Dataset for CDS BBC3 of organism all

[Download (right click)] [Alignment] [Repertoires]

85 sequence(s)

>gnl|bcl2dbcds|G1LNV7_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BBC3 (length=456 residues).
ggaagcggggcaagaggggacccgatttcaagaccacaggcacaggtgtggaaactgaggccccgatgtgtgactggagg
gaagcacagactgcggggcggctcagaagggggtggggcaggaaggcatctcccgaatcccagccccccaggtcctcagc
cctcactctcgccggcagagcagcacctggaatcgccggtgcccagtgccccgggggccctggcgggaggccccacccag
gcagccccgggagtccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggcggatggcggacgacct
caacgcgctgtacgagcggcggagacaagaggagcggcagcgacaccgcccctcaccctggagggtcctgtacaatctca
tcatgggactcctgccattacccaggggccgcggagccccggagatggagcccaat
>gnl|bcl2dbcds|A0A2K5F6X4_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Aotus nancymaae GN=BBC3 (length=303 residues).
aaatgtggcgtggggtctgcctgggcatgtccatgccaagtgcctagggcttcttcctcgacgtgggtcccctgccagat
gtgtgagacaagaggagcagccgcagcaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgccc
tttcccaggggccacagagcccccgagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcgggg
ggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|A0A2K5F6X4_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Aotus nancymaae GN=BBC3 (length=654 residues).
tctgcctgggcatgtccatgccaagtgcctagggcttcttcctcgacgtgggtcccctgccagatgtgtggccccaggga
gcgccatggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttc
ccgctgccgcctgcgatgtttcccctcccgccgccacccgccgcaccgccgcctggccccgtggcctgggtgggtccccg
cagccgcccccgaggcccgcgcccggacgagagggcccggaggctcggaggaactggagacgccccgggggccctggcgg
gcggtcccacccaggcggccccgggagtccgcggggaggaggagcagtgggcccgggagatcggggcccagctgcggcgg
atggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagccgcagcaccgcccctcaccctggagggt
cctgtacaatctcatcatgggactcctgccctttcccaggggccacagagcccccgagatggagcccaattaggtgcctg
cacccgcccggtggacgtcagggactcggggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttc
tctgcaccatgtag
>gnl|bcl2dbcds|A0A2K5F6X4_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Aotus nancymaae GN=BBC3 (length=393 residues).
aaatgtggcgtggggtctgcctgggcatgtccatgccaagtgcctagggcttcttcctcgacgtgggtcccctgccagat
gtgtggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctggcgg
gcggtcccacccaggcggccccgggagtccgcggggaggaggagcagtgggcccgggagatcggggcccagctgcggcgg
atggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagccgcagcaccgcccctcaccctggagggt
cctgtacaatctcatcatgggactcctgccctttcccaggggccacagagcccccgagatggagcccaattag
>gnl|bcl2dbcds|A0A4W2EKD9_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Bos indicus GN=BBC3 (length=396 residues).
gtgagagccactgcagaggctgcccgggcatgtccgtgccagctgcccggggctttcttctccccctgggtcccccacca
gattcgtggtcctcagccttcactctcgcccgcggagcagcacctggaatcaccagtgcccagcgccccgggggccctgg
cgggcggccccacccaagcggccccgggagtccggggggaggaggagcagtgggcccgagagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgctatacgagcggcggagacaagaggagcggcagcgacaccgcccctcaccctggag
ggtcctgtacaatctcatcatgggactcctgccctttcccgggggccgcggagcccccgaggtggagcccaattag
>gnl|bcl2dbcds|A0A4W2EKD9_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Bos indicus GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cagccgcctggtgccctcggcggtgtcctgcggcctctgcgaacccggcctgcctgctgcccccgccgcccccgccctgc
tgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctgggggccccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgacccgacggtcctcagccttcactctcgcccgcggagcagcacctggaatcacc
agtgcccagcgccccgggggccctggcgggcggccccacccaagcggccccgggagtccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggcggacgacctcaacgcgctatacgagcggcggagacaagaggagcgg
cagcgacaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgccctttcccgggggccgcggagc
ccccgaggtggagcccaattag
>gnl|bcl2dbcds|A0A3Q1LXZ6_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Bos taurus GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cagccgcctggtgccctcggcggtgtcctgcggcctctgcgaacccggcctgcctgctgcccccgccgcccccgccctgc
tgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctgggggccccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgacccgacggtcctcagccttcactctcgcccgcggagcagcacctggaatcacc
agtgcccagcgccccgggggccctggcgggcggccccacccaagcggccccgggagtccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggcggacgacctcaacgcgctatacgagcggcggagacaagaggagcgg
cagcgacaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgccctttcccgggggccgcggagc
ccccgaggtggagcccaattag
>gnl|bcl2dbcds|A0A4W2EKD9_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Bos indicus GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cagccgcctggtgccctcggcggtgtcctgcggcctctgcgaacccggcctgcctgctgcccccgccgcccccgccctgc
tgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctgggggccccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgacccgacggtcctcagccttcactctcgcccgcggagcagcacctggaatcacc
agtgcccagcgccccgggggccctggcgggcggccccacccaagcggccccgggagtccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggcggacgacctcaacgcgctatacgagcggcggagacaagaggagcgg
cagcgacaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgccctttcccgggggccgcggagc
ccccgaggtggagcccaattag
>gnl|bcl2dbcds|A0A4W2EKD9_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Bos indicus GN=BBC3 (length=396 residues).
gtgagagccactgcagaggctgcccgggcatgtccgtgccagctgcccggggctttcttctccccctgggtcccccacca
gattcgtggtcctcagccttcactctcgcccgcggagcagcacctggaatcaccagtgcccagcgccccgggggccctgg
cgggcggccccacccaagcggccccgggagtccggggggaggaggagcagtgggcccgagagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgctatacgagcggcggagacaagaggagcggcagcgacaccgcccctcaccctggag
ggtcctgtacaatctcatcatgggactcctgccctttcccgggggccgcggagcccccgaggtggagcccaattag
>gnl|bcl2dbcds|A0A2R8MW85_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Callithrix jacchus GN=BBC3 (length=396 residues).
atgaaatgtggcgtggggtctgcctgggcatgtccatgccaagtgcccagggcttcttcctcggtgtgggtcccctgcca
gatgtgtggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccaggggccctgg
cgggcggtcccacccaggcggcccccggagtccgcggggaggaggagcagtgggcccgggagatcggggcccagctgcga
cggatggcggacgacctcaacgcgctgtacgagcggcggagacaagaggagcagccgcagcaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgccctttcccaggggccacagagccccggagatggagcccaattag
>gnl|bcl2dbcds|A0A2R8MW85_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Callithrix jacchus GN=BBC3 (length=786 residues).
atgaaatgtggcgtggggtctgcctgggcatgtccatgccaagtgcccagggcttcttcctcggtgtgggtcccctgcca
gatgtgtggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgtagagggcttggcccgc
gacggcccgcgccccttcccgcttggccgcctggtgccctcggccgtgtcctgcggcctctgcgagtccggcctgcccgc
cacccccgccgcccccgccttgctgcccgctgcctacctctgcgcccccgccgccccacccgccgtcaccgccgccctgg
ggggcccccgctggcctgggggcccccgcagccgcccccgaggcccgcgcccggacggtcctcagccctcgctctcgctg
gcggagcagcacctggagtcgcccgtgcccagcgccccaggggccctggcgggcggtcccacccaggcggcccccggagt
ccgcggggaggaggagcagtgggcccgggagatcggggcccagctgcgacggatggcggacgacctcaacgcgctgtacg
agcggcggagacaagaggagcagccgcagcaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctg
ccctttcccaggggccacagagccccggagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggacttg
gggggcaggcccctcccatctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|A0A2R8MW85_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Callithrix jacchus GN=BBC3 (length=1263 residues).
aggaagccgcccgccctccaccgccgccccctccggcgtgttcatgcccccggggtgagtgtgcgcgccctgaatcctcg
ccggcggcgatcggccaggccgggtgggctccctggaggaggtgacaggagtgcaggcggcgagcagtgcgggcgccctg
cctccccacactgcgcctccccacaaaccccacgagggaccctgggctggggtcgcggggagggaggcggctcggcgttg
gggcgcctggtctgggcgcacaggtgcctcggcggtctggcgggtttgtttacaaacaatggggtgcgggctcggcagcg
ccccctggcggccagtgcgaccccggggaagagggtcgaccccggggtgccccagcccccaaagtcagggaggggcgggg
gggcggcacggaggggcggccacacccagggcgcgcgcccgctgggggcggcgacagggggcggctcgcgggccgtggag
tctgcggctcctgcgggcgggggctgcgccccagcaacagccggttattggccccgcgctcgcctggcgggcggggcggg
cgcacgtggcggcggtgggggtggctgtgacagcggagtggggcgtctgggaccgccgtgggagcgcgcgtgtgcggggt
tgtggatctgcaggtgtctcgcctgggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagccc
gtagagggcttggcccgcgacggcccgcgccccttcccgcttggccgcctggtgccctcggccgtgtcctgcggcctctg
cgagtccggcctgcccgccacccccgccgcccccgccttgctgcccgctgcctacctctgcgcccccgccgccccacccg
ccgtcaccgccgccctggggggcccccgctggcctgggggcccccgcagccgcccccgaggcccgcgcccggacggtcct
cagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccaggggccctggcgggcggtcccac
ccaggcggcccccggagtccgcggggaggaggagcagtgggcccgggagatcggggcccagctgcgacggatggcggacg
acctcaacgcgctgtacgagcggcggagacaagaggagcagccgcagcaccgcccctcgccctggagggtcctgtacaat
ctcatcatgggactcctgccctttcccaggggccacagagccccggagatggagcccaattag
>gnl|bcl2dbcds|A0A5F4CJ83_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Canis lupus familiaris GN=BBC3 (length=723 residues).
atgccctgtgtgactcccaggctgggccccagggagcgccatggcccgagcacgccaggagggcagctccccggagcccg
tagagggcctggcccgcgacggtccgcgcccgtttcccctcagccgcctggtgccctcggccgtgtcctgcggcctctgc
gagcccggcctgcccgccgcccctgctgcccctgccctgctgcccgctgcctacctctgcgcccccaccgccccgcccgc
cgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagccggccccgaggcccgcgccccgacggtcctc
agccctcactgtcgccggcggaacagcacctggaatcgccggtgcccagcgccccgggggccctggcgggcggtcccacc
caagcagccccgggagtccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggcggatggcggacga
cctcaacgcgctgtacgagcggcggagacaagaggagcagcagcgacaccgcccctcaccctggagggtcctgtacaatc
tcatcatgggactcctgcccttacccaggggccgtggagccccggagatggagcccaattaggtgcctgcacccgcccgg
tggacatcagggacttggggggcaggaccctcccacctcctgatgccctggccagcgcgggggactttttctgcaccatg
tag
>gnl|bcl2dbcds|A0A5F4CJ83_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Canis lupus familiaris GN=BBC3 (length=882 residues).
atgcaggggctgcccgggcatgtccctgtcaggtgctcggggtttccttctggccctgtgggtcccccgtcagatctgtg
ccaagcgcggctagatgtgcctgctccagagtgtgtccccatcagtgggccagttaccaggaacctgttacaggccccag
ggagcgccatggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggtccgcgcccg
tttcccctcagccgcctggtgccctcggccgtgtcctgcggcctctgcgagcccggcctgcccgccgcccctgctgcccc
tgccctgctgcccgctgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggc
ctgggggtccccgcagccggccccgaggcccgcgccccgacggtcctcagccctcactgtcgccggcggaacagcacctg
gaatcgccggtgcccagcgccccgggggccctggcgggcggtcccacccaagcagccccgggagtccggggggaggagga
gcagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgctgtacgagcggcgggtgagtg
ttgggggaggggtagacggcaggtgggacttcccgcccgggagggggctgcgggcggccccgccagatgtgcggcagctg
ctgcccggcgcggcggggtcgcgctggggacaggcaggtgggatgggcgacgggcccacggacctgccgaagggcccgcg
ccgcggctggcacgacccgggcaagggccgggaccgcctcgagcgccgcggcgcgtccgtggccctcggccgcggggact
ga
>gnl|bcl2dbcds|A0A5F4CJ83_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Canis lupus familiaris GN=BBC3 (length=807 residues).
atgccctgtgtgactcccaggctgggccccagggagcgccatggcccgagcacgccaggagggcagctccccggagcccg
tagagggcctggcccgcgacggtccgcgcccgtttcccctcagccgcctggtgccctcggccgtgtcctgcggcctctgc
gagcccggcctgcccgccgcccctgctgcccctgccctgctgcccgctgcctacctctgcgcccccaccgccccgcccgc
cgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagccggccccgaggcccgcgccccgacggtcctc
agccctcactgtcgccggcggaacagcacctggaatcgccggtgcccagcgccccgggggccctggcgggcggtcccacc
caagcagccccgggagtccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggcggatggcggacga
cctcaacgcgctgtacgagcggcgggtgagtgttgggggaggggtagacggcaggtgggacttcccgcccgggagggggc
tgcgggcggccccgccagatgtgcggcagctgctgcccggcgcggcggggtcgcgctggggacaggcaggtgggatgggc
gacgggcccacggacctgccgaagggcccgcgccgcggctggcacgacccgggcaagggccgggaccgcctcgagcgccg
cggcgcgtccgtggccctcggccgcggggactgagggcggcgctcggcggagcagctcatatatcccgggctatttatag
ccggtga
>gnl|bcl2dbcds|A0A452E3G1_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Capra hircus GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctcccccgagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cagccgcctggtgccctcggcggtgtcctgtggcctctgcgaacccggcctgcctgctgcccccgccgcccccgccctgc
tgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcactgccgccctgggggccccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgacccgacggtcctcagccttcactctcgcccgcggagcagcacctggaatcgcc
agtgcccagcgccccgggggccctggcgggcggacccacccaagcggccccgggagtccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggcggacgacctcaacgcgctatacgagcggcggagacaagaggagcgg
caacgacaccgcccctcgccctggagggtcctgtacaatctcatcttgggactcctgcccttccccgggggccgcggagc
ccccgaggtggagcccaattag
>gnl|bcl2dbcds|A0A250YBU3_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Castor canadensis GN=BBC3 (length=756 residues).
atgaaattgagtgtgggggctgcccgggcatgttcgtgccaggtgcccagggttgcctcctgtgggtgggcccacgccct
atttgtgtggagcctggctaggtgtgcacagtctggagtatgtcctgccagtgggccagttagcaggaacctgtcacagg
ccccagggagcgccatggcccgcgcacgccaggagggcagctctccggagcccgtagagggcttagctcgcgacggcccg
cgccccttcccgctcggtcgcctggtgccctcggccgtgtcctgcggcctctgcgagccgggcctgcccgccgccccagc
cgccccggccctgctgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcaccgcagccttggggggccccc
gctggcctggaggtccccgcagccggccccgaggcccgcgtccggatggtcctcagccatcactatcaccagcccagcag
cacctagagtcacccgtgcccagcgtcccggaggccctggcgggcggccccacccaggcggcccccggagtccgggggga
ggaggagcagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcgga
gacaagaagagcaacagcaacaccgcccctcgccctggagggtgctgtacaatgtcatcatgggactcctgcccttaccc
aggggcccgggagccccggagatggagcccaattag
>gnl|bcl2dbcds|A0A250YBU3_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Castor canadensis GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctctccggagcccgtagagggcttagctcgcgacggcccgcgccccttcccgct
cggtcgcctggtgccctcggccgtgtcctgcggcctctgcgagccgggcctgcccgccgccccagccgccccggccctgc
tgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcaccgcagccttggggggcccccgctggcctggaggt
ccccgcagccggccccgaggcccgcgtccggatggtcctcagccatcactatcaccagcccagcagcacctagagtcacc
cgtgcccagcgtcccggaggccctggcgggcggccccacccaggcggcccccggagtccggggggaggaggagcagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaagagcaa
cagcaacaccgcccctcgccctggagggtgctgtacaatgtcatcatgggactcctgcccttacccaggggcccgggagc
cccggagatggagcccaattag
>gnl|bcl2dbcds|A0A2K5QNS7_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Cebus capucinus imitator GN=BBC3 (length=786 residues).
atgaaatgtggcgtggggtctgcctgggcatgtccatgccaagtgcccagggcttcttcctcggtgtgggttccttgcca
gatgtgtggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgc
gacggcccgcgccccttcccgctcggccgcctggtgccctcggccgtgtcctgcggcctctgcgagtccggcctgcccgc
cgcccctgccgcccccgccttgctgcccgctgcctacctctgcgcccccgccaccccacccgccgtcaccgccgccctgg
ggagcccccgctggcctgggggcccccgcagccgcccccgaggcccgcgcccggacggtcctcagccctcgctctcgctg
gcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctggcgggcggtcccacccaggcggccctgggagt
ccgcggggaggaggagcagtgggcccgggagatcggggcccagctgcagcggatggcggacgacctcaacgcgcagtacg
agcggcggagacaagaggagcagccgcagcaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctg
ccctttcccaggggccacagagcccccgagatggagcccaattaggtgcctgcacctgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|A0A2K5QNS7_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Cebus capucinus imitator GN=BBC3 (length=396 residues).
atgaaatgtggcgtggggtctgcctgggcatgtccatgccaagtgcccagggcttcttcctcggtgtgggttccttgcca
gatgtgtggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctgg
cgggcggtcccacccaggcggccctgggagtccgcggggaggaggagcagtgggcccgggagatcggggcccagctgcag
cggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagccgcagcaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgccctttcccaggggccacagagcccccgagatggagcccaattag
>gnl|bcl2dbcds|A0A2K5QNS7_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Cebus capucinus imitator GN=BBC3 (length=306 residues).
atgaaatgtggcgtggggtctgcctgggcatgtccatgccaagtgcccagggcttcttcctcggtgtgggttccttgcca
gatgtgtgagacaagaggagcagccgcagcaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctg
ccctttcccaggggccacagagcccccgagatggagcccaattaggtgcctgcacctgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|A0A2K5P2T8_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Cercocebus atys GN=BBC3 (length=786 residues).
ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccagggctgcttctgcgacgtgggtcctctgcca
gatttgtggccccagggagcgccatggcccgcgcacgccaggagggcagctctccggagcccgtagagggcctggcccgc
gacggcccgcgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgc
cgcccccgccgcccccgccctgctgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctgg
ggggcccccgctggcctgggggtccccgcagccggccccgaggcccacgcccggacggtcctcagccctcgctcttgctg
gcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctggcgggcggtcccacccaggcggccccgggagt
ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacg
agcggcggagacaagaggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctg
cccttacccaggggccacagagcccccgaaatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|A0A2K5P2T8_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Cercocebus atys GN=BBC3 (length=396 residues).
ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccagggctgcttctgcgacgtgggtcctctgcca
gatttgtggtcctcagccctcgctcttgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccccgaaatggagcccaattag
>gnl|bcl2dbcds|A0A2K5P2T8_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Cercocebus atys GN=BBC3 (length=306 residues).
ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccagggctgcttctgcgacgtgggtcctctgcca
gatttgtgagacaagaggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctg
cccttacccaggggccacagagcccccgaaatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|A0A0D9S2H2_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Chlorocebus sabaeus GN=BBC3 (length=600 residues).
caggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacgg
cccgcgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgccgccc
ccgccgcccccgccctgctgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctggggggc
ccccgctggcctgggggtccccgcagccggccccgaggcccacgcccggacggtcctcagccctcgctttcgctggcgga
gcagcacctggagtcgcccgtgcccagcgccccgggggccctggcgggcggtcccacccaggcggccccgggagtccgcg
gggaggaggaacagtgggcccaggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcgg
cggagacaagaggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctgccctt
acccaggggccacagagcccccgaaatggagcccaattag
>gnl|bcl2dbcds|A0A5F5PGZ4_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Equus caballus GN=BBC3 (length=396 residues).
gtgagagtcagcgcaggggctgcccgggcatgtctgtgccaggcgcctggggcttccttctcaccctgggtcccccagca
gactcgtggtccacagccctcactcttgccggccgagcagcacctggagtcgccggtgcccagcgccccgggggccctgg
agggcggccccacccaggcagccccgggagtccggggggaggaggagcagtgggcccgggagatcggggcccagctgcgg
cggatggcggacgacctgaacgcgctgtacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgcccctacccaggggccgagcggccccggagatggagcccaactag
>gnl|bcl2dbcds|A0A5F5PGZ4_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Equus caballus GN=BBC3 (length=786 residues).
gtgagagtcagcgcaggggctgcccgggcatgtctgtgccaggcgcctggggcttccttctcaccctgggtcccccagca
gactcgtggccccagggagcgccatggcccgagcacgccaggagggcagctccccggagccggtagagggcctggcccgc
gacggcccgcgccccttcccgctcagccgcctggtgccctcggccgtgtcctgcggcctctgcgagcccggcctgcccgc
cgcgcccgccgcgcccgccctgctgcccgctgcctacctctgcgcccccgccgccccgcccgccgtcaccgccgccctgg
ggggcccccgctggcctgggggcccccgcagccgtccccgagccccgcgccccgacggtccacagccctcactcttgccg
gccgagcagcacctggagtcgccggtgcccagcgccccgggggccctggagggcggccccacccaggcagccccgggagt
ccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctgaacgcgctgtacg
agcggcggagacaagaggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctg
cccctacccaggggccgagcggccccggagatggagcccaactaggtgcctgcacccgcccgggggacgtcggggacttg
gggggcaggaccctcccacctcctgacgccctggccagcgcggggggctctttctgcaccatgtag
>gnl|bcl2dbcds|A0A337SJI7_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Felis catus GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgcccctttcccct
cagccgcctggtgccctcggccgtgtcctgcggcctctgcgagcccggcctgcccgccgcccccgccgcccccgccctgc
tgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccggccccgagggccgcgccccgacggtcctcagccctcactctcgccggcagagcagcacctggaatcgcc
ggtgcccagcgccccgggggccctggcgggcggccccacccaggcagccccgggagtccggggggaggaggagcagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgctgtacgagcggcggagacaagaggagcag
cagcgacaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgcccttacccagggcccgcggggc
cccggagatggagcccaattag
>gnl|bcl2dbcds|B4DQK3_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Homo sapiens GN=BBC3 (length=600 residues).
atggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacgg
cccgcgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgccgccc
ccgccgcccccaccctgctgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctggggggt
tcccgctggcctgggggtccccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctctcgctggcgga
gcagcacctggagtcgcccgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagtccgcg
gggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcacagtacgagcgg
cggagacaagaggagcagcagcggcaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgccctt
acccaggggccacagagcccccgagatggagcccaattag
>gnl|bcl2dbcds|Q9BXH1_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Homo sapiens GN=BBC3 (length=786 residues).
atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggctgcttccacgacgtgggtcccctgcca
gatttgtggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgc
gacggcccgcgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgc
cgcccccgccgcccccaccctgctgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctgg
ggggttcccgctggcctgggggtccccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctctcgctg
gcggagcagcacctggagtcgcccgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagt
ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcacagtacg
agcggcggagacaagaggagcagcagcggcaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctg
cccttacccaggggccacagagcccccgagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|Q9BXH1_BBC3-06 BCL2 binding component 3 gene OS=[Eukaryota] Homo sapiens GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgccgcccccgccgcccccaccctgc
tgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctggggggttcccgctggcctgggggt
ccccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcc
cgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcacagtacgagcggcggagacaagaggagcag
cagcggcaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagc
ccccgagatggagcccaattag
>gnl|bcl2dbcds|Q9BXH1_BBC3-05 BCL2 binding component 3 gene OS=[Eukaryota] Homo sapiens GN=BBC3 (length=396 residues).
atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggctgcttccacgacgtgggtcccctgcca
gatttgtggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggctctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcacagtacgagcggcggagacaagaggagcagcagcggcaccgcccctcaccctggag
ggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccccgagatggagcccaattag
>gnl|bcl2dbcds|Q9BXH1_BBC3-04 BCL2 binding component 3 gene OS=[Eukaryota] Homo sapiens GN=BBC3 (length=306 residues).
atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggctgcttccacgacgtgggtcccctgcca
gatttgtgagacaagaggagcagcagcggcaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctg
cccttacccaggggccacagagcccccgagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|G3T2N1_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Loxodonta africana GN=BBC3 (length=561 residues).
atggcccgcgcacgccaggagggcagctcccccgagcccgtagagggtctggcccgcgagagcccgcgccccttcccact
cggcagcctggtgccctcggccgtgtcctgtggcctctgcgagcccggccttcctcgagttgcagggccacggctccttc
cggggcctcggacacagctgtttcccagcccctctccagtctgggtctctgatctctcgggactgcagttggagagaggt
ggggccgagtgggaggacagggcccctcgtcctctctcaggtcctcagccctcactctcgccggcggagcagcacctgga
gtcgccggtgcccacgcaggcggccccgggggtccggggagaggatgagcaatgggcccgagagatcggggcccagtttc
ggcggaaggcggacgacctctatgcgctgtacgagcggtcggtgagacaggaggagcagcaccggcaccgtccctcgccc
tggagggtcctgtacaatctcatcatgggactactgcccttaccaagggaccatggcgcccccgagatggagcccaatta
g
>gnl|bcl2dbcds|A0A2K5V8J3_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Macaca fascicularis GN=BBC3 (length=786 residues).
ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccagggcttcttctgcgacgtgggtcccctgcca
gatttgtggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgc
gacggcccgcgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgc
cgcccccgccgcccccgccctgctgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctgg
ggggcccccgctggcctgggggtccccgcagccggccccgaggcccacgcccggacggtcctcagccctcgctcttgctg
gcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctggcgggcggtcccacccaggcggccccgggagt
ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcaatacg
agcggcggagacaagaggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctg
cccttacccaggggccacagagcccccgaaatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|A0A2K5V8J3_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Macaca fascicularis GN=BBC3 (length=306 residues).
ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccagggcttcttctgcgacgtgggtcccctgcca
gatttgtgagacaagaggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctg
cccttacccaggggccacagagcccccgaaatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|A0A2K5V8J3_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Macaca fascicularis GN=BBC3 (length=396 residues).
ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccagggcttcttctgcgacgtgggtcccctgcca
gatttgtggtcctcagccctcgctcttgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcaatacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccccgaaatggagcccaattag
>gnl|bcl2dbcds|A0A2K6ASP2_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Macaca nemestrina GN=BBC3 (length=786 residues).
ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccagggcttcttctgcgacgtgggtcccctgcca
gatttgtggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgc
gacggcccgcgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgc
cgcccccgccgcccccgccctgctgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccaccctgg
ggggcccccgctggcctgggggtccccgcagccggccccgaggcccacgcccggacggtcctcagccctcgctcttgctg
gcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctggcgggcggtcccacccaggcggccccgggagt
ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcaatacg
agcggcggagacaagaggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctg
cccttacccaggggccacagagcccccgaaatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|A0A2K6ASP2_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Macaca nemestrina GN=BBC3 (length=396 residues).
ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccagggcttcttctgcgacgtgggtcccctgcca
gatttgtggtcctcagccctcgctcttgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcaatacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccccgaaatggagcccaattag
>gnl|bcl2dbcds|A0A2K6ASP2_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Macaca nemestrina GN=BBC3 (length=306 residues).
ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccagggcttcttctgcgacgtgggtcccctgcca
gatttgtgagacaagaggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctg
cccttacccaggggccacagagcccccgaaatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|A0A1U7R5N5_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Mesocricetus auratus GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctctccggagcccgtagagggcttggcccgcgacagtccgcgccccttcccgct
cggccgcctggtgccctccgctgtgtcctgcggcctctgcgagcccggcctgcccgccgcccctgctgcccccgccctgc
tgccggccgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccgaccccgaggcccacgcccggacggtcctcagccctcgctgtcaccggcccagcagcacctagagtcgcc
cgtgcccagcgccccggaggccctggcgggcggccccacccaagcagccccgggagtgcgcggggaggaggaggagtggg
cccgggagatcggggctcagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaagagcaa
catcgacaccgcccgtcgccctggagggtcatgtacaatctcttcatgggactcctccccttacccagggatcctggagc
cccagaaatggagcccaactag
>gnl|bcl2dbcds|F7GL32_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Monodelphis domestica GN=BBC3 (length=957 residues).
atgggtgtgcggccccgcggcgccccctggcgcccggagccggcggggggcggcggggctgggggccgggcgaggggcac
ggccgggcgggcgcgtgccactgggcgtgttgttttccaggggctcggcgtgggcctccgcagtggtgagtgtgcgccgc
ggctgggggtgcgcgtgccgtgccgtgagcgggggccgctgtcaccgcgctgctgctgccgctgtgagtgcggggccgga
ctggggaaactgaggcggggccgggcccgaggggtggcaccgccgctcacctgctccgcccacctgtctgtgtccctccg
caggctccctccccactggggcatggccagagcccagcaggatggcagctctccggagccggtggaggggctgccccggg
agagccccaggaccttccccctgggccggctcatgccctctgcggtctcctgcagcctctgtgaggccggcttgaacccc
tctggcgactccatgtgcccagccccggggccagcgctggcaccctcttccctcctgcccctcgcttacttctgcacgcg
acagccccgtgcctatgggggcccccgctgggcacgggcggccaggagcccggcggccggcaaccagggccaaagcggtt
ccctgccctccctgggccccaggtctgcccaggaggaggggggacaggagggagagccccagggagcgtcccccatgtct
ggcggccccccgggggtgttaggcccggagcacggggaccaaggcgagcagcaggaccgggagatcggcgcccagctgcg
caggatggccgatgacctcaacgccctgtacgagcagcggagacgggaggaggagcagaggcgccacctgtcgccctgga
ggctgctgtacaatctcatctcggggctcctggccccccagcgaaggaaccggatgccggacgtggagcccaactag
>gnl|bcl2dbcds|F7GL32_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Monodelphis domestica GN=BBC3 (length=615 residues).
atggccagagcccagcaggatggcagctctccggagccggtggaggggctgccccgggagagccccaggaccttccccct
gggccggctcatgccctctgcggtctcctgcagcctctgtgaggccggcttgaacccctctggcgactccatgtgcccag
ccccggggccagcgctggcaccctcttccctcctgcccctcgcttacttctgcacgcgacagccccgtgcctatgggggc
ccccgctgggcacgggcggccaggagcccggcggccggcaaccagggccaaagcggttccctgccctccctgggccccag
gtctgcccaggaggaggggggacaggagggagagccccagggagcgtcccccatgtctggcggccccccgggggtgttag
gcccggagcacggggaccaaggcgagcagcaggaccgggagatcggcgcccagctgcgcaggatggccgatgacctcaac
gccctgtacgagcagcggagacgggaggaggagcagaggcgccacctgtcgccctggaggctgctgtacaatctcatctc
ggggctcctggccccccagcgaaggaaccggatgccggacgtggagcccaactag
>gnl|bcl2dbcds|B2RVL4_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Mus musculus GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctctccggagcccgtagagggtctagcccgcgacagtccgcgccccttcccgct
cggccgcctgatgccctccgctgtatcctgcagcctttgcgagcccggcctgcccgccgcccctgctgcccctgccttgc
tgccggccgcctacctctgcgcccccaccgctccacctgccgtcaccgccgccctggggggcccccgctggcctgggggt
caccgcagccggcccagaggcccgcgcccggacggtcctcagccctccctgtcaccagcccagcagcacttagagtcgcc
cgtgcccagcgccccggaggccctggcaggaggccccacccaagctgccccgggagtgcgtgtggaggaggaggagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaagagcag
catcgacaccgaccctcaccctggagggtcatgtacaatctcttcatgggactcctccccttacccagggatcctggagc
cccagaaatggagcccaactag
>gnl|bcl2dbcds|Q99ML1_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Mus musculus GN=BBC3 (length=386 residues).
atggcccgcgcacgccaggagggcagctctccggagcccgtagagggtctagcccgcgacagtccgcgccccttcccgct
cggccgcctgatgccctccgctgtatcctgcagcctttgcgagcccggcctgcccgccgcccctgctgcccctgccttgc
tgccggccgcctacctctgcgcccccaccgctccacctgccgtcaccgccgccctggggggcccccgctggcctgggggt
caccgcagccggcccagaggcccgcgcccggacggtcctcagccctccctgtcaccagcccagcagcacttagagtcgcc
cgtgcccagcgccccggaggccctggcaggaggccccacccaagctgccccgggagtgcgtgtgga
>gnl|bcl2dbcds|Q99ML1_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Mus musculus GN=BBC3 (length=274 residues).
atggcccgcgcacgccaggagggcagctctccggagcccgtagagggtctagcccgcgacagtccgcgccccttcccgct
cggccgcctgatgccctccgctgtatcctgcagcctttgcgagcccggcctgcccgccgcccctgctgcccctgccttgc
tgccggccgcctacctctgcgcccccaccgctccacctgccgtcaccgccgccctggggggcccccgctggcctgggggt
caccgcagccggcccagaggcccgcgcccggacg
>gnl|bcl2dbcds|Q99ML1_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Mus musculus GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctctccggagcccgtagagggtctagcccgcgacagtccgcgccccttcccgct
cggccgcctgatgccctccgctgtatcctgcagcctttgcgagcccggcctgcccgccgcccctgctgcccctgccttgc
tgccggccgcctacctctgcgcccccaccgctccacctgccgtcaccgccgccctggggggcccccgctggcctgggggt
caccgcagccggcccagaggcccgcgcccggacggtcctcagccctccctgtcaccagcccagcagcacttagagtcgcc
cgtgcccagcgccccggaggccctggcaggaggccccacccaagctgccccgggagtgcgtgtggaggaggaggagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaagagcag
catcgacaccgaccctcaccctggagggtcatgtacaatctcttcatgggactcctccccttacccagggatcctggagc
cccagaaatggagcccaactag
>gnl|bcl2dbcds|M3Y0R3_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Mustela putorius furo GN=BBC3 (length=606 residues).
caggccccagggagcgccatggcccgagcacgccaggagggcagctccccggagcccgtagagggcctgtcccgcgacgg
cccgcgcccctttcccctcagccgcctggtgccctcggccgtgtcctgtggcctctgggaatctgactgcagtccccgag
ttgcagcccacggccttttccgggccggggcagcagctgtttcccagcccccacctcccccagtctgggtctccttaacc
tcccagaggacgatagttggagggagtgtgggcagagcgagaggactgcttttcccaggtcctcagccctcactctcgcc
ggcggagccgcacctggaatcgccggtgcccagtgccccgggggccctggcgggcggccccacccaggcagccccgggag
tccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggaggatggcggacgacctcaacgcgctgtac
gagcggcggagacaagaagagcagcagcgacaccgcccctccccctggagggtcctgtacaatctcatcatgggactcct
gcccttacccaggggccgtggagccccagagatggagcccaattag
>gnl|bcl2dbcds|A0A2I3HWI8_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Nomascus leucogenys GN=BBC3 (length=324 residues).
atgaaatttggcatggggtctgcccgggcatgtccatgccaggtgcccagggcttcttccgtgacgtgggtcccctgcca
gatttgtgcaggcggtcccacccaggcggctccgggagtccgcggggaggaggaacagtgggcccgggagatcggggccc
agctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcaacagcggcaccgcccctcg
ccctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccccgagatggagcccaa
ttag
>gnl|bcl2dbcds|A0A2I3HWI8_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Nomascus leucogenys GN=BBC3 (length=714 residues).
atgaaatttggcatggggtctgcccgggcatgtccatgccaggtgcccagggcttcttccgtgacgtgggtcccctgcca
gatttgtggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgc
gacggcccgcgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctagctgc
cgcccccgccgcccccgccctgctgcccgctgcctacctctgcgcccccaccgctccacccgccgtcaccgccgccctgg
ggggcccccgctggcccgggggtcctcgcagccggccccgaggcccgcgcccggacgcaggcggtcccacccaggcggct
ccgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaacgc
gcagtacgagcggcggagacaagaggagcaacagcggcaccgcccctcgccctggagggtcctgtacaatctcatcatgg
gactcctgcccttacccaggggccacagagcccccgagatggagcccaattaggtgcctgcacccgcccggtggacgtca
gggactcggggggcaggcccctcccacctcctgacaccctggccagcgtggggaactttctctgcaccatgtag
>gnl|bcl2dbcds|A0A2I3HWI8_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Nomascus leucogenys GN=BBC3 (length=306 residues).
atgaaatttggcatggggtctgcccgggcatgtccatgccaggtgcccagggcttcttccgtgacgtgggtcccctgcca
gatttgtgagacaagaggagcaacagcggcaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctg
cccttacccaggggccacagagcccccgagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgtggggaactttctctgcaccatgtag
>gnl|bcl2dbcds|A0A5F9DGT6_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BBC3 (length=549 residues).
atggcccgcgcacgccaggagggcagctctccggagcccgtagagggcctggcccgcgacggccctcgcccccttcccgc
ttggtcgcctggtgccctcggccgtgtcctgcggccttctgcgagcgggaagtccctcctggaatctgactgcagtcccc
gagctgcggccggcgggctcctcccggcctccagccacagcggtttcccagcgcccctcccccggcctgggcccccgcga
cccccacggggctcgcagttggaaggagggccagtcactggagtcgtcccgtgcccagcgccccgggggcccctggaggg
ggtccccaccccggcggccccgggagtctggggcgaggaggagcagtgggcccgagagatcgtggcccagctgcggtgga
tggcgtacgatctgtacgcgcagtatgagcgcagacaagaggagcagcagcgacaccgcccttcgccctggagggtcctg
tacaatcttctcatgggacttctgcccttacccaggggccccggagccccggagatggagcccaactag
>gnl|bcl2dbcds|H0XQ00_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Otolemur garnettii GN=BBC3 (length=582 residues).
atggcccgcgcacgccaagagggcagctccccggagcccgtagagggcctggctcgcgacggtccgcgccccttcccgct
cggccgcctagtgccctcggccgtgtcctgcggcctctgcgagcccggcctgcccgccgcccctgccgccccggctctgc
tgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcactgccaccctagggggcccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgcctggatggtcctcagccatcactcttgccggccgagcagcacctggagtcgcc
cgttcccagcaccccgggggccctggcgggcggtcccacccaggcggccccggaggtccggggggaggaggagcagtggg
ccagagagataggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcag
cagcgacaccgcccctcaccctggagagtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagc
ccctgagatggagcccaattag
>gnl|bcl2dbcds|A0A2R9BZA9_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Pan paniscus GN=BBC3 (length=306 residues).
atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggctgcttccgtgacgtgggtcccctgcca
gatttgtgagacaagaggagcagcagcggcaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctg
cccttacccaggggccacagagcccccgagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|A0A2R9BZA9_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Pan paniscus GN=BBC3 (length=396 residues).
atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggctgcttccgtgacgtgggtcccctgcca
gatttgtggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggctctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagcagcggcaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccccgagatggagcccaattag
>gnl|bcl2dbcds|A0A2I3RGH5_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Pan troglodytes GN=BBC3 (length=396 residues).
atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggctgcttccgcgacgtgggtcccctgcca
gatttgtggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggctctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagcagcggcaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccccgagatggagcccaattag
>gnl|bcl2dbcds|A0A2I3RGH5_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Pan troglodytes GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgccgcccccgccgcccccaccctgc
tgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctggggggtccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcc
cgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcag
cagcggcaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagc
ccccgagatggagcccaattag
>gnl|bcl2dbcds|A0A2I3RGH5_BBC3-04 BCL2 binding component 3 gene OS=[Eukaryota] Pan troglodytes GN=BBC3 (length=813 residues).
atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggctgcttccgcgacgtgggtcccctgcca
gatttgtggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgc
gacggcccgcgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgc
cgcccccgccgcccccaccctgctgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctgg
ggggtccccgctggcctgggggtccccgcagccggccccgaggcccgcgcccggacgggctggagactcggaggaactgg
agaagtcctcagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggctctggcggg
cggtcccacccaggcggccccgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggcgga
tggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagcagcggcaccgcccctcgccctggagggtc
ctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccccgagatggagcccaattaggtgcctgc
acccgcccggtggacgtcagggactcggggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttct
ctgcaccatgtag
>gnl|bcl2dbcds|A0A2I3RGH5_BBC3-05 BCL2 binding component 3 gene OS=[Eukaryota] Pan troglodytes GN=BBC3 (length=306 residues).
atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggctgcttccgcgacgtgggtcccctgcca
gatttgtgagacaagaggagcagcagcggcaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctg
cccttacccaggggccacagagcccccgagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|A0A2I3RGH5_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Pan troglodytes GN=BBC3 (length=786 residues).
atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggctgcttccgcgacgtgggtcccctgcca
gatttgtggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgc
gacggcccgcgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgc
cgcccccgccgcccccaccctgctgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctgg
ggggtccccgctggcctgggggtccccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctctcgctg
gcggagcagcacctggagtcgcccgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagt
ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacg
agcggcggagacaagaggagcagcagcggcaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctg
cccttacccaggggccacagagcccccgagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|A0A2I3N2Z9_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Papio anubis GN=BBC3 (length=306 residues).
ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccagggcttcttctgcgacgtgggtcccctgcca
gatttgtgagacaagaggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctg
cccttacccaggggccacagagcccccgaaatggagcccaattaggtgcctgcacccgcccggtggacgtcagggacttg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|A0A2I3N2Z9_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Papio anubis GN=BBC3 (length=786 residues).
ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccagggcttcttctgcgacgtgggtcccctgcca
gatttgtggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgc
gacggcccgcgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgc
cgcccccgccgcccccgccctgctgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctgg
ggggcccccgctggcctgggggtccccgcagccggccccgaggcccacgcccggacggtcctcagccctcgctcttgctg
gcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctggcgggcggtcccacccaggcggccccgggagt
ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacg
agcggcggagacaagaggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctg
cccttacccaggggccacagagcccccgaaatggagcccaattaggtgcctgcacccgcccggtggacgtcagggacttg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|A0A2I3N2Z9_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Papio anubis GN=BBC3 (length=396 residues).
ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccagggcttcttctgcgacgtgggtcccctgcca
gatttgtggtcctcagccctcgctcttgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccccgaaatggagcccaattag
>gnl|bcl2dbcds|H2NZD3_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Pongo abelii GN=BBC3 (length=582 residues).
atggcccgcgcacggcaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggccgccgcccccgccgcccccgccctgc
tgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcc
cgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcag
cagcggcaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagc
ccccgagatggagcccaattag
>gnl|bcl2dbcds|A0A2K6FQZ1_BBC3-04 BCL2 binding component 3 gene OS=[Eukaryota] Propithecus coquereli GN=BBC3 (length=396 residues).
atgaaatttggtgcggggtctgcccgggcatgtccctgccaggtgcccgggacttccttctcatggtgggtcctgggcca
tattcctggtcctcagccatcactctcgctggcagagcagcacctggagtcgcccgtccccagcgccccgggggccctgg
cgggcggtcccacccaggcggccccgggagtccggggggaggaggagcagtgggcccgagagatcggggcccagctgcgg
cggatggcagacgacctcaatgcgcagtacgagcggcggagacaagaggagcagcagagacaccgcccctcaccctggag
ggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccctgagatggagcccaattag
>gnl|bcl2dbcds|A0A2K6FQZ1_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Propithecus coquereli GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cggccgcctggtgccctcggccgtgtcctgcggcctctgcgagcccggcctgcccgctgcccccgccgcccccgccctgc
tacccgctgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccgaccccgaggcccgcgcccggacggtcctcagccatcactctcgctggcagagcagcacctggagtcgcc
cgtccccagcgccccgggggccctggcgggcggtcccacccaggcggccccgggagtccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggcagacgacctcaatgcgcagtacgagcggcggagacaagaggagcag
cagagacaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagc
ccctgagatggagcccaattag
>gnl|bcl2dbcds|A0A2K6FQZ1_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Propithecus coquereli GN=BBC3 (length=783 residues).
atgaaatttggtgcggggtctgcccgggcatgtccctgccaggtgcccgggacttccttctcatggtgggtcctgggcca
tattcctggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgc
gacggcccgcgccccttcccgctcggccgcctggtgccctcggccgtgtcctgcggcctctgcgagcccggcctgcccgc
tgcccccgccgcccccgccctgctacccgctgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctgg
ggggcccccgctggcctgggggtccccgcagccgaccccgaggcccgcgcccggacggtcctcagccatcactctcgctg
gcagagcagcacctggagtcgcccgtccccagcgccccgggggccctggcgggcggtcccacccaggcggccccgggagt
ccggggggaggaggagcagtgggcccgagagatcggggcccagctgcggcggatggcagacgacctcaatgcgcagtacg
agcggcggagacaagaggagcagcagagacaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctg
cccttacccaggggccacagagccccgatggagcccaattaggtgcctgcacccgcctggtggacgtcggagacttgggg
ggcaggaccctcccacctcctgacaccctggccagcacgggggactttttctgcaccatgtag
>gnl|bcl2dbcds|A0A2K6FQZ1_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Propithecus coquereli GN=BBC3 (length=303 residues).
atgaaatttggtgcggggtctgcccgggcatgtccctgccaggtgcccgggacttccttctcatggtgggtcctgggcca
tattcctgagacaagaggagcagcagagacaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctg
cccttacccaggggccacagagccccgatggagcccaattaggtgcctgcacccgcctggtggacgtcggagacttgggg
ggcaggaccctcccacctcctgacaccctggccagcacgggggactttttctgcaccatgtag
>gnl|bcl2dbcds|Q80ZG6_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Rattus norvegicus GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctctccggagcccgtagagggcctagcccgcgacagcccgcgtcctttcccgct
cggccgcctgatgccctccgctgtatcctgcggcctctgcgagcccggcctgcccgctgcccctgctgcccctgccttgc
tgccggccgcctacctctgcgcccccaccgccccgcctgccgtcaccgccgccctggggggcccccgctggcctgggggt
caccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctgtcaccagcccagcagcacctagagtcgcc
cgtgcccagcgccccggaggccctggcgggaggccccacccaagctgccccgggagtgcgtgtggaggaggaggagtggg
cccgggagatcggggcccagctgcggaggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaagagcaa
catcgacaccgaccctcgccctggagggtcatgtataatctcttcatgggactcctccccttacccagggatcctggagc
cccagaaatggagcccaactag
>gnl|bcl2dbcds|A0A2K6KS56_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Rhinopithecus bieti GN=BBC3 (length=642 residues).
atgccgcgcaccagaggcagctcccccggacccgtagagggctggccgcgacggccgtcgccccttcccgctcggcctgt
cctgcggcctctgcgagcccggccggctgccgcccccgctgcccccgccctgctcgcccgcctgccacctctgcgccccc
accgcccacgccgtcccgcgccgcccctggggcgctggcctggtcccgcagccgccccgggcccacgcccggaggtgagt
gcccgcccgccccccgggttgataggagtcgggcgcacctggagtcgcggtgccagccccggggccctggcgggcggtcc
accaggcggccccgggagtcgcggggaggaggcgaagtgggccgggaatcggggcccagctgcggcggatggcgagacga
ctcaacgcgcagtacagacggcggagacaagaggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatct
cattatgggactcctgcccttacccaggggccacagagcccccgaaatggagcccaattaggtgcctgcacccgcccggt
ggacgtcagggactcggggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgt
ag
>gnl|bcl2dbcds|A0A2K6KS56_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Rhinopithecus bieti GN=BBC3 (length=261 residues).
ctggcggagcgcacctggagtcgcggtgccagccccggggccctggcggccccgggagtcgcggggaggaggcgaagtgg
gccgggaatcggggcccagctgcggcggatggcgagacgactcaacgcgcagtacagacggcggagacaagaggagcagc
agcgacaccgcccctcgccctggagggtcctgtacaatctcattatgggactcctgcccttacccaggggccacagagcc
cccgaaatggagcccaattag
>gnl|bcl2dbcds|A0A2K6QZT2_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BBC3 (length=306 residues).
ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccagggcttcttctgcgacgtgggtcccctgcca
gatttgtgagacaagaggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctcattatgggactcctg
cccttacccaggggccacagagcccccgaaatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|A0A2K6QZT2_BBC3-04 BCL2 binding component 3 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BBC3 (length=396 residues).
ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccagggcttcttctgcgacgtgggtcccctgcca
gatttgtggtcctcagccctcgctctcgctggcggagcagcacctggagtcgccggtgcccagcgccccgggggccctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctggag
ggtcctgtacaatctcattatgggactcctgcccttacccaggggccacagagcccccgaaatggagcccaattag
>gnl|bcl2dbcds|A0A2K6QZT2_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BBC3 (length=786 residues).
ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccagggcttcttctgcgacgtgggtcccctgcca
gatttgtggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgc
gacggcccgcgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgc
cacccccgctgcccccgccctgctgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctgg
ggggcccccgctggcctgggggtccccgcagccggccccgaggcccacgcccggacggtcctcagccctcgctctcgctg
gcggagcagcacctggagtcgccggtgcccagcgccccgggggccctggcgggcggtcccacccaggcggccccgggagt
ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacg
agcggcggagacaagaggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctcattatgggactcctg
cccttacccaggggccacagagcccccgaaatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|A0A2K6QZT2_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgccacccccgctgcccccgccctgc
tgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccggccccgaggcccacgcccggacggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcc
ggtgcccagcgccccgggggccctggcgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcag
cagcgacaccgcccctcgccctggagggtcctgtacaatctcattatgggactcctgcccttacccaggggccacagagc
ccccgaaatggagcccaattag
>gnl|bcl2dbcds|A0A2K6STD6_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BBC3 (length=306 residues).
atgaaatgtggcatggggtctgcctgggcatgtccatgccaagtgcccagggcttcttccttgacgtgggtcccctgcca
gatgtgtgagacaagaagagcagccgcaacaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctg
ccctttcccaggggccacagagccccagagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|A0A2K6STD6_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BBC3 (length=396 residues).
atgaaatgtggcatggggtctgcctgggcatgtccatgccaagtgcccagggcttcttccttgacgtgggtcccctgcca
gatgtgtggttctcagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggagcagtgggctcgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaagagcagccgcaacaccgcccctcaccctggag
ggtcctgtacaatctcatcatgggactcctgccctttcccaggggccacagagccccagagatggagcccaattag
>gnl|bcl2dbcds|A0A480SCP6_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Sus scrofa GN=BBC3 (length=651 residues).
atggcttctggagcgtgtcccatcagtgggccagtgagcaggaacctgtcacaggccccagggagcgccatggcccgagc
acgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgtcccttccccctcagccgcctgg
tgccctccgccgtgtcctgcggcctctgcgaacccggtctgcctgccgcccccgccgcccccaccctgctgcccgctgcc
tacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagccg
gccccgaggcccgcgccccgacggtcctcagccctcactctcgccggcggagcagcacctggaatcgccagtgcccagcg
ctccgggggccctggcgggcggccccacccaagcagccccgggaatccggggggaggaggagcagtgggcccgagagatc
ggggcccagctgcggcggatggctgacgatctcaacgcgctgtacgagcggcggagacaagaggagcagcagcgacaccg
cccctcgccctggagggttctgtacaatctcatcatgggacttctgcccttacccaggggccgtggagcccccgagatgg
agcctaattag
>gnl|bcl2dbcds|A0A480SCP6_BBC3-04 BCL2 binding component 3 gene OS=[Eukaryota] Sus scrofa GN=BBC3 (length=1086 residues).
atgaccgtgtttgtgggaggttgtgctggccagccagtgccttgggtcagcccccccaccatggggggggcgtgtctctt
ggggccttctcacctgcctcccctccatctgggccttgtgtgtgttgtgggtgccagccctgggcttccctgcctgccac
gtgtcctcatgcctgggttcaagagtggggtgccctgtgtaccccagggaggggggtgccctgggggccggcctgatgcc
ccctgcacttctcagctgaccgtgcccctctgtcctgtcctgcaggccccagggagcgccatggcccgagcacgccagga
gggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgtcccttccccctcagccgcctggtgccctccg
ccgtgtcctgcggcctctgcgaacccggtctgcctgccgcccccgccgcccccaccctgctgcccgctgcctacctctgc
gcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagccggccccgagg
cccgcgccccgacggtcctcagccctcactctcgccggcggagcagcacctggaatcgccagtgcccagcgctccggggg
ccctggcgggcggccccacccaagcagccccgggaatccggggggaggaggagcagtgggcccgagagatcggggcccag
ctgcggcggatggctgacgatctcaacgcgctgtacgagcggcgggtgagtgctgggggaggggtagacggcaggtggga
cttcccgcggggagggggttgggggcgacccagccagatgtgcggcagctgctgccctgcgcggcggggtcgcgctgggg
acaggcaggtgggaggggcggcctgtccgcggagccaccgtaaggcccgcgctgcggctggcaccaccgggtcgagggcc
agggccggggcagcctcgagcgttacggtgtgcccgcggccggcggccggcggccggcggccgcgagaactgagggcggc
gctcagccgagcggctcatatatcccaggctatttatagccggtga
>gnl|bcl2dbcds|A0A480SCP6_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Sus scrofa GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgtcccttccccct
cagccgcctggtgccctccgccgtgtcctgcggcctctgcgaacccggtctgcctgccgcccccgccgcccccaccctgc
tgcccgctgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgccccgacggtcctcagccctcactctcgccggcggagcagcacctggaatcgcc
agtgcccagcgctccgggggccctggcgggcggccccacccaagcagccccgggaatccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggctgacgatctcaacgcgctgtacgagcggcggagacaagaggagcag
cagcgacaccgcccctcgccctggagggttctgtacaatctcatcatgggacttctgcccttacccaggggccgtggagc
ccccgagatggagcctaattag
>gnl|bcl2dbcds|A0A480SCP6_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Sus scrofa GN=BBC3 (length=393 residues).
gcgagagtcagtgcaggggctgcccgggcatgtccgtgcccagtgcccagggctttctgctcaccctggccccaccagat
tcatggtcctcagccctcactctcgccggcggagcagcacctggaatcgccagtgcccagcgctccgggggccctggcgg
gcggccccacccaagcagccccgggaatccggggggaggaggagcagtgggcccgagagatcggggcccagctgcggcgg
atggctgacgatctcaacgcgctgtacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctggagggt
tctgtacaatctcatcatgggacttctgcccttacccaggggccgtggagcccccgagatggagcctaattag
>gnl|bcl2dbcds|A0A4X1VVX9_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Sus scrofa GN=BBC3 (length=576 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgtcccttccccct
cagccgcctggtgccctccgccgtgtcctgcggcctctgcgaacccggtctgcctgccgcccccgccgcccccaccctgc
tgcccgctgcctacctctgcgccaccgcccccgccgtcaccgccgccctggggggcccccgctggcctgggggtccccgc
agccggccccgaggcccgcgccccgacggtcctcagccctcactctcgccggcggagcagcacctggaatcgccagtgcc
cagcgctccgggggccctggcgggcggccccacccaagcagccccgggaatccggggggaggaggagcagtgggcccgag
agatcggggcccagctgcggcggatggctgacgatctcaacgcgctgtacgagcggcggagacaagaggagcagcagcga
caccgcccctcgccctggagggttctgtacaatctcatcatgggacttctgcccttacccaggggccgtggagcccccga
gatggagcctaattag
>gnl|bcl2dbcds|A0A4X1VVX9_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Sus scrofa GN=BBC3 (length=393 residues).
gcgagagtcagtgcaggggctgcccgggcatgtccgtgcccagtgcccagggctttctgctcaccctggccccaccagat
tcatggtcctcagccctcactctcgccggcggagcagcacctggaatcgccagtgcccagcgctccgggggccctggcgg
gcggccccacccaagcagccccgggaatccggggggaggaggagcagtgggcccgagagatcggggcccagctgcggcgg
atggctgacgatctcaacgcgctgtacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctggagggt
tctgtacaatctcatcatgggacttctgcccttacccaggggccgtggagcccccgagatggagcctaattag
>gnl|bcl2dbcds|A0A4X2LVY2_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Vombatus ursinus GN=BBC3 (length=699 residues).
atggtgctggagggggcagcggcggagcccgctctgacctgctccgcccacctgtctccacaggctccccggtgtggcat
ggccagagcacagcaggacggcagctcccgagaaccagtagagggtctgccccgggagggccccagaacctttcccctgg
ggcggctcatgccctctgcagtctcctgcagcctctgcgaggctggcctgaacccttctggtgactccatgtgtccagcc
cctggccccgcgctggcacccccttccctcctgcccctcgcctacttctgcactcgacagccccgttcctatgggggccc
ccgctgggcccgggtggccaggagcccagcccccagcagccagggccagagtggctcccagccctcgttgggtgaaaggt
ctgcagaggaccaggaggagggaggacaggaggtagaaccccagggagcatccccgatgtctggtggccccccaggggtg
ttaggcccagaccacgggggccaagcagagcagcaagaccgggagattggggcccagctccgaaggatggccgatgacct
caatgctctgtatgagcagcggagacgagaggaggagcaaagacggcatctctccccctggaggctgctctacaatctcg
tctcaggactcctggccccacaccgagggaaccggatccccgagatcgaacccaactag
>gnl|bcl2dbcds|A0A4X2LVY2_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Vombatus ursinus GN=BBC3 (length=621 residues).
atggccagagcacagcaggacggcagctcccgagaaccagtagagggtctgccccgggagggccccagaacctttcccct
ggggcggctcatgccctctgcagtctcctgcagcctctgcgaggctggcctgaacccttctggtgactccatgtgtccag
cccctggccccgcgctggcacccccttccctcctgcccctcgcctacttctgcactcgacagccccgttcctatgggggc
ccccgctgggcccgggtggccaggagcccagcccccagcagccagggccagagtggctcccagccctcgttgggtgaaag
gtctgcagaggaccaggaggagggaggacaggaggtagaaccccagggagcatccccgatgtctggtggccccccagggg
tgttaggcccagaccacgggggccaagcagagcagcaagaccgggagattggggcccagctccgaaggatggccgatgac
ctcaatgctctgtatgagcagcggagacgagaggaggagcaaagacggcatctctccccctggaggctgctctacaatct
cgtctcaggactcctggccccacaccgagggaaccggatccccgagatcgaacccaactag
© 1998-2020Legal notice