A0A3B4B6Y3_BMF-01       --------------------------------------------------
A0A3Q2CXC4_BMF-02       --------------------------------------------------
A0A3Q2CXC4_BMF-01       --------------------------------------------------
A0A3B5QK08_BMF-02       --------------------------------------------------
A0A3B5QK08_BMF-01       --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
A0A3B3WU80_BMF-01       --------------------------------------------------
A0A3P9Q8E2_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-02       --------------------------------------------------
A0A3Q2PJX9_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-03       --------------------------------------------------
A0A3Q2YCX7_BMF-01       --------------------------------------------------
A0A3Q2YCX7_BMF-02       --------------------------------------------------
A0A3B3CGR9_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-04       --------------------------------------------------
A0A3P9K487_BMF-02       --------------------------------------------------
A0A3P9K487_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-03       --------------------------------------------------
A0A3B3HAU1_BMF-02       --------------------------------------------------
A0A3B3HAU1_BMF-04       --------------------------------------------------
A0A3Q3GUU5_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-02       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A3Q4G1I4_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-02       --------------------------------------------------
A0A3B4ETH0_BMF-01       --------------------------------------------------
A0A3Q3C5V2_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-03       --------------------------------------------------
A0A3P8UA78_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-02       --------------------------------------------------
A0A3Q3VLX6_BMF-01       --------------------------------------------------
A0A3Q2ZA20_BMF-01       --------------------------------------------------
A0A3Q3RVI2_BMF-02       --------------------------------------------------
A0A3Q3RVI2_BMF-01       --------------------------------------------------
A0A3Q1IPR4_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-02       --------------------------------------------------
A0A3Q1FVH7_BMF-01       --------------------------------------------------
A0A3Q1FVH7_BMF-02       --------------------------------------------------
A0A3B5B8F6_BMF-01       --------------------------------------------------
A0A3Q1D1K3_BMF-01       --------------------------------------------------
A0A3P8RKY9_BMF-01       --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
A0A3B4U5H8_BMF-01       --------------------------------------------------
A0A3B4WM88_BMF-01       --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A452QUG1_BIK-01       --------------------------------------------------
A0A452V3L2_BIK-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
A0A452H3N6_BMF-01       --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
A0A493T7X1_BMF-01       --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-02       --------------------------------------------------
A0A3Q2UCA0_BMF-01       --------------------------------------------------
A0A493T7X1_BMF-02       --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-03       --------------------------------------------------
A0A3Q2UCA0_BMF-04       --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           gcggtgtgccgtggcctcctcccgcgccagctcgcgcctgcagcagtcgc
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A286XXB0_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-03       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           taccgcacggtgttgagtctcgtccaccagcgcccgccagcgcttgctgc
G1PAU1_BMF-01           --------------------------------------------------
L8IXF5_BMF-01           --------------------------------------------------
Q05KI3_BMF-02           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
A0A452F2E0_BMF-02       --------------------------------------------------
A0A452F2E0_BMF-01       --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
A0A287CXH0_BMF-01       atgccccgagcgggcgtattttggaaacaataccgcgcggtgcgcagtgg
A0A287CXH0_BMF-02       -----------------gtttt----------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       ccagggaggaggtgtggagcctccttgagcagtgaggcaggccacatttg
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       ccagggaggaggtgtggagcctccttgagcagtgaggcaggccacatttg
M3YAD5_BMF-01           --------------------------------------------------
U6CSY8_BMF-01           --------------------------------------------------
A0A452SED0_BMF-01       --------------------------------------------------
A0A384D070_BMF-01       --------------------------------------------------
J9PB65_BMF-04           --------------------------------------------------
J9PB65_BMF-03           --------------------------------------------------
J9PB65_BMF-02           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
A0A2K5KGP2_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
F7CM09_BMF-03           --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
F7CM09_BMF-01           --------------------------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K5Z4A9_BMF-02       --------------------------------------------------
A0A2K5MJW4_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K5Z4A9_BMF-01       --------------------------------------------------
A0A2K5KGP2_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-03       --------------------------------------------------
A0A2K6L919_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-02       --------------------------------------------------
A0A2K6TW78_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-03       --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-02       --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-01       --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-01       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
G3VRY3_BAD-02           --------------------------------------------------
G3VRY3_BAD-01           --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
Q61337_BAD-01           --------------------------------------------------
Q61337_BAD-05           --------------------------------------------------
O35147_BAD-01           --------------------------------------------------
Q6P7C5_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A8MXU7_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2K5VCA9_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K5M0A7_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
A0A452ER54_BAD-01       --------------------------------------------------
A0A452ER54_BAD-02       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
A0A287CT05_BAD-02       --------------------------------------------------
A0A287CT05_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2R8Z688_BAD-03       --------------------------------------------------
A8MXU7_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A2K5VCA9_BAD-03       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K5HKU7_BAD-02       --------------------------------------------------
A0A2K6N196_BAD-02       --------------------------------------------------
A0A2K6PUL3_BAD-02       --------------------------------------------------
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2K5HKU7_BAD-01       --------------------------------------------------
A0A2K6N196_BAD-01       --------------------------------------------------
A0A2K6PUL3_BAD-01       --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
A0A2R8Z688_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       aaggcggtaggcagggagcaagtcccgcggcgggggcggagactgggtcg
A0A452RJM6_BAD-01       --------------------------------------------------
G1MI17_BAD-01           accgcgcttgccc-------------------------------------
A0A384DJL2_BAD-01       --------------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
F7FUT7_BIK-02           cttgtagcggttctgttgctaatgccattcagaccccagtccagcattcc
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           ----------------------------gcaggctgccgccccccacccc
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
G3UH24_HRK-01           --------------------------------------------------
A0A452DXE5_HRK-01       --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-03          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          --------------------------------------------------
F1RM01_BBC3-02          --------------------------------------------------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      gcggcgacagggggcggctcgcgggccgtggagtctgcggctcctgcggg
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B1IH05_BAD-01       --------------------------------------------------
A0A3B4CPH6_BAD-01       --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
A0A3B4UNJ0_BMF-01       --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B3QX41_BAD-01       --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
A0A3P8Y761_BAD-01       --------------------------------------------------
A0A3B3RH63_BMF-01       --------------------------------------------------
A0A452IFQ4_BAD-01       --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
K7GA86_BCL2L11-01       cgcgccgcgtcccagccttttgtcccgtggcgggggggtccgagcgcgcg
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      ggagaggggccgggcccggccgtcccgctgcggcccggagcccccgccgc
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      tgcggagcgcggcggcggcgggcgggcggcaagcggcaggctctgcgctg
A0A3Q2GRS5_BCL2L11      tgcggagcgcggcggcggcgggcgggcggcaagcggcaggctctgcgctg
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      tgtgtgcaccagtttcacaagctgttgacattgttactgtcttttgtttg
A0A2R8M6L7_BCL2L11      ggagcgcagcggcgggctggccggaaggcgtgggctctgtgctgcgccgg
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       ccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacag
C1KGB6_BCL2L11-01       ccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacag
C1KGB6_BCL2L11-02       ccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacag
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       ggctcgggcccggacgcgacggtcggaagggaaggggcggacaaaaaaag
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       ccgccgccgccgccaccggattctcacagtcgccctacgcgccccagccc
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3B1K1X5_BMF-01       --------------------------------------------------
A0A3B4CNJ8_BMF-01       --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
A0A3P9A5G8_BAD-02       --------------------------------------------------
A0A3P9A5G8_BAD-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A0A3B1JLM2_BAD-01       -----------------------------------atgagcaatcagtat
A0A3B4DUY7_BAD-01       -----------------------------------atgagcaatcaatat
A3KND0_BMF-01           --------------------------------------------------
A0A3Q2Y0E4_BAD-01       --------------------------------------------------
A0A3B3BQF7_BAD-01       --------------------------------------------------
A0A3P9HNZ2_BAD-01       --------------------------------------------------
A0A3B3HDU2_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-02       --------------------------------------------------
A0A3Q3AEL8_BAD-01       --------------------------------------------------
A0A3Q3AEL8_BAD-02       --------------------------------------------------
A0A3Q2QC80_BAD-01       -------------------------------atgtcgccaagtagcagca
A0A3Q2D5S0_BAD-01       --------------------------------------------------
A0A3B5L9R9_BAD-01       --------------------------------------------------
A0A3B5Q2N7_BAD-01       --------------------------------------------------
A0A3P9Q7C3_BAD-01       --------------------------------------------------
A0A3B3YFR1_BAD-01       --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A3B3UA11_BAD-01       --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A3P9B2E4_BAD-01       --------------------------------------------------
A0A3Q4GGN3_BAD-01       --------------------------------------------------
A0A3P8QRJ7_BAD-01       --------------------------------------------------
A0A3Q3C680_BAD-01       --------------------------------------------------
A0A3B4GXJ6_BAD-01       --------------------------------------------------
A0A3Q0QNQ2_BAD-02       --------------------------------------------------
A0A3Q0QNQ2_BAD-01       --------------------------------------------------
A0A3Q3WTY4_BAD-01       --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
A0A3P8WI83_BAD-02       --------------------------------------------------
A0A3P8WI83_BAD-01       --------------------------------------------------
A0A3Q3FKT9_BAD-03       gaagtgtaacaacaagtgttatcattttataagacttgtttttgtcaaaa
A0A3Q3FKT9_BAD-01       gacac-taacagcaagt---------------------------------
A0A3Q3RXS8_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-02       --------------------------------------------------
A0A3Q3R5S3_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-02       --------------------------------------------------
A0A3B5BAL2_BAD-01       --------------------------------------------------
A0A3Q1GWH9_BAD-01       --------------------------------------------------
A0A3Q1CPU7_BAD-01       --------------------------------------------------
A0A3P8TWH6_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
A0A3B4VFC5_BAD-01       --------------------------------------------------
A0A3B4W9T1_BAD-01       --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        tccggatcgcttggctctaggattcgggggctgttggaatcggcaggatg
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8ZIE7_BMF-01       --------------------------------------------------
A0A3B4B6Y3_BMF-01       --------------------------------------------------
A0A3Q2CXC4_BMF-02       --------------------------------------------------
A0A3Q2CXC4_BMF-01       --------------------------------------------------
A0A3B5QK08_BMF-02       --------------------------------------------------
A0A3B5QK08_BMF-01       --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
A0A3B3WU80_BMF-01       --------------------------------------------------
A0A3P9Q8E2_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-02       --------------------------------------------------
A0A3Q2PJX9_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-03       --------------------------------------------------
A0A3Q2YCX7_BMF-01       --------------------------------------------------
A0A3Q2YCX7_BMF-02       --------------------------------------------------
A0A3B3CGR9_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-04       --------------------------------------------------
A0A3P9K487_BMF-02       --------------------------------------------------
A0A3P9K487_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-03       --------------------------------------------------
A0A3B3HAU1_BMF-02       --------------------------------------------------
A0A3B3HAU1_BMF-04       --------------------------------------------------
A0A3Q3GUU5_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-02       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A3Q4G1I4_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-02       --------------------------------------------------
A0A3B4ETH0_BMF-01       --------------------------------------------------
A0A3Q3C5V2_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-03       --------------------------------------------------
A0A3P8UA78_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-02       --------------------------------------------------
A0A3Q3VLX6_BMF-01       --------------------------------------------------
A0A3Q2ZA20_BMF-01       --------------------------------------------------
A0A3Q3RVI2_BMF-02       --------------------------------------------------
A0A3Q3RVI2_BMF-01       --------------------------------------------------
A0A3Q1IPR4_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-02       --------------------------------------------------
A0A3Q1FVH7_BMF-01       --------------------------------------------------
A0A3Q1FVH7_BMF-02       --------------------------------------------------
A0A3B5B8F6_BMF-01       --------------------------------------------------
A0A3Q1D1K3_BMF-01       --------------------------------------------------
A0A3P8RKY9_BMF-01       --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
A0A3B4U5H8_BMF-01       --------------------------------------------------
A0A3B4WM88_BMF-01       --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A452QUG1_BIK-01       --------------------------------------------------
A0A452V3L2_BIK-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
A0A452H3N6_BMF-01       --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
A0A493T7X1_BMF-01       --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-02       --------------------------------------------------
A0A3Q2UCA0_BMF-01       --------------------------------------------------
A0A493T7X1_BMF-02       --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-03       --------------------------------------------------
A0A3Q2UCA0_BMF-04       --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           tgccgcagcccgcgccaccgcctcccaccgcagcccgctggagtttgccc
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A286XXB0_BMF-02       ----------------atgcccggggcgggcgtattttggaaacaatacc
A0A286XXB0_BMF-03       ---------------------------------gtttt------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           cgccgccgtccgttcgccgcgcctgccgccgctgcccgctgagctttttc
G1PAU1_BMF-01           --------------------------------------------------
L8IXF5_BMF-01           --------------------------------------------------
Q05KI3_BMF-02           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
A0A452F2E0_BMF-02       --------------------------------------------------
A0A452F2E0_BMF-01       --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
A0A287CXH0_BMF-01       cctcctccggcgcccgccagagtccgcagccgccgccggccctgccagcg
A0A287CXH0_BMF-02       --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       gggagggtgtcatcctcagtggtactttatcaccaggtcgtttgtcatca
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       gggagggtgtcatcctcagtggtactttatcaccaggtcgtttgtcatca
M3YAD5_BMF-01           --------------------------------------------------
U6CSY8_BMF-01           --------------------------------------------------
A0A452SED0_BMF-01       --------------------------------------------------
A0A384D070_BMF-01       --------------------------------------------------
J9PB65_BMF-04           --------------------------------------------------
J9PB65_BMF-03           --------------------------------------------------
J9PB65_BMF-02           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
A0A2K5KGP2_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
F7CM09_BMF-03           --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
F7CM09_BMF-01           --------------------------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K5Z4A9_BMF-02       --------------------------------------------------
A0A2K5MJW4_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K5Z4A9_BMF-01       --------------------------------------------------
A0A2K5KGP2_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-03       --------------------------------------------------
A0A2K6L919_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-02       --------------------------------------------------
A0A2K6TW78_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-03       --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-02       --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-01       --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-01       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
G3VRY3_BAD-02           --------------------------------------------------
G3VRY3_BAD-01           --------------------------------------------------
A0A1U7Q4V0_BAD-01       -------------------------------------------atgggaa
Q61337_BAD-01           -------------------------------------------atgggaa
Q61337_BAD-05           --------------------------------------------------
O35147_BAD-01           -------------------------------------------atgggaa
Q6P7C5_BAD-01           -------------------------------------------atgggaa
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       -------------------------------------atgggcatcccag
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A8MXU7_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2K5VCA9_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K5M0A7_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
A0A452ER54_BAD-01       --------------------------------------------------
A0A452ER54_BAD-02       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
A0A287CT05_BAD-02       ----------------------------atggggatcccagaaaaagccc
A0A287CT05_BAD-01       ----------------------------atggggatcccagaaaaagccc
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2R8Z688_BAD-03       --------------------------------------------------
A8MXU7_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A2K5VCA9_BAD-03       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K5HKU7_BAD-02       --------------------------------------------------
A0A2K6N196_BAD-02       --------------------------------------------------
A0A2K6PUL3_BAD-02       --------------------------------------------------
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2K5HKU7_BAD-01       --------------------------------------------------
A0A2K6N196_BAD-01       --------------------------------------------------
A0A2K6PUL3_BAD-01       --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
A0A2R8Z688_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       gaagcggccacgccccctggccagccctggtgacatttcaaaagctgatt
A0A452RJM6_BAD-01       --------------------------------------------------
G1MI17_BAD-01           --------------------------------------------------
A0A384DJL2_BAD-01       --------------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
F7FUT7_BIK-02           gcgctcggggtgcgagaggcagctcccggggcggggcggcgcggggcggg
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           tcccggaacctttctgatttatctct------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
G3UH24_HRK-01           --------------------------------------------------
A0A452DXE5_HRK-01       --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-03          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          --------------------------------------------------
F1RM01_BBC3-02          --------------------------------------------------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      cgggggctgcgccccagcaacagccggttattggccccgcgctcgcctgg
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3B1IH05_BAD-01       --------------------------------------------------
A0A3B4CPH6_BAD-01       --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
A0A3B4UNJ0_BMF-01       --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B3QX41_BAD-01       --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
A0A3P8Y761_BAD-01       --------------------------------------------------
A0A3B3RH63_BMF-01       --------------------------------------------------
A0A452IFQ4_BAD-01       --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
K7GA86_BCL2L11-01       gctgcccgattcc--------------------cagctccggccggggcg
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3Q2U844_BCL2L11      gctgcccggcgccgcccggcccgcctcgcccggcagccccggcccgttcg
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      tcctggcgcctctgagcgcgagtcccgggctttgtctcccccgctgccta
A0A3Q2GRS5_BCL2L11      tcctggcgcctctgagcgcgagtcccgggctttgtctcccccgctgccta
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      gggttacgaagtttagtcccaccctctaccaaacaaaaattatgtcttta
A0A2R8M6L7_BCL2L11      ggactctgaacccgagtcccgggctttgtctcctgcattgtcttcgtggt
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       tcgccctgcgcgtcctgttctctgcggccagcatcgcttcagactgctgg
C1KGB6_BCL2L11-01       tcgccctgcgcgtcctgttctctgcggccagcatcgcttcagactgctgg
C1KGB6_BCL2L11-02       tcgccctgcgcgtcctgttctctgcggccagcatcgcttcagactgctgg
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       accaa---------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       actgcggccagcatcgccacgggctgctcgcttt----------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3B1K1X5_BMF-01       --------------------------------------------------
A0A3B4CNJ8_BMF-01       --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
A0A3P9A5G8_BAD-02       --------------------------------------------------
A0A3P9A5G8_BAD-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A0A3B1JLM2_BAD-01       ctgctaaaactgaggagagctcgttttaattgcgacgaggagggatatag
A0A3B4DUY7_BAD-01       ctgcagaaactgaggagagctcgttttaattgcgaagaggagcgatataa
A3KND0_BMF-01           --------------------------------------------------
A0A3Q2Y0E4_BAD-01       --------------------------------------------------
A0A3B3BQF7_BAD-01       --------------------------------------------------
A0A3P9HNZ2_BAD-01       --------------------------------------------------
A0A3B3HDU2_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-02       --------------------------------------------------
A0A3Q3AEL8_BAD-01       --------------------------------------------------
A0A3Q3AEL8_BAD-02       --------------------------------------------------
A0A3Q2QC80_BAD-01       gccatattggatgctttccttacccactgagaaatcagatcaactcgagt
A0A3Q2D5S0_BAD-01       --------------------------------------------------
A0A3B5L9R9_BAD-01       --------------------------------------------------
A0A3B5Q2N7_BAD-01       --------------------------------------------------
A0A3P9Q7C3_BAD-01       --------------------------------------------------
A0A3B3YFR1_BAD-01       --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A3B3UA11_BAD-01       --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A3P9B2E4_BAD-01       --------------------------------------------------
A0A3Q4GGN3_BAD-01       --------------------------------------------------
A0A3P8QRJ7_BAD-01       --------------------------------------------------
A0A3Q3C680_BAD-01       --------------------------------------------------
A0A3B4GXJ6_BAD-01       --------------------------------------------------
A0A3Q0QNQ2_BAD-02       --------------------------------------------------
A0A3Q0QNQ2_BAD-01       --------------------------------------------------
A0A3Q3WTY4_BAD-01       --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
A0A3P8WI83_BAD-02       --------------------------------------------------
A0A3P8WI83_BAD-01       --------------------------------------------------
A0A3Q3FKT9_BAD-03       agcagtcggttatctgcgcaggttacggcactgtgaatacctttggaccg
A0A3Q3FKT9_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-02       --------------------------------------------------
A0A3Q3R5S3_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-02       --------------------------------------------------
A0A3B5BAL2_BAD-01       --------------------------------------------------
A0A3Q1GWH9_BAD-01       --------------------------------------------------
A0A3Q1CPU7_BAD-01       --------------------------------------------------
A0A3P8TWH6_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
A0A3B4VFC5_BAD-01       --------------------------------------------------
A0A3B4W9T1_BAD-01       --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        ggaggaattggtaagaagccagccccgggcacatcaaggtctcaccagtg
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8ZIE7_BMF-01       --------------------------------------------------
A0A3B4B6Y3_BMF-01       --------------------------------------------------
A0A3Q2CXC4_BMF-02       --------------------------------------------------
A0A3Q2CXC4_BMF-01       --------------------------------------------------
A0A3B5QK08_BMF-02       --------------------------------------------------
A0A3B5QK08_BMF-01       --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
A0A3B3WU80_BMF-01       --------------------------------------------------
A0A3P9Q8E2_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-02       --------------------------------------------------
A0A3Q2PJX9_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-03       --------------------------------------------------
A0A3Q2YCX7_BMF-01       --------------------------------------------------
A0A3Q2YCX7_BMF-02       --------------------------------------------------
A0A3B3CGR9_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-04       --------------------------------------------------
A0A3P9K487_BMF-02       --------------------------------------------------
A0A3P9K487_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-03       --------------------------------------------------
A0A3B3HAU1_BMF-02       --------------------------------------------------
A0A3B3HAU1_BMF-04       --------------------------------------------------
A0A3Q3GUU5_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-02       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A3Q4G1I4_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-02       --------------------------------------------------
A0A3B4ETH0_BMF-01       --------------------------------------------------
A0A3Q3C5V2_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-03       --------------------------------------------------
A0A3P8UA78_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-02       --------------------------------------------------
A0A3Q3VLX6_BMF-01       --------------------------------------------------
A0A3Q2ZA20_BMF-01       --------------------------------------------------
A0A3Q3RVI2_BMF-02       --------------------------------------------------
A0A3Q3RVI2_BMF-01       --------------------------------------------------
A0A3Q1IPR4_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-02       --------------------------------------------------
A0A3Q1FVH7_BMF-01       --------------------------------------------------
A0A3Q1FVH7_BMF-02       --------------------------------------------------
A0A3B5B8F6_BMF-01       --------------------------------------------------
A0A3Q1D1K3_BMF-01       --------------------------------------------------
A0A3P8RKY9_BMF-01       --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
A0A3B4U5H8_BMF-01       --------------------------------------------------
A0A3B4WM88_BMF-01       --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       ----------------------------atgagaaagcggcggcgtcacg
A0A452QUG1_BIK-01       --------------------------------------------------
A0A452V3L2_BIK-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
A0A452H3N6_BMF-01       --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
A0A493T7X1_BMF-01       --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-02       --------------------------------------------------
A0A3Q2UCA0_BMF-01       --------------------------------------------------
A0A493T7X1_BMF-02       --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-03       --------------------------------------------------
A0A3Q2UCA0_BMF-04       --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           ccttcttcccaatcgagtgtgggcaccaagccccccgagtgttcttcacc
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A286XXB0_BMF-02       gcgcgcgccgccgccgccgcggacccgaccccccccgagtgttcgtcacg
A0A286XXB0_BMF-03       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           cctccttcccaatcgaatctgggcgccaagccccccgagtgctcgtcacg
G1PAU1_BMF-01           --------------------------------------------------
L8IXF5_BMF-01           --------------------------------------------------
Q05KI3_BMF-02           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
A0A452F2E0_BMF-02       --------------------------------------------------
A0A452F2E0_BMF-01       --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
A0A287CXH0_BMF-01       gctcccgcctccctgggagcggagtctcgctcccccaagtgttcatcacg
A0A287CXH0_BMF-02       --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       gtgtcgggccccacttcccccaggtagaagggaaaggagaaaggaaaggg
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       gtgtcgggccccacttcccccaggtagaagggaaaggagaaaggaaaggg
M3YAD5_BMF-01           --------------------------------------------------
U6CSY8_BMF-01           --------------------------------------------------
A0A452SED0_BMF-01       --------------------------------------------------
A0A384D070_BMF-01       --------------------------------------------------
J9PB65_BMF-04           --------------------atgggggcccgagaagggttgggctgcggg
J9PB65_BMF-03           --------------------------------------------------
J9PB65_BMF-02           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
A0A2K5KGP2_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
F7CM09_BMF-03           --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
F7CM09_BMF-01           --------------------------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K5Z4A9_BMF-02       --------------------------------------------------
A0A2K5MJW4_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K5Z4A9_BMF-01       --------------------------------------------------
A0A2K5KGP2_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-03       --------------------------------------------------
A0A2K6L919_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-02       --------------------------------------------------
A0A2K6TW78_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-03       --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-02       --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-01       --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-01       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
G3VRY3_BAD-02           --------------------------------------------------
G3VRY3_BAD-01           --------------------------------------------------
A0A1U7Q4V0_BAD-01       ccccaaaacagccctcgctggctcctgcacacgccctaggcgtgaggaag
Q61337_BAD-01           ccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaag
Q61337_BAD-05           --------------------------------------------------
O35147_BAD-01           ccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaag
Q6P7C5_BAD-01           ccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaag
G3TP47_BAD-01           --ggacccccagagaatccctcaccggcttccacacacgcccaaggcgtg
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       aaaatccctcatctgcttccacacacacccaaggaataaggaagtccgga
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A8MXU7_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2K5VCA9_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K5M0A7_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
A0A452ER54_BAD-01       -----------atggggaccccggagaatccctcagcggctcccacaact
A0A452ER54_BAD-02       --------------------------------------------------
W5P8G9_BAD-01           -----------caggggcctc-----------------------------
A0A287CT05_BAD-02       tcatcgcttccacgcacgctccaggcgcgaggaagtcagggaaggaggga
A0A287CT05_BAD-01       tcatcgcttccacgcacgctccaggcgcgaggaagtcagggaaggaggga
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2R8Z688_BAD-03       --------------------------------------------------
A8MXU7_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A2K5VCA9_BAD-03       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K5HKU7_BAD-02       --------------------------------------------------
A0A2K6N196_BAD-02       --------------------------------------------------
A0A2K6PUL3_BAD-02       --------------------------------------------------
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2K5HKU7_BAD-01       --------------------------------------------------
A0A2K6N196_BAD-01       --------------------------------------------------
A0A2K6PUL3_BAD-01       --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
A0A2R8Z688_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       gggccgggtcggtgacagttcccgttgcccaggcaactagggccgggctc
A0A452RJM6_BAD-01       --------------------------------------------------
G1MI17_BAD-01           --------------------------------------------------
A0A384DJL2_BAD-01       --------------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
F7FUT7_BIK-02           acccgggcggggcggggcgtcccggtccattaggtcccgcgcgggtcccc
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           -ccttggtgggtctctggggtccgtctcagcaggtctgccggtgggcccc
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
G3UH24_HRK-01           --------------------------------------------------
A0A452DXE5_HRK-01       --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          ---------------------------------------------gccaa
J9NTK9_BBC3-03          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          --------------------------------------------------
F1RM01_BBC3-02          --------------------------------------------------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      cgggcggggcgggcgcacgtggcggcggtgggggtggctgtgacagcgga
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      ---------------------------------------------atgtt
A0A3B1IH05_BAD-01       --------------------------------------------------
A0A3B4CPH6_BAD-01       --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
A0A3B4UNJ0_BMF-01       --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B3QX41_BAD-01       --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
A0A3P8Y761_BAD-01       --------------------------------------------------
A0A3B3RH63_BMF-01       --------------------------------------------------
A0A452IFQ4_BAD-01       --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
K7GA86_BCL2L11-01       gactcggagcgccggggtctggctgaggaattgctcttggagcctgactc
U3IW89_BCL2L11-01       -----------------------------------ccccgagc-gcggtc
A0A3Q2U844_BCL2L11      ccatccgctcgccgctcttc-------------ttcttcgtgcggaggtc
G1MV54_BCL2L11-01       ----------------tttt-------------tgctctgtgc-------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      ---------------atgccgctcagcgtgcggagttacttgtggatttg
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      agtggcgacaatcagggggctccgggtcggcgaaaggcgcgggctggacg
A0A3Q2GRS5_BCL2L11      agtggcgacaatcagggggctccgggtcggcgaaaggcgcgggctggacg
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      ttattttag-----------------------------------------
A0A2R8M6L7_BCL2L11      gacggtcaggggccgccgggtcggcgaaaggcgcgggtcggacgccgtgg
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       gttcgccccgctcccgccgccgccactcactcggcgcccttcccctggcc
C1KGB6_BCL2L11-01       gttcgccccgctcccgccgccgccactcactcggcgcccttcccctggcc
C1KGB6_BCL2L11-02       gttcgccccgctcccgccgccgccactcactcggcgcccttcccctggcc
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       ------gccccgctcccgccgccacccctttggcgccctttccttggccc
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3B1K1X5_BMF-01       --------------------------------------------------
A0A3B4CNJ8_BMF-01       --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
A0A3P9A5G8_BAD-02       --------------------------------------------------
A0A3P9A5G8_BAD-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A0A3B1JLM2_BAD-01       ccaagcacttaacagcagaacatcgactgaaggaggggggagagatacgc
A0A3B4DUY7_BAD-01       gaaagtaattaa------aacactgact------ggagagaaaggaacgc
A3KND0_BMF-01           --------------------------------------------------
A0A3Q2Y0E4_BAD-01       --------------------------------------------------
A0A3B3BQF7_BAD-01       --------------------------------------------------
A0A3P9HNZ2_BAD-01       --------------------------------------------------
A0A3B3HDU2_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-02       --------------------------------------------------
A0A3Q3AEL8_BAD-01       --------------------------------------------------
A0A3Q3AEL8_BAD-02       --------------------------------------------------
A0A3Q2QC80_BAD-01       ccaagttgcactttcatttctggtttgaattttccgaattcgtgtcttcc
A0A3Q2D5S0_BAD-01       ---------------------------atggctcagtcggtagagacttc
A0A3B5L9R9_BAD-01       --------------------------------------------------
A0A3B5Q2N7_BAD-01       --------------------------------------------------
A0A3P9Q7C3_BAD-01       --------------------------------------------------
A0A3B3YFR1_BAD-01       --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A3B3UA11_BAD-01       --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A3P9B2E4_BAD-01       --------------------------------------------------
A0A3Q4GGN3_BAD-01       --------------------------------------------------
A0A3P8QRJ7_BAD-01       --------------------------------------------------
A0A3Q3C680_BAD-01       --------------------------------------------------
A0A3B4GXJ6_BAD-01       --------------------------------------------------
A0A3Q0QNQ2_BAD-02       --------------------------------------------------
A0A3Q0QNQ2_BAD-01       --------------------------------------------------
A0A3Q3WTY4_BAD-01       --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
A0A3P8WI83_BAD-02       ------------------------atgaatgtagaagtgtccatctttcc
A0A3P8WI83_BAD-01       --------------------------------------------------
A0A3Q3FKT9_BAD-03       gcttacagcagggacagcacagagaataagatatcctgcttgggtgtgtt
A0A3Q3FKT9_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-02       --------------------------------------------------
A0A3Q3R5S3_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-02       --------------------------------------------------
A0A3B5BAL2_BAD-01       --------------------------------------------------
A0A3Q1GWH9_BAD-01       --------------------------------------------------
A0A3Q1CPU7_BAD-01       --------------------------------------------------
A0A3P8TWH6_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
A0A3B4VFC5_BAD-01       --------------------------------------------------
A0A3B4W9T1_BAD-01       --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        ----gcgcgggca------gcggcgggagc--------------------
Q9GL49_PMAIP1-01        gccggtgtgggcagacgaggcgggaggagcttcgtggttccttcggtccg
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      -------------------------------------------------a
A0A3Q2SZH6_BCL2L11      ---------------------------atg----------------gtga
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      ---------------------------atg----------ctcacggtga
A0A3B5QAM1_BCL2L11      ---------------------------atg----------c--------a
A0A3B5QAM1_BCL2L11      ---------------------------atg----------ctcacggtga
A0A3B3VNE0_BCL2L11      ---------------------------atg----------c--------a
A0A3B3YII5_BCL2L11      ---------------------------atg----------c--------a
A0A3B3YII5_BCL2L11      ---------------------------atg----------c--------a
A0A3Q3ESW6_BCL2L11      ---------------------------atgcaccgtccgtc---------
A0A3Q1ICY2_BCL2L11      ---------------------------atggatcc---------------
A0A3B4V919_BCL2L11      ---------------------------atgaaagcccaggctgacggtgc
A0A3B4XZH1_BCL2L11      ---------------------------atgaaagcccaggctgacggtgc
A0A3Q3SYA1_BCL2L11      ---------------------------atg--------------------
A0A3Q3K6I5_BCL2L11      ---------------------------atgca------------------
A0A3P8ZIE7_BMF-01       --------------------------------------------------
A0A3B4B6Y3_BMF-01       --------------------------------------------------
A0A3Q2CXC4_BMF-02       --------------------------------------------------
A0A3Q2CXC4_BMF-01       --------------------------------------------------
A0A3B5QK08_BMF-02       --------------------------------------------------
A0A3B5QK08_BMF-01       --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
A0A3B3WU80_BMF-01       --------------------------------------------------
A0A3P9Q8E2_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-02       --------------------------------------------------
A0A3Q2PJX9_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-03       --------------------------------------------------
A0A3Q2YCX7_BMF-01       --------------------------------------------------
A0A3Q2YCX7_BMF-02       --------------------------------------------------
A0A3B3CGR9_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-04       --------------------------------------------------
A0A3P9K487_BMF-02       --------------------------------------------------
A0A3P9K487_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-03       --------------------------------------------------
A0A3B3HAU1_BMF-02       --------------------------------------------------
A0A3B3HAU1_BMF-04       --------------------------------------------------
A0A3Q3GUU5_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-02       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A3Q4G1I4_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-02       --------------------------------------------------
A0A3B4ETH0_BMF-01       --------------------------------------------------
A0A3Q3C5V2_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-03       --------------------------------------------------
A0A3P8UA78_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-02       --------------------------------------------------
A0A3Q3VLX6_BMF-01       --------------------------------------------------
A0A3Q2ZA20_BMF-01       --------------------------------------------------
A0A3Q3RVI2_BMF-02       --------------------------------------------------
A0A3Q3RVI2_BMF-01       --------------------------------------------------
A0A3Q1IPR4_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-02       --------------------------------------------------
A0A3Q1FVH7_BMF-01       --------------------------------------------------
A0A3Q1FVH7_BMF-02       --------------------------------------------------
A0A3B5B8F6_BMF-01       --------------------------------------------------
A0A3Q1D1K3_BMF-01       --------------------------------------------------
A0A3P8RKY9_BMF-01       --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
A0A3B4U5H8_BMF-01       --------------------------------------------------
A0A3B4WM88_BMF-01       --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       cagctgctaagcggcagacctgggattcgaactcaggccctctggtttca
A0A452QUG1_BIK-01       ---------tttcacaccacccgcaggtgcgctca---------------
A0A452V3L2_BIK-01       ---------------atggcttg-----gagctca---------------
H9GL49_BMF-01           --------------------------------------------------
A0A452H3N6_BMF-01       --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
A0A493T7X1_BMF-01       --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-02       --------------------------------------------------
A0A3Q2UCA0_BMF-01       --------------------------------------------------
A0A493T7X1_BMF-02       --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-03       --------------------------------------------------
A0A3Q2UCA0_BMF-04       --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           ctggaccctggcgcagagccctggcatcacaactcggaggctgagacgct
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A286XXB0_BMF-02       ctggaccctggcacagagccctggcaccacgactcggaggccgattctct
A0A286XXB0_BMF-03       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           ctggaccctggcgcggagccctggcgtcacgacccggagactgacactct
G1PAU1_BMF-01           --------------------------------------------------
L8IXF5_BMF-01           --------------------------------------------------
Q05KI3_BMF-02           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
A0A452F2E0_BMF-02       --------------------------------------------------
A0A452F2E0_BMF-01       --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
A0A287CXH0_BMF-01       ctggaccctggcgcagagccctggcatcacgactcggaggccgagactct
A0A287CXH0_BMF-02       --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       ggagtccttcaggttcggccttcgggcaggggacagcaccccagatgcct
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       ggagtccttcaggttcggccttcgggcaggggacagcaccccagatgcct
M3YAD5_BMF-01           --------------------------------------------------
U6CSY8_BMF-01           --------------------------------------------------
A0A452SED0_BMF-01       --------------------------------------------------
A0A384D070_BMF-01       --------------------------------------------------
J9PB65_BMF-04           cgtgtggggggaccatggaggactggagcgccggggtgcgggaacgcggt
J9PB65_BMF-03           --------------------------------------------------
J9PB65_BMF-02           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
A0A2K5KGP2_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
F7CM09_BMF-03           --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
F7CM09_BMF-01           --------------------------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K5Z4A9_BMF-02       --------------------------------------------------
A0A2K5MJW4_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K5Z4A9_BMF-01       --------------------------------------------------
A0A2K5KGP2_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-03       --------------------------------------------------
A0A2K6L919_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-02       --------------------------------------------------
A0A2K6TW78_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-03       --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-02       --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-01       --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-01       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
G3VRY3_BAD-02           --------------------------------------------------
G3VRY3_BAD-01           --------------------------------------------------
A0A1U7Q4V0_BAD-01       tccgatcccggaatccgaagcctggggaacgacgcgggaggaaggcggcg
Q61337_BAD-01           tccgatcccggaatccggagcctggggagcgacgcgggaggaaggcggtg
Q61337_BAD-05           --------------------------------------------------
O35147_BAD-01           tccgatcccggaatccggagcctggggagcgacgcgggaggaaggcggtg
Q6P7C5_BAD-01           tccgatcccggaatccggagcctggggagcgacgcgggaggaaggcggtg
G3TP47_BAD-01           aggatgtcgggagctgaacatccggagaagaagaagggacgcaggagatc
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       gctgaaccagggaccccggaggaaggcggtgggcggggccggagccgtag
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A8MXU7_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2K5VCA9_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K5M0A7_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
A0A452ER54_BAD-01       cggaagctgagcatccggagacgtagaagagaatcaggaggaaggcagtg
A0A452ER54_BAD-02       ---------------------------------------------tatcg
W5P8G9_BAD-01           -------------------------------------------gttatcg
A0A287CT05_BAD-02       ccggggaggaaggcggtaggacccgcaggtcggcggcgagggtggcaccc
A0A287CT05_BAD-01       ccggggaggaaggcggtaggacccgcaggtcggcggcgagggtggcaccc
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2R8Z688_BAD-03       --------------------------------------------------
A8MXU7_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A2K5VCA9_BAD-03       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K5HKU7_BAD-02       --------------------------------------------------
A0A2K6N196_BAD-02       --------------------------------------------------
A0A2K6PUL3_BAD-02       --------------------------------------------------
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2K5HKU7_BAD-01       --------------------------------------------------
A0A2K6N196_BAD-01       --------------------------------------------------
A0A2K6PUL3_BAD-01       --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
A0A2R8Z688_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       cctcagtactggagggaggcggcaggcccgggtcaggggcctcgagatcg
A0A452RJM6_BAD-01       --------------------------------------------------
G1MI17_BAD-01           --------------------------------------------------
A0A384DJL2_BAD-01       --------------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
F7FUT7_BIK-02           gggccgcagacacgacgcctctcggctgggtcgcagactctgctatcatc
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           ctgcccccaattctctcccggtc-----------------------ccgc
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
G3UH24_HRK-01           --------------------------------------------------
A0A452DXE5_HRK-01       --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          gcgcggctagatgtgcctgctccagagtgtgtccccatcagtgggccagt
J9NTK9_BBC3-03          ----ggct------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      ---------------------------------------------ccagt
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          --------------------------------------------------
F1RM01_BBC3-02          --------------------------------------------------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      gtggggcgtctgggaccgccgtgggagcgcgcgtgtgcggggttgtggat
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      tgattcgtccagaccacaaaatcggtccaatggcacgaccaccctaattg
A0A3B1IH05_BAD-01       --------------------------------------------------
A0A3B4CPH6_BAD-01       --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
A0A3B4UNJ0_BMF-01       --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A452J430_PMAIP1-      --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
A0A3B3QX41_BAD-01       ----------------------------------------------atgt
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
A0A3P8Y761_BAD-01       --------------------------------------------------
A0A3B3RH63_BMF-01       --------------------------------------------------
A0A452IFQ4_BAD-01       --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
K7GA86_BCL2L11-01       gcttttgttcagacaaagcctttctgcgagttactctttggacgcaggaa
U3IW89_BCL2L11-01       gccgctgct--gtcgcgctcctccagcggctacttct-------------
A0A3Q2U844_BCL2L11      cccgctgct--gccgcgctcctccagcgggtacttct-------------
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-02       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
G1SSY0_BCL2L11-02       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
A0A3Q1MV27_BCL2L11      --------------------------------------------------
A0A3Q1MV27_BCL2L11      gctggggtcgccaggagccggcttgggggaccttgctcccattcggagaa
L8IVA4_BCL2L11-02       --------------------------------------------------
L8IVA4_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      ccgcggggcccgggcccggacgcgacgctcggaagggaaggggcggataa
A0A3Q2GRS5_BCL2L11      ccgcggggcccgggcccggacgcgacgctcggaagggaaggggcggataa
J9NWV6_BCL2L11-06       --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A1U7T0R1_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      ------------------------------------------------aa
A0A2R8M6L7_BCL2L11      tgccccgtcccgggccagaacgctgcgctctgaagggaaggctcggacaa
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2K6TRU4_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5Q1Y0_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2I3GVB2_BCL2L11      --------------------------------------------------
A0A2R9C366_BCL2L11      --------------------------------------------------
A0A2I3SN61_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K6E212_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A096NYC3_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
C1KGB6_BCL2L11-03       ctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaa
C1KGB6_BCL2L11-01       ctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaa
C1KGB6_BCL2L11-02       ctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaa
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A452U4S4_BCL2L11      --------------------------------------------------
U6CTE3_BCL2L11-04       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-01       --------------------------------------------------
U6CTE3_BCL2L11-03       --------------------------------------------------
U6CTE3_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-05       --------------------------------------------------
J9NWV6_BCL2L11-04       --------------------------------------------------
J9NWV6_BCL2L11-02       --------------------------------------------------
J9NWV6_BCL2L11-03       --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
A0A452SBG5_BCL2L11      --------------------------------------------------
J9NWV6_BCL2L11-01       tcgtcccccccaatgtctgactctgactctcggactgagaaacgcaagaa
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3B1K1X5_BMF-01       --------------------------------------------------
A0A3B4CNJ8_BMF-01       --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
A0A3P9A5G8_BAD-02       -----------------------------------atggctt--------
A0A3P9A5G8_BAD-01       -----------------------------------atggctt--------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A0A3B1JLM2_BAD-01       ttttcaggccattgtgctggaattcatctggaagcacagttt--------
A0A3B4DUY7_BAD-01       cttttaacccattgtgctggaattcattaagaaccacagctt--------
A3KND0_BMF-01           --------------------------------------------------
A0A3Q2Y0E4_BAD-01       ----------atggccgcaaacttcagcatat---ccgacag--------
A0A3B3BQF7_BAD-01       ----------atggcagcaaagttctccatct---cagacaa--------
A0A3P9HNZ2_BAD-01       ----------atggcagcaaagttcaccatct---cag---a--------
A0A3B3HDU2_BAD-01       ----------atggcagcaaagttcaccatct---cag---a--------
A0A3P9KSL7_BAD-01       ----------atggcagcaaagttcaccatct---cag---a--------
A0A3P9KSL7_BAD-02       ----------atggcagcaaagttcaccatct---cag---a--------
A0A3Q3AEL8_BAD-01       ----------atggctgcaaagttcaccattt---cagacag--------
A0A3Q3AEL8_BAD-02       ----------atggctgcaaagttcaccattt---cagacag--------
A0A3Q2QC80_BAD-01       agatgatacgatggcggccaagtttactattt---cggacag--------
A0A3Q2D5S0_BAD-01       ggatcctattatggctgcaacctttaccattt---cagacag--------
A0A3B5L9R9_BAD-01       ----------atggacacaaaatttacaattt---cagacgg--------
A0A3B5Q2N7_BAD-01       ----------atggacacaaaatttacaattt---cagacgg--------
A0A3P9Q7C3_BAD-01       ----------atggacgcaaaatttacaattt---cagacag--------
A0A3B3YFR1_BAD-01       ----------atggacgcaaaatttacaattt---cagacag--------
A0A087X8P8_BAD-01       ----------atggacgcaaaatttacaattt---cagacag--------
A0A3B3UA11_BAD-01       ----------atggacgcaaaatttacaattt---cagacag--------
I3K7B6_BAD-01           ----------atggctgcaaacttcacaattt---cagacag--------
A0A3P9B2E4_BAD-01       ----------atggctgcaaacttcaaaattt---cagacag--------
A0A3Q4GGN3_BAD-01       ----------atggctgcaaacttcaaaattt---cagacag--------
A0A3P8QRJ7_BAD-01       ----------atggctgcaaacttcaaaattt---cagacag--------
A0A3Q3C680_BAD-01       ----------atggctgcaaacttcaaaattt---cagacag--------
A0A3B4GXJ6_BAD-01       ----------atggctgcaaacttcaaaattt---cagacag--------
A0A3Q0QNQ2_BAD-02       --------------------------------------------------
A0A3Q0QNQ2_BAD-01       --ttcatccattttcttccgtttatccagggt---cgggggc--------
A0A3Q3WTY4_BAD-01       ----------atggctaccaatttcaccatttcaagtgacag--------
H3D8J8_BAD-01           ----------atggctgcaaagttcagtctgtgcagcgacag--------
G3Q8B3_BAD-01           ----------atggctgcacatttcaccattt---ccgacag--------
A0A3P8WI83_BAD-02       agatgtcacaatggctgcacagttcactatat---cggacag--------
A0A3P8WI83_BAD-01       ----------atggctgcacagttcactatat---cggacag--------
A0A3Q3FKT9_BAD-03       agatgtcacgatggctgcgaagttcactattt---cagacag--------
A0A3Q3FKT9_BAD-01       -gatgtcacgatggctgcgaagttcactattt---cagacag--------
A0A3Q3RXS8_BAD-01       ----------atggctgcaaaattcagtattt---cagaaag--------
A0A3Q3RXS8_BAD-02       ----------atggctgcaaaattcagtattt---cagaaag--------
A0A3Q3R5S3_BAD-01       ----------atggctgcaaacttcacgattt---cagacag--------
A0A3Q1K1C7_BAD-01       ----------atggcagcaagattcaccattt---cagacag--------
A0A3Q1K1C7_BAD-02       ----------atggcagcaagattcaccattt---cagacag--------
A0A3B5BAL2_BAD-01       ----------atggctgcacaattctctatta---gtggcag--------
A0A3Q1GWH9_BAD-01       ----------atggctgcaaaattctcaattt---cagacgg--------
A0A3Q1CPU7_BAD-01       ----------atggctgcaaaattcactattt---cagacag--------
A0A3P8TWH6_BAD-01       ----------atggctgcaaaattcactattt---cagacag--------
A0A2U9BAC9_BAD-01       ----------atggcggcaaacttcacaatat---cagacag--------
A0A3B4VFC5_BAD-01       ----------atggctgcaaacttcaccattt---cagacag--------
A0A3B4W9T1_BAD-01       ----------atggctgcaaacttcaccattt---cagacag--------
W5N4P7_BMF-01           --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------gccaacctcagaggct--------
Q9GL49_PMAIP1-01        cctcccgctgccgtccgaggaaaccaaccaacctcagaggct--------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------agctccagcgctgctt--------
A0A3Q1CI15_BCL2L11      --------------------cctacaaagtccggtcctgacg--------
A0A3P8RLE2_BCL2L11      ---gcgaacagaacacctagtttagtaggacctgaacagaag--------
A0A3Q3B113_BCL2L11      tgcgtagtccatcc---agaccgccaaatctgcgcgatggct--------
A0A3Q2SZH6_BCL2L11      cgctctgttcatccaacagaccgccaaatctgcgcgatggct--------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      cgctctgttcatccaacagaccgccaaatctgctcgatggct--------
A0A3B5QAM1_BCL2L11      ctcttta----------agaccgccaaatctgctcgatggct--------
A0A3B5QAM1_BCL2L11      cgctctgttcatccaacagaccgccaaatctgctcgatggct--------
A0A3B3VNE0_BCL2L11      ctcttca----------agaccgccaaatctgctcgatggct--------
A0A3B3YII5_BCL2L11      ctcttta----------agaccgccaaatctgctcgatggct--------
A0A3B3YII5_BCL2L11      ctcttta----------agaccgccaaatctgctcgatggct--------
A0A3Q3ESW6_BCL2L11      ----------------cagaccaccgaaccggttggatggct--------
A0A3Q1ICY2_BCL2L11      ----------------tagacaaccaaaccgctccgatggct--------
A0A3B4V919_BCL2L11      cgctctattcatccaacagaccacaaaaccggtccgatggct--------
A0A3B4XZH1_BCL2L11      cgctctattcatccaacagaccacaaaaccggtccgatggct--------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      ---cctatc-------tagaccaccaaaccgctccgatggct--------
A0A3P8ZIE7_BMF-01       --------------------------------------------------
A0A3B4B6Y3_BMF-01       --------------------------------------------------
A0A3Q2CXC4_BMF-02       --------------------------------------------------
A0A3Q2CXC4_BMF-01       --------------------------------------------------
A0A3B5QK08_BMF-02       --------------------------------------------------
A0A3B5QK08_BMF-01       --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
A0A3B3WU80_BMF-01       --------------------------------------------------
A0A3P9Q8E2_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-02       --------------------------------------------------
A0A3Q2PJX9_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-03       --------------------------------------------------
A0A3Q2YCX7_BMF-01       --------------------------------------------------
A0A3Q2YCX7_BMF-02       --------------------------------------------------
A0A3B3CGR9_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-04       --------------------------------------------------
A0A3P9K487_BMF-02       --------------------------------------------------
A0A3P9K487_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-01       --atgtgtctatcgggcatatcaggtcactcgtcttacagtg--------
A0A3B3HAU1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-03       --------------------------------------------------
A0A3B3HAU1_BMF-02       --------------------------------------------------
A0A3B3HAU1_BMF-04       --------------------------------------------------
A0A3Q3GUU5_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-02       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A3Q4G1I4_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-02       --------------------------------------------------
A0A3B4ETH0_BMF-01       --------------------------------------------------
A0A3Q3C5V2_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-03       --------------------------------------------------
A0A3P8UA78_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-02       --------------------------------------------------
A0A3Q3VLX6_BMF-01       --------------------------------------------------
A0A3Q2ZA20_BMF-01       --------------------------------------------------
A0A3Q3RVI2_BMF-02       --------------------------------------------------
A0A3Q3RVI2_BMF-01       --------------------------------------------------
A0A3Q1IPR4_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-02       --------------------------------------------------
A0A3Q1FVH7_BMF-01       --------------------------------------------------
A0A3Q1FVH7_BMF-02       --------------------------------------------------
A0A3B5B8F6_BMF-01       --------------------------------------------------
A0A3Q1D1K3_BMF-01       --------------------------------------------------
A0A3P8RKY9_BMF-01       --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
A0A3B4U5H8_BMF-01       --------------------------------------------------
A0A3B4WM88_BMF-01       --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       gagccgcgttcttcatcatcgtattctgtacctaaggctgtt--------
A0A452QUG1_BIK-01       ---------------------------------------gcg--------
A0A452V3L2_BIK-01       ---------------------------------------gaa--------
H9GL49_BMF-01           --------------atggatcctcccggctacttggatgatg--------
A0A452H3N6_BMF-01       --------------atggatccccccaactacctggaagacg--------
K7FRX2_BMF-01           --------------atggatccccccagctacctggaagaag--------
A0A493T7X1_BMF-01       --------------atggatcgccccagctacctggaagagg--------
U3JS06_BMF-01           --------------atggatcgccccagctacctggaagagg--------
A0A3Q2UCA0_BMF-02       --------------atggatcgccccagctacctggaagagg--------
A0A3Q2UCA0_BMF-01       --------------atggatcgccccagctacctggaagagg--------
A0A493T7X1_BMF-02       --------------atggatcgccccagctacctggaagagg--------
G1NHG8_BMF-01           --------------atggatcgccccagctacctggaagagg--------
A0A3Q2UCA0_BMF-03       --------------atggatcgccccagctacctggaagagg--------
A0A3Q2UCA0_BMF-04       --------------atggatcgccccagctacctggaagagg--------
A9XRH0_BMF-01           --------------atggatcgccccagctacctggaagagg--------
G3WDQ2_BMF-01           ----------------------atggagtctcctcatt------------
A0A1S3WU31_BMF-01       ----------------------atggagctcccccagt------------
A0A1U8CPE0_BMF-02       -------attttcccaggagagatggagccacctcagt------------
A0A1U8CPE0_BMF-01       ----------------------atggagccacctcagt------------
Q8K589_BMF-01           ----------------------atggagccacctcagt------------
A2AV74_BMF-01           gtcctggagtcacccaggagagatggagccacctcagt------------
A2AV74_BMF-02           ------------cccaggagagatggagccacctcagt------------
A0A1S3EQA2_BMF-02       -------attgtcccaggggagatggagccgcctcagt------------
A0A1S3EQA2_BMF-01       ----------------------atggagccgcctcagt------------
A0A286XXB0_BMF-02       ctcctggagtcacccaggggagatggagccacctcagt------------
A0A286XXB0_BMF-03       ------------cccaagggagatggagccacctcagt------------
G1SR62_BMF-01           ----------------------atggagccacctcagt------------
G3T7Z4_BMF-01           ttcctggagtcacccaggggagatggagccatctcagt------------
G1PAU1_BMF-01           ----------------------atggagccacctcagt------------
L8IXF5_BMF-01           ----------------------atggagccaccccagt------------
Q05KI3_BMF-02           ----------------------atggagccaccccagt------------
Q05KI3_BMF-01           ----------------------atggagccaccccagt------------
A0A452F2E0_BMF-02       ----------------------atggagccaccccagt------------
A0A452F2E0_BMF-01       ----------------------atggagccaccccagt------------
W5QFV1_BMF-01           ----------ctcacaggggagatggagccaccccagt------------
A0A287CXH0_BMF-01       ctcctggagtcacccaggtgagatggagccgcctcagt------------
A0A287CXH0_BMF-02       ------------cccagaggagatggagccgcctcagt------------
H0WYH6_BMF-01           ----------------------atggagccatcgcagt------------
A0A287AIU8_BMF-02       ----------------------atggagccacctcagt------------
A0A287AIU8_BMF-01       ----------------------atggagccacctcagt------------
A0A337ST43_BMF-02       ----------------------atggagccgcctcagt------------
A0A337ST43_BMF-05       gcattgcaccccagcaggggagatggagccgcctcagt------------
A0A337ST43_BMF-03       ----------------------atggagccgcctcagt------------
A0A337ST43_BMF-01       ----------------------atggagccgcctcagt------------
A0A337ST43_BMF-04       gcattgcaccccagcaggggagatggagccgcctcagt------------
M3YAD5_BMF-01           ----------------------atggagccgcctcagt------------
U6CSY8_BMF-01           ----------------------atggagccgcctcagt------------
A0A452SED0_BMF-01       ----------------------atggagccgcctcagt------------
A0A384D070_BMF-01       ----------------------atggagccgcctcagt------------
J9PB65_BMF-04           gcaggacccttatctaggggagatggagccgcctcagt------------
J9PB65_BMF-03           ----------------------atggagccgcctcagt------------
J9PB65_BMF-02           ----------------------atggagccgcctcagt------------
J9PB65_BMF-01           ----------------------atggagccgcctcagt------------
A0A2K5KGP2_BMF-01       ----------------------atggagccatctcggt------------
A0A0D9R4R5_BMF-01       ----------------------atggagccatctcggt------------
A0A2K5VLE9_BMF-01       ----------------------atggagccatctcggt------------
A0A2K5VLE9_BMF-02       ----------------------atggagccatctcggt------------
A0A096NTE9_BMF-01       ----------------------atggagccatctcggt------------
A0A096NTE9_BMF-03       ----------------------atggagccatctcggt------------
F7CM09_BMF-03           ----------------------atggagccatctcggt------------
F7CM09_BMF-02           ----------------------atggagccatctcggt------------
F7CM09_BMF-01           ----------------------atggagccatctcggt------------
A0A2K5MJW4_BMF-01       ----------------------atggagccatctcggt------------
A0A2K6B5F6_BMF-03       ----------------------atggagccatctcggt------------
A0A2K5Z4A9_BMF-02       ----------------------atggagccatctcggt------------
A0A2K5MJW4_BMF-02       ----------------------atggagccatctcggt------------
A0A2K6B5F6_BMF-01       ----------------------atggagccatctcggt------------
A0A2K6B5F6_BMF-02       ----------------------atggagccatctcggt------------
A0A2K6B5F6_BMF-04       ----------------------atggagccatctcggt------------
A0A2K5Z4A9_BMF-01       ----------------------atggagccatctcggt------------
A0A2K5KGP2_BMF-02       ----------------------atggagccatctcggt------------
A0A2K6RAW1_BMF-02       ----------------------atggagccatctcggt------------
A0A2K6RAW1_BMF-01       ----------------------atggagccatctcggt------------
A0A2K6L919_BMF-01       ----------------------atggagccatctcggt------------
A0A2K6L919_BMF-03       ----------------------atggagccatctcggt------------
A0A2K6L919_BMF-02       ----------------------atggagccatctcggt------------
A0A2K5E1Q4_BMF-02       ----------------------atggagccatctcagt------------
A0A2K5E1Q4_BMF-01       ----------------------atggagccatctcagt------------
A0A2K6TW78_BMF-02       ----------------------atggagccatctcagt------------
A0A2K6TW78_BMF-01       ----------------------atggagccatctcagt------------
A0A2K6TW78_BMF-03       ----------------------atggagccatctcagt------------
A0A2K5RN49_BMF-02       ----------------------atggagccatctcagt------------
A0A2K5RN49_BMF-01       ----------------------atggagccatctcagt------------
A0A2J8T301_BMF-01       ----------------------atggagccatctcagt------------
A0A2I3HD83_BMF-01       ----------------------atggagccatctcagt------------
A0A2I2Z168_BMF-02       ----------------------atggagccatctcagt------------
A0A2R9BS98_BMF-02       ----------------------atggagccatctcagt------------
A0A2J8QDD5_BMF-01       ----------------------atggagccatctcagt------------
A0A2I2Z168_BMF-01       ----------------------atggagccatctcagt------------
A0A2R9BS98_BMF-01       ----------------------atggagccatctcagt------------
A0A2J8QDD5_BMF-02       ----------------------atggagccatctcagt------------
A0A2K6FFN3_BMF-02       ----------------------atggagccatcccact------------
A0A2K6FFN3_BMF-01       ----------------------atggagccatcccact------------
A0A3Q2HR24_BMF-02       ----------------------atggagccgcctcagt------------
A0A3Q2HR24_BMF-01       ----------------------atggagccgcctcagt------------
G3VRY3_BAD-02           -------------------atgttccagatatccgagt------------
G3VRY3_BAD-01           -------------------atgttccagatatccgagt------------
A0A1U7Q4V0_BAD-01       aagaccagcagcccagagtatgttccagatcccagagt------------
Q61337_BAD-01           gagaccagcagcccagagtatgttccagatcccagagt------------
Q61337_BAD-05           -------------------atgttccagatcccagagt------------
O35147_BAD-01           gagaccagcagcccagagtatgttccagatcccagagt------------
Q6P7C5_BAD-01           gagaccagcagcccagagtatgttccagatcccagagt------------
G3TP47_BAD-01           atcgggcgggctgcagagtatgttccagatcccagagt------------
A0A1S3FL84_BAD-01       -------------------atgttccagatcccagagt------------
H0V608_BAD-01           -------------------atgttccagatcccagagt------------
A0A091DDU4_BAD-01       -------------------atgttccagatcccagagt------------
H0WVR2_BAD-01           -------------------atgttccagatcccagagt------------
A0A2K6GWV0_BAD-01       -------------------atgttccagatcccagagt------------
A0A287AEF3_BAD-01       cggccccgcctcccagagcatgttccagatcccagagt------------
A0A2I2Z8C7_BAD-03       -------------------atgttccagatcccagagt------------
A8MXU7_BAD-03           -------------------atgttccagatcccagagt------------
A0A2I3TBK7_BAD-01       -------------------atgttccagatcccagagt------------
A0A2K5VCA9_BAD-02       -------------------atgttccagatcccagagt------------
A0A2K6E7I4_BAD-02       -------------------atgttccagatcccagagt------------
A0A2K5M0A7_BAD-02       -------------------atgttccagatcccagagt------------
A0A2K5XJR2_BAD-02       -------------------atgttccagatcccagagt------------
F1MUT9_BAD-01           -------------------atgttccagatcccagagt------------
Q3SYZ0_BAD-01           -------------------atgttccagatcccagagt------------
A0A452ER54_BAD-01       ggcggggccccggggaagcatgttccagatcccagagt------------
A0A452ER54_BAD-02       ggcttgggcccag---agcatgttccagatcccagagt------------
W5P8G9_BAD-01           ggcttgggcccag---agcatgttccagatcccagagt------------
A0A287CT05_BAD-02       ggcctggacccag---agcatgttccagatcccagagt------------
A0A287CT05_BAD-01       ggcctggacccag---agcatgttccagatcccagagt------------
A0A2K5E6A6_BAD-03       -------------------atgttccagatcccagagt------------
A0A2R8Z688_BAD-03       -------------------atgttccagatcccagagt------------
A8MXU7_BAD-04           -------------------atgttccagatcccagagt------------
A0A2I3TBK7_BAD-03       -------------------atgttccagatcccagagt------------
A0A2K5M0A7_BAD-03       -------------------atgttccagatcccagagt------------
A0A096MLD5_BAD-02       -------------------atgttccagatcccagagt------------
A0A2K5VCA9_BAD-03       -------------------atgttccagatcccagagt------------
A0A2K6E7I4_BAD-03       -------------------atgttccagatcccagagt------------
A0A2K5HKU7_BAD-02       -------------------atgttccagatcccagagt------------
A0A2K6N196_BAD-02       -------------------atgttccagatcccagagt------------
A0A2K6PUL3_BAD-02       -------------------atgttccagatcccagagt------------
A0A2K5PDB1_BAD-03       -------------------atgttccagatcccagagt------------
A0A2K6TG62_BAD-03       -------------------atgttccagatcccagagt------------
A0A0D9R491_BAD-01       -------------------atgttccagatcccagagt------------
A0A2K5HKU7_BAD-01       -------------------atgttccagatcccagagt------------
A0A2K6N196_BAD-01       -------------------atgttccagatcccagagt------------
A0A2K6PUL3_BAD-01       -------------------atgttccagatcccagagt------------
A0A096MLD5_BAD-01       -------------------atgttccagatcccagagt------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5XJR2_BAD-01       -------------------atgttccagatcccagagt------------
A0A2J8TYJ3_BAD-01       -------------------atgttccagatcccagagt------------
B4DZQ9_BAD-01           -------------------atgttccagatcccagagt------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-02       -------------------atgttccagatcccagagt------------
A0A2I2Z8C7_BAD-01       -------------------atgttccagatcccagagt------------
A0A2R8Z688_BAD-01       -------------------atgttccagatcccagagt------------
A0A2K5E6A6_BAD-01       -------------------atgttccagatcccagagt------------
A0A2K5PDB1_BAD-01       -------------------atgttccagatcccagagt------------
A0A2K6TG62_BAD-01       -------------------atgttccagatcccagagt------------
G1P8C5_BAD-01           -cctacagcccag---agcatgttccagatcccagagt------------
F7DN67_BAD-01           -------------------atgttccagatcccagagt------------
F1PK10_BAD-01           -------------------atgttccagatcccagagt------------
Q45KI9_BAD-01           -------------------atgttccagatcccagagt------------
M3YNE7_BAD-01           -------------------atgttccagatcccagagt------------
A0A337SAW2_BAD-01       ggcttgggcccag---agcatgttccagatcccagagt------------
A0A452RJM6_BAD-01       -------------------atgttccagatcccagagt------------
G1MI17_BAD-01           --ccacagcccag---agcatgttccagatcccagagt------------
A0A384DJL2_BAD-01       -------------------atgttccagatcccagagt------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
F7FUT7_BIK-02           gccgccaccgccgccgccgccgccgccgccgccgccag------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           cccgctcttgctgtccgggagcccgcgaccg--gaggg------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
H0W025_BIK-01           ----------------------------------atgt------------
I3LVX0_BIK-01           ----------------------------------atgg------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
G3UH24_HRK-01           --------------------------------------------------
A0A452DXE5_HRK-01       --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
F7GL32_BBC3-02          ----------------------------------atgg------------
F7GL32_BBC3-01          ----------------------------------atgg------------
F7G1G0_HRK-01           --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
G3T2N1_BBC3-01          ----------------------------------atgg------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          ----------------caggccccagggagcgccatgg------------
A0A1U7R5N5_BBC3-01      ----------------------------------atgg------------
Q99ML1_BBC3-02          ----------------------------------atgg------------
Q80ZG6_BBC3-01          ----------------------------------atgg------------
J9NTK9_BBC3-01          taccaggaacctgttacaggccccagggagcgccatgg------------
J9NTK9_BBC3-03          -----------------gggccccagggagcgccatgg------------
H0XQ00_BBC3-01          ----------------------------------atgg------------
A0A250YBU3_BBC3-02      ----------------------------------atgg------------
A0A250YBU3_BBC3-01      tagcaggaacctgtcacaggccccagggagcgccatgg------------
A0A3Q2GWE8_BBC3-01      ------------------ggccccagggagcgccatgg------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          ----------------caggccccagggagcgccatgg------------
F1RM01_BBC3-02          ----------------caggccccagggagcgccatgg------------
F1RM01_BBC3-03          ----------------------------------atgg------------
J9NTK9_BBC3-02          ------------------------agggagcgccatgg------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      ----------------------------------atgg------------
A0A452E3G1_BBC3-01      ----------------------------------atgg------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      ----------------------------------atgg------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      ctgcaggtgtctcgcctgggccccagggagcgccatgg------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          ----------------------------------atgg------------
A0A2I3RGH5_BBC3-01      ----------------------------------atgg------------
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          ------------------ggccccagggagcgccatgg------------
Q9BXH1_BBC3-03          ------------------ggccccagggagcgccatgg------------
A0A0D9S2H2_BBC3-01      ------------------ggccccagggagcgccatgg------------
A0A2K6QZT2_BBC3-01      ----------------------------------atgg------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------agag-----------------agtc-----------
A0A3P8XIA2_BCL2L11      ggagagggaaaatcggag-----------------agtcgca-tccctgt
A0A3B1IH05_BAD-01       --atgtccacagcggcgagagcggcggcggggacctgcgactccactgct
A0A3B4CPH6_BAD-01       --------------------------------------------------
C1C3S9_BAD-01           -----------atggggg-----------------attctcctcataagt
A0A3B4UNJ0_BMF-01       -----------atggatgat------------------------------
H3ANP3_BAD-01           -----------atgt----------------------------tccagat
H3ANP3_BAD-02           -----------atgt----------------------------tccagat
H3ANP3_BAD-03           -----------atgt----------------------------tccagat
W5QCU2_BIK-01           -----------atgtatcaagcaagacccctctctaggaacc-tcttttt
A0A3B4BVX1_BCL2L11      -----------atg-----cagaa----------cagtaattactgctgt
A0A3B4BVX1_BCL2L11      --------cttctgtccgccagaaaagctcgtttcagtgtttgcccgtgt
M3XHJ5_BCL2L11-01       -----------atgccaacag--------------aggaaagtttacaat
A0A452J430_PMAIP1-      -----------atgccgg-----------------gaaagac---cctgc
A0A3B1JXK6_BCL2L11      -----------atgtccagaccgtcaaaccgggccacccgcccacccttc
A0A3B3QX41_BAD-01       cgggtgtcaccatggcgcacatgtttaccatctccggcaatgagtcggac
A7MCM4_BAD-01           -----------atggcacatatg------------tttaatatctccgat
Q4V925_BAD-03           -----------atggcacatatg------------tttaatatctctgat
Q4V925_BAD-02           -----------atggcacatatg------------tttaatatctctgat
Q4V925_BAD-01           -----------atggcacatatg------------tttaatatctctgat
Q4V925_BAD-04           -----------atggcacatatg------------tttaatatctctgat
A0A3P8Y761_BAD-01       -----------atggaaa----atattttcactatatcagac-accgaat
A0A3B3RH63_BMF-01       ----atggacgatgacgatgacgatgtgttccacacggacccgctcacct
A0A452IFQ4_BAD-01       -----------atgtttc-----------gcatccaggagtt-cccggac
G1TZR9_BIK-01           -----------atgtctgaagtcagacctggctccagggacc-tcttcca
R4G9R5_BCL2L11-01       -----------atg------------------------------------
Q0GKC7_BMF-01           -----------atggatg-----------------ag-------------
K7GA86_BCL2L11-01       aaggcgaccaaatggcaa-----------------agcaacc-ttctgat
U3IW89_BCL2L11-01       ----------------------------------------cc-ttc----
A0A3Q2U844_BCL2L11      ----------------------------------------cc-ttc----
G1MV54_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       -----------atggcca-----------------agcaacc-ttccgac
G3W979_BCL2L11-01       -----------atggcaa-----------------agcaacc-gtcagat
F7CXT2_BCL2L11-02       -----------atggcaa-----------------aacaacc-gtcagat
F7CXT2_BCL2L11-01       -----------atggcaa-----------------aacaacc-gtcagat
G1PDJ5_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-20       -----------atggcaa-----------------agcaacc-ttctgat
G1SSY0_BCL2L11-01       -----------atggcca-----------------agcaacc-ttccgat
G1SSY0_BCL2L11-02       -----------atggcca-----------------agcaacc-ttccgat
A0A1U8BW10_BCL2L11      -----------atggcca-----------------agcaacc-ttctgat
A0A1U8BW10_BCL2L11      -----------atggcca-----------------agcaacc-ttctgat
A0A1U8BW10_BCL2L11      -----------atggcca-----------------agcaacc-ttctgat
O54918_BCL2L11-03       -----------atggcca-----------------agcaacc-ttctgat
O54918_BCL2L11-01       -----------atggcca-----------------agcaacc-ttctgat
O88498_BCL2L11-01       -----------atggcca-----------------agcaacc-ttctgat
A0A3Q1MV27_BCL2L11      -----------atggcaa-----------------agcaacc-ttccgat
A0A3Q1MV27_BCL2L11      aaaaagaccaaatggcaa-----------------agcaacc-ttccgat
L8IVA4_BCL2L11-02       -----------atggcaa-----------------agcaacc-ttccgat
L8IVA4_BCL2L11-01       -----------atggcaa-----------------agcaacc-ttccgat
W5PY58_BCL2L11-01       -----------atggcaa-----------------agcaacc-ttccgat
A0A452FCR6_BCL2L11      -----------atggcaa-----------------agcaacc-ttccgat
A0A452FCR6_BCL2L11      -----------atggcaa-----------------agcaacc-ttccgat
A0A3Q2GRS5_BCL2L11      -----------atggcca-----------------aacaacc-ttccgat
A0A3Q2GRS5_BCL2L11      -----------atggcca-----------------aacaacc-ttccgat
A0A3Q2GRS5_BCL2L11      -----------atggcca-----------------aacaacc-ttccgat
A0A3Q2GRS5_BCL2L11      aaaaagaccaaatggcca-----------------aacaacc-ttccgat
A0A3Q2GRS5_BCL2L11      aaaaagaccaaatggcca-----------------aacaacc-ttccgat
J9NWV6_BCL2L11-06       -----------atggcaa-----------------agcaacc-ttcagat
A0A2K6TRU4_BCL2L11      -----------atggcaa-----------------agcaacc-ttccgat
A0A2I3GVB2_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A2R9C366_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A2K5CA89_BCL2L11      -----------atggcaa-----------------agcaacc-ttccgat
A0A2K5Z7V3_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A2K6KJP8_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A286XJN2_BCL2L11      -----------atggcca-----------------agcaacc-ttccgat
A0A286XJN2_BCL2L11      -----------atggcca-----------------agcaacc-ttccgat
A0A286XJN2_BCL2L11      -----------atggcca-----------------agcaacc-ttccgat
H0XW23_BCL2L11-01       -----------atggcaa-----------------agcaacc-ttcagat
A0A1U7T0R1_BCL2L11      -----------atggcaa-----------------agcaacc-ttccgtt
A0A1U7T0R1_BCL2L11      -----------atggcaa-----------------agcaacc-ttccgtt
A0A1U7T0R1_BCL2L11      -----------atggcaa-----------------agcaacc-ttccgtt
A0A1U7T0R1_BCL2L11      -----------atggcaa-----------------agcaacc-ttccgtt
A0A1U7T0R1_BCL2L11      -----------atggcaa-----------------agcaacc-ttccgtt
A0A1U7T0R1_BCL2L11      -----------atggcaa-----------------agcaacc-ttccgtt
A0A2K6GE31_BCL2L11      -----------atggcaa-----------------agcaacc-ttccgat
A0A2K6GE31_BCL2L11      -----------atggcaa-----------------agcaacc-ttccgat
A0A2R8M6L7_BCL2L11      aaagagaccaaatggcaa-----------------agcaacc-ttccgat
A0A2R8M6L7_BCL2L11      aaagagaccaaatggcaa-----------------agcaacc-ttccgat
H2P5E2_BCL2L11-01       -----------atggcaa-----------------agcaacc-ttctgat
A0A2K5Q1Y0_BCL2L11      -----------atggcaa-----------------agcaacc-ttccgat
A0A2R8M6L7_BCL2L11      -----------atggcaa-----------------agcaacc-ttccgat
A0A2K6TRU4_BCL2L11      -----------atggcaa-----------------agcaacc-ttccgat
A0A2K5CA89_BCL2L11      -----------atggcaa-----------------agcaacc-ttccgat
A0A2K5Q1Y0_BCL2L11      -----------atggcaa-----------------agcaacc-ttccgat
Q6JTU4_BCL2L11-01       -----------atg------------------------------------
A0A2I3SN61_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A2I3GVB2_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A2R9C366_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A2I3SN61_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A2K5HZI5_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A2K6QIL2_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A2I2YQ13_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A2K6QIL2_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A2K5HZI5_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A2I2YQ13_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A096NYC3_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A2K5NU92_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A2K5X1Y3_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A2K6E212_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A2K5Z7V3_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A2K6KJP8_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A2K5X1Y3_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A2K6E212_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A2K5NU92_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A096NYC3_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A0D9RWE0_BCL2L11      -----------atggcaa-----------------agcaacc-ttctgat
A0A287DFJ0_BCL2L11      -----------atggcaa-----------------agcaacc-ttccgat
A0A287DFJ0_BCL2L11      -----------atggcaa-----------------agcaacc-ttccgat
G3SU55_BCL2L11-01       -----------atggcaa-----------------agcaacc-ttcagat
C1KGB6_BCL2L11-03       aaaaagaccaaatggcaa-----------------agcaacc-ttccgat
C1KGB6_BCL2L11-01       aaaaagaccaaatggcaa-----------------agcaacc-ttccgat
C1KGB6_BCL2L11-02       aaaaagaccaaatggcaa-----------------agcaacc-ttccgat
C1KGB8_BCL2L11-01       -----------atggcaa-----------------agcaacc-ttccgat
A0A250YBV9_BCL2L11      -----------atggcaa-----------------agcaacc-ttccgat
A0A250YBV9_BCL2L11      -----------atggcaa-----------------agcaacc-ttccgat
A0A1S3FFM9_BCL2L11      -----------atggcaa-----------------agcaacc-ttccgat
A0A1S3FFM9_BCL2L11      -----------atggcaa-----------------agcaacc-ttccgat
A0A452U4S4_BCL2L11      -----------atggcaa-----------------agcaacc-ttcagat
U6CTE3_BCL2L11-04       -----------atggcaa-----------------agcaacc-ttcagat
M3YDI3_BCL2L11-01       -----------atggcaa-----------------agcaacc-ttcagat
U6CTE3_BCL2L11-01       -----------atggcaa-----------------agcaacc-ttcagat
U6CTE3_BCL2L11-03       -----------atggcaa-----------------agcaacc-ttcagat
U6CTE3_BCL2L11-02       -----------atggcaa-----------------agcaacc-ttcagat
J9NWV6_BCL2L11-05       -----------atggcaa-----------------agcaacc-ttcagat
J9NWV6_BCL2L11-04       -----------atggcaa-----------------agcaacc-ttcagat
J9NWV6_BCL2L11-02       -----------atggcaa-----------------agcaacc-ttcagat
J9NWV6_BCL2L11-03       -----------atggcaa-----------------agcaacc-ttcagat
G1LDR8_BCL2L11-01       -----------atggcaa-----------------agcaacc-ttcagat
A0A452SBG5_BCL2L11      -----------atggcaa-----------------agcaacc-ttcagat
J9NWV6_BCL2L11-01       aaaaagaccaaatggcaa-----------------agcaacc-ttcagat
A0A2I2UX96_BCL2L11      -----------atggcaa-----------------agcaacc-ttcagat
A0A2I2UX96_BCL2L11      -----------atggcaa-----------------agcaacc-ttcagat
                                                                          

O61667_EGL1-01          --------------------------------------------------
A0A3G3M2M0_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
A0A3B3QC78_BCL2L11      --------------------------------------------------
A0A3B1K1X5_BMF-01       --------------------------------------------------
A0A3B4CNJ8_BMF-01       --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
A0A3P9A5G8_BAD-02       --------------------------------------------------
A0A3P9A5G8_BAD-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A0A3B1JLM2_BAD-01       --------------------------------------------------
A0A3B4DUY7_BAD-01       --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
A0A3Q2Y0E4_BAD-01       --------------------------------------------------
A0A3B3BQF7_BAD-01       --------------------------------------------------
A0A3P9HNZ2_BAD-01       --------------------------------------------------
A0A3B3HDU2_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-01       --------------------------------------------------
A0A3P9KSL7_BAD-02       --------------------------------------------------
A0A3Q3AEL8_BAD-01       --------------------------------------------------
A0A3Q3AEL8_BAD-02       --------------------------------------------------
A0A3Q2QC80_BAD-01       --------------------------------------------------
A0A3Q2D5S0_BAD-01       --------------------------------------------------
A0A3B5L9R9_BAD-01       --------------------------------------------------
A0A3B5Q2N7_BAD-01       --------------------------------------------------
A0A3P9Q7C3_BAD-01       --------------------------------------------------
A0A3B3YFR1_BAD-01       --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A3B3UA11_BAD-01       --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A3P9B2E4_BAD-01       --------------------------------------------------
A0A3Q4GGN3_BAD-01       --------------------------------------------------
A0A3P8QRJ7_BAD-01       --------------------------------------------------
A0A3Q3C680_BAD-01       --------------------------------------------------
A0A3B4GXJ6_BAD-01       --------------------------------------------------
A0A3Q0QNQ2_BAD-02       --------------------------------------------------
A0A3Q0QNQ2_BAD-01       --------------------------------------------------
A0A3Q3WTY4_BAD-01       --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
A0A3P8WI83_BAD-02       --------------------------------------------------
A0A3P8WI83_BAD-01       --------------------------------------------------
A0A3Q3FKT9_BAD-03       --------------------------------------------------
A0A3Q3FKT9_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-01       --------------------------------------------------
A0A3Q3RXS8_BAD-02       --------------------------------------------------
A0A3Q3R5S3_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-01       --------------------------------------------------
A0A3Q1K1C7_BAD-02       --------------------------------------------------
A0A3B5BAL2_BAD-01       --------------------------------------------------
A0A3Q1GWH9_BAD-01       --------------------------------------------------
A0A3Q1CPU7_BAD-01       --------------------------------------------------
A0A3P8TWH6_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
A0A3B4VFC5_BAD-01       --------------------------------------------------
A0A3B4W9T1_BAD-01       --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
Q9JM54_PMAIP1-03        --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A3Q1NFP6_PMAIP1-      --------------------------------------------------
A0A452EST2_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF1_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV43_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5QQC6_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A452TE71_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A3Q1ELG4_BCL2L11      --------------------------------------------------
A0A3Q1CI15_BCL2L11      --------------------------------------------------
A0A3P8RLE2_BCL2L11      --------------------------------------------------
A0A3Q3B113_BCL2L11      --------------------------------------------------
A0A3Q2SZH6_BCL2L11      --------------------------------------------------
A0A3P9N073_BCL2L11      --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3Q3ESW6_BCL2L11      --------------------------------------------------
A0A3Q1ICY2_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
A0A3Q3SYA1_BCL2L11      --------------------------------------------------
A0A3Q3K6I5_BCL2L11      --------------------------------------------------
A0A3P8ZIE7_BMF-01       --------------------------------------------------
A0A3B4B6Y3_BMF-01       --------------------------------------------------
A0A3Q2CXC4_BMF-02       --------------------------------------------------
A0A3Q2CXC4_BMF-01       --------------------------------------------------
A0A3B5QK08_BMF-02       --------------------------------------------------
A0A3B5QK08_BMF-01       --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
A0A3B3WU80_BMF-01       --------------------------------------------------
A0A3P9Q8E2_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-02       --------------------------------------------------
A0A3Q2PJX9_BMF-01       --------------------------------------------------
A0A3Q2PJX9_BMF-03       --------------------------------------------------
A0A3Q2YCX7_BMF-01       --------------------------------------------------
A0A3Q2YCX7_BMF-02       --------------------------------------------------
A0A3B3CGR9_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-04       --------------------------------------------------
A0A3P9K487_BMF-02       --------------------------------------------------
A0A3P9K487_BMF-01       --------------------------------------------------
A0A3P9ICE1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-01       --------------------------------------------------
A0A3B3HAU1_BMF-03       --------------------------------------------------
A0A3B3HAU1_BMF-02       --------------------------------------------------
A0A3B3HAU1_BMF-04       --------------------------------------------------
A0A3Q3GUU5_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-02       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A3Q4G1I4_BMF-01       --------------------------------------------------
A0A3P8NFE2_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-01       --------------------------------------------------
A0A3P9DPJ5_BMF-02       --------------------------------------------------
A0A3B4ETH0_BMF-01       --------------------------------------------------
A0A3Q3C5V2_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-03       --------------------------------------------------
A0A3P8UA78_BMF-01       --------------------------------------------------
A0A3P8UA78_BMF-02       --------------------------------------------------
A0A3Q3VLX6_BMF-01       --------------------------------------------------
A0A3Q2ZA20_BMF-01       --------------------------------------------------
A0A3Q3RVI2_BMF-02       --------------------------------------------------
A0A3Q3RVI2_BMF-01       --------------------------------------------------
A0A3Q1IPR4_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-01       --------------------------------------------------
A0A3Q3QZ16_BMF-02       --------------------------------------------------
A0A3Q1FVH7_BMF-01       --------------------------------------------------
A0A3Q1FVH7_BMF-02       --------------------------------------------------
A0A3B5B8F6_BMF-01       --------------------------------------------------
A0A3Q1D1K3_BMF-01       --------------------------------------------------
A0A3P8RKY9_BMF-01       --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
A0A3B4U5H8_BMF-01       --------------------------------------------------
A0A3B4WM88_BMF-01       --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A452QUG1_BIK-01       --------------------------------------------------
A0A452V3L2_BIK-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
A0A452H3N6_BMF-01       --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
A0A493T7X1_BMF-01       --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-02       --------------------------------------------------
A0A3Q2UCA0_BMF-01       --------------------------------------------------
A0A493T7X1_BMF-02       --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A0A3Q2UCA0_BMF-03       --------------------------------------------------
A0A3Q2UCA0_BMF-04       --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           --------------------------------------------------
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A286XXB0_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-03       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           --------------------------------------------------
G1PAU1_BMF-01           --------------------------------------------------
L8IXF5_BMF-01           --------------------------------------------------
Q05KI3_BMF-02           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
A0A452F2E0_BMF-02       --------------------------------------------------
A0A452F2E0_BMF-01       --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
A0A287CXH0_BMF-01       --------------------------------------------------
A0A287CXH0_BMF-02       --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       --------------------------------------------------
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       --------------------------------------------------
M3YAD5_BMF-01           --------------------------------------------------
U6CSY8_BMF-01           --------------------------------------------------
A0A452SED0_BMF-01       --------------------------------------------------
A0A384D070_BMF-01       --------------------------------------------------
J9PB65_BMF-04           --------------------------------------------------
J9PB65_BMF-03           --------------------------------------------------
J9PB65_BMF-02           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
A0A2K5KGP2_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-02       --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
F7CM09_BMF-03           --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
F7CM09_BMF-01           --------------------------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-03       --------------------------------------------------
A0A2K5Z4A9_BMF-02       --------------------------------------------------
A0A2K5MJW4_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-01       --------------------------------------------------
A0A2K6B5F6_BMF-02       --------------------------------------------------
A0A2K6B5F6_BMF-04       --------------------------------------------------
A0A2K5Z4A9_BMF-01       --------------------------------------------------
A0A2K5KGP2_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-02       --------------------------------------------------
A0A2K6RAW1_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-01       --------------------------------------------------
A0A2K6L919_BMF-03       --------------------------------------------------
A0A2K6L919_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-02       --------------------------------------------------
A0A2K5E1Q4_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-02       --------------------------------------------------
A0A2K6TW78_BMF-01       --------------------------------------------------
A0A2K6TW78_BMF-03       --------------------------------------------------
A0A2K5RN49_BMF-02       --------------------------------------------------
A0A2K5RN49_BMF-01       --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-02       --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
A0A2I2Z168_BMF-01       --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-02       --------------------------------------------------
A0A2K6FFN3_BMF-01       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
G3VRY3_BAD-02           --------------------------------------------------
G3VRY3_BAD-01           --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
Q61337_BAD-01           --------------------------------------------------
Q61337_BAD-05           --------------------------------------------------
O35147_BAD-01           --------------------------------------------------
Q6P7C5_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A8MXU7_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2K5VCA9_BAD-02       --------------------------------------------------
A0A2K6E7I4_BAD-02       --------------------------------------------------
A0A2K5M0A7_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
A0A452ER54_BAD-01       --------------------------------------------------
A0A452ER54_BAD-02       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
A0A287CT05_BAD-02       --------------------------------------------------
A0A287CT05_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-03       --------------------------------------------------
A0A2R8Z688_BAD-03       --------------------------------------------------
A8MXU7_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A096MLD5_BAD-02       --------------------------------------------------
A0A2K5VCA9_BAD-03       --------------------------------------------------
A0A2K6E7I4_BAD-03       --------------------------------------------------
A0A2K5HKU7_BAD-02       --------------------------------------------------
A0A2K6N196_BAD-02       --------------------------------------------------
A0A2K6PUL3_BAD-02       --------------------------------------------------
A0A2K5PDB1_BAD-03       --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2K5HKU7_BAD-01       --------------------------------------------------
A0A2K6N196_BAD-01       --------------------------------------------------
A0A2K6PUL3_BAD-01       --------------------------------------------------
A0A096MLD5_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
A0A2R8Z688_BAD-01       --------------------------------------------------
A0A2K5E6A6_BAD-01       --------------------------------------------------
A0A2K5PDB1_BAD-01       --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
A0A452RJM6_BAD-01       --------------------------------------------------
G1MI17_BAD-01           --------------------------------------------------
A0A384DJL2_BAD-01       --------------------------------------------------
A0A2K5QXZ1_BIK-01       --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
F7FUT7_BIK-02           --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
A0A493SWX7_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
G3UH24_HRK-01           --------------------------------------------------
A0A452DXE5_HRK-01       --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
A0A2K5PIE7_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01