Dataset for CDS BBC3 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

44 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          atgggtgtgcggccccgcggcgccccctggcgcccggagccggcgggggg
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-03          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          --------------------------------------------------
F1RM01_BBC3-02          --------------------------------------------------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
                                                                          

F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          cggcggggctgggggccgggcgaggggcacggccgggcgggcgcgtgcca
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          -atg------------------caggggctgcccgggcatgtccctgtc-
J9NTK9_BBC3-03          -at-----------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      -atgaaattgagtg--------tgggggctgcccgggcatgttcgtgcc-
A0A3Q2GWE8_BBC3-01      -gtgagagtcagcg--------caggggctgcccgggcatgtctgtgcc-
A0A3Q2GWE8_BBC3-02      -gtgagagtcagcg--------caggggctgcccgggcatgtctgtgcc-
F1RM01_BBC3-04          --------atgaccgtgtttgtgggaggttgtgctggccagccagtgcct
F1RM01_BBC3-02          --------------------------------------------------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      -atgaaatttggtg--------cggggtctgcccgggcatgtccctgcc-
A0A2K6STD6_BBC3-02      -atgaaatgtggca--------tggggtctgcctgggcatgtccatgcc-
A0A2K5F6X4_BBC3-02      ----aaatgtggcg--------tggggtctgcctgggcatgtccatgcc-
A0A2R8MW85_BBC3-02      -atgaaatgtggcg--------tggggtctgcctgggcatgtccatgcc-
A0A2K5QNS7_BBC3-02      -atgaaatgtggcg--------tggggtctgcctgggcatgtccatgcc-
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      -ataaaatttggcg--------tggggtctgcccgggcatgtccatgcc-
A0A2K5P2T8_BBC3-03      -ataaaatttggcg--------tggggtctgcccgggcatgtccatgcc-
A0A2K5V8J3_BBC3-03      -ataaaatttggcg--------tggggtctgcccgggcatgtccatgcc-
A0A2K6ASP2_BBC3-03      -ataaaatttggcg--------tggggtctgcccgggcatgtccatgcc-
A0A2I3N2Z9_BBC3-03      -ataaaatttggcg--------tggggtctgcccgggcatgtccatgcc-
A0A2R8MW85_BBC3-03      -aggaagccgcccgccctccaccgccgccccctccggcgtgttcatgccc
A0A2I3HWI8_BBC3-03      -atgaaatttggca--------tggggtctgcccgggcatgtccatgcc-
A0A2R9BZA9_BBC3-01      -atgaaatttggca--------tggggtctgcccaggcatgtccatgcc-
A0A2I3RGH5_BBC3-03      -atgaaatttggca--------tggggtctgcccaggcatgtccatgcc-
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          -atgaaatttggca--------tggggtctgcccaggcatgtccatgcc-
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          -atgaaatttggca--------tggggtctgcccaggcatgtccatgcc-
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
                                                                          

F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          ctgggcgtgttgttttccaggggctcggcgtgggcctccgcagtggtgag
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-03          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          tgggtcagcccccccaccatggggggggcgtgtctcttggggccttctca
F1RM01_BBC3-02          -----------------------------atggcttctggagc-------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      ccggggtgagtgtgcgcgccctgaatcctcgccggcggcgatcggccagg
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
                                                                          

F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          tgtgcgccgcggctgggggtgcgcgtgccgtgccgtgagcgggggccgct
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-03          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          cctgcctcccctccatctgggccttgtgtgtgttgtgggtgccagccctg
F1RM01_BBC3-02          --------------------------------------------------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      ccgggtgggctccctggaggaggtgacaggagtgcaggcggcgagcagtg
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
                                                                          

F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          gtcaccgcgctgctgctgccgctgtgagtgcggggccggactggggaaac
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          ---------------------------------------------aggtg
J9NTK9_BBC3-03          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      ---------------------------------------------aggtg
A0A3Q2GWE8_BBC3-01      ---------------------------------------------aggcg
A0A3Q2GWE8_BBC3-02      ---------------------------------------------aggcg
F1RM01_BBC3-04          ggcttccctgcctgccacgtgtcctcatgcctgggttcaagagtggggtg
F1RM01_BBC3-02          --------------------------------------------------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          -----------------------------------------------atg
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      ---------------------------------------------aggtg
A0A2K6STD6_BBC3-02      ---------------------------------------------aagtg
A0A2K5F6X4_BBC3-02      ---------------------------------------------aagtg
A0A2R8MW85_BBC3-02      ---------------------------------------------aagtg
A0A2K5QNS7_BBC3-02      ---------------------------------------------aagtg
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      ---------------------------------------------aggtg
A0A2K5P2T8_BBC3-03      ---------------------------------------------aggtg
A0A2K5V8J3_BBC3-03      ---------------------------------------------aggtg
A0A2K6ASP2_BBC3-03      ---------------------------------------------aggtg
A0A2I3N2Z9_BBC3-03      ---------------------------------------------aggtg
A0A2R8MW85_BBC3-03      cgggcgccctgcctccccacactgcgcctccccacaaaccccacgaggga
A0A2I3HWI8_BBC3-03      ---------------------------------------------aggtg
A0A2R9BZA9_BBC3-01      ---------------------------------------------aggtg
A0A2I3RGH5_BBC3-03      ---------------------------------------------aggtg
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          ---------------------------------------------aggtg
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          ---------------------------------------------aggtg
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
                                                                          

F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          tgaggcggggccgggcccgaggggtggcaccgccgctcacctgctccgcc
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          ctcggggtttccttctggccctgtgggtccc-------------------
J9NTK9_BBC3-03          -----------------gccctgtgtgactc-------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      cccagggttgcctcc--tgtgggtgggcccacgccctatttgtgtggagc
A0A3Q2GWE8_BBC3-01      cctggggcttccttc--tcaccctgggtccc-------------------
A0A3Q2GWE8_BBC3-02      cctggggcttccttc--tcaccctgggtccc-------------------
F1RM01_BBC3-04          ccctgtgtaccccag--ggaggggggtgccctgggggccggcctgatgcc
F1RM01_BBC3-02          ----gtgtcccatca--gtgggccagtgagcaggaacctgtc--------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          ccctgtgtgactccc--aggc--tgggcccc-------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      cccgggacttccttc--tcatggtgggtcct-------------------
A0A2K6STD6_BBC3-02      cccagggcttcttcc--ttgacgtgggtccc-------------------
A0A2K5F6X4_BBC3-02      cctagggcttcttcc--tcgacgtgggtccc-------------------
A0A2R8MW85_BBC3-02      cccagggcttcttcc--tcggtgtgggtccc-------------------
A0A2K5QNS7_BBC3-02      cccagggcttcttcc--tcggtgtgggttcc-------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      cccagggcttcttct--gcgacgtgggtccc-------------------
A0A2K5P2T8_BBC3-03      cccagggctgcttct--gcgacgtgggtcct-------------------
A0A2K5V8J3_BBC3-03      cccagggcttcttct--gcgacgtgggtccc-------------------
A0A2K6ASP2_BBC3-03      cccagggcttcttct--gcgacgtgggtccc-------------------
A0A2I3N2Z9_BBC3-03      cccagggcttcttct--gcgacgtgggtccc-------------------
A0A2R8MW85_BBC3-03      ccctgggctggggtc--gcggggagggaggcggctcggcgttggggcgcc
A0A2I3HWI8_BBC3-03      cccagggcttcttcc--gtgacgtgggtccc-------------------
A0A2R9BZA9_BBC3-01      cccagggctgcttcc--gtgacgtgggtccc-------------------
A0A2I3RGH5_BBC3-03      cccagggctgcttcc--gcgacgtgggtccc-------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          cccagggctgcttcc--acgacgtgggtccc-------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          cccagggctgcttcc--acgacgtgggtccc-------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
                                                                          

F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          cacctgtctgtgtccctccgcaggctccctccccactggggc--------
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          -----------------------------ccgtcagatctgt--------
J9NTK9_BBC3-03          -----------------------------cca------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      ctggctaggtgtgcacagtctggagtatgtcctgccagtggg--------
A0A3Q2GWE8_BBC3-01      -----------------------------ccagcagactcgt--------
A0A3Q2GWE8_BBC3-02      -----------------------------ccagcagactcgt--------
F1RM01_BBC3-04          ccctgcacttctcagctgaccgtgcccctctgtcctgtcctg--------
F1RM01_BBC3-02          -----------------------------------------a--------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      -----------------------------gggccatattcct--------
A0A2K6STD6_BBC3-02      -----------------------------ctgccagatgtgt--------
A0A2K5F6X4_BBC3-02      -----------------------------ctgccagatgtgt--------
A0A2R8MW85_BBC3-02      -----------------------------ctgccagatgtgt--------
A0A2K5QNS7_BBC3-02      -----------------------------ttgccagatgtgt--------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      -----------------------------ctgccagatttgt--------
A0A2K5P2T8_BBC3-03      -----------------------------ctgccagatttgt--------
A0A2K5V8J3_BBC3-03      -----------------------------ctgccagatttgt--------
A0A2K6ASP2_BBC3-03      -----------------------------ctgccagatttgt--------
A0A2I3N2Z9_BBC3-03      -----------------------------ctgccagatttgt--------
A0A2R8MW85_BBC3-03      tggtctgggcgcacaggtgcctcggcggtctggcgggtttgtttacaaac
A0A2I3HWI8_BBC3-03      -----------------------------ctgccagatttgt--------
A0A2R9BZA9_BBC3-01      -----------------------------ctgccagatttgt--------
A0A2I3RGH5_BBC3-03      -----------------------------ctgccagatttgt--------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          -----------------------------ctgccagatttgt--------
B4DQK3_BBC3-01          ----------------------------------------at--------
Q9BXH1_BBC3-03          -----------------------------ctgccagatttgt--------
A0A0D9S2H2_BBC3-01      ----------------------------------------ca--------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
                                                                          

F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-03          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          --------------------------------------------------
F1RM01_BBC3-02          --------------------------------------------------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      aatggggtgcgggctcggcagcgccccctggcggccagtgcgaccccggg
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
                                                                          

F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-03          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          --------------------------------------------------
F1RM01_BBC3-02          --------------------------------------------------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      gaagagggtcgaccccggggtgccccagcccccaaagtcagggaggggcg
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
                                                                          

F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-03          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          --------------------------------------------------
F1RM01_BBC3-02          --------------------------------------------------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      ggggggcggcacggaggggcggccacacccagggcgcgcgcccgctgggg
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
                                                                          

F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-03          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          --------------------------------------------------
F1RM01_BBC3-02          --------------------------------------------------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      gcggcgacagggggcggctcgcgggccgtggagtctgcggctcctgcggg
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
                                                                          

F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-03          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          --------------------------------------------------
F1RM01_BBC3-02          --------------------------------------------------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      cgggggctgcgccccagcaacagccggttattggccccgcgctcgcctgg
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
                                                                          

F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          ---------------------------------------------gccaa
J9NTK9_BBC3-03          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          --------------------------------------------------
F1RM01_BBC3-02          --------------------------------------------------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      cgggcggggcgggcgcacgtggcggcggtgggggtggctgtgacagcgga
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
                                                                          

F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          gcgcggctagatgtgcctgctccagagtgtgtccccatcagtgggccagt
J9NTK9_BBC3-03          ----ggct------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      ---------------------------------------------ccagt
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          --------------------------------------------------
F1RM01_BBC3-02          --------------------------------------------------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      gtggggcgtctgggaccgccgtgggagcgcgcgtgtgcggggttgtggat
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
                                                                          

F7GL32_BBC3-02          ----------------------------------atggccagagcccagc
F7GL32_BBC3-01          ----------------------------------atggccagagcccagc
G3T2N1_BBC3-01          ----------------------------------atggcccgcgcacgcc
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          ----------------caggccccagggagcgccatggcccgagcacgcc
A0A1U7R5N5_BBC3-01      ----------------------------------atggcccgcgcacgcc
Q99ML1_BBC3-02          ----------------------------------atggcccgcgcacgcc
Q80ZG6_BBC3-01          ----------------------------------atggcccgcgcacgcc
J9NTK9_BBC3-01          taccaggaacctgttacaggccccagggagcgccatggcccgagcacgcc
J9NTK9_BBC3-03          -----------------gggccccagggagcgccatggcccgagcacgcc
H0XQ00_BBC3-01          ----------------------------------atggcccgcgcacgcc
A0A250YBU3_BBC3-02      ----------------------------------atggcccgcgcacgcc
A0A250YBU3_BBC3-01      tagcaggaacctgtcacaggccccagggagcgccatggcccgcgcacgcc
A0A3Q2GWE8_BBC3-01      ------------------ggccccagggagcgccatggcccgagcacgcc
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          ----------------caggccccagggagcgccatggcccgagcacgcc
F1RM01_BBC3-02          ----------------caggccccagggagcgccatggcccgagcacgcc
F1RM01_BBC3-03          ----------------------------------atggcccgagcacgcc
J9NTK9_BBC3-02          ------------------------agggagcgccatggcccgagcacgcc
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      ----------------------------------atggcccgagcacgcc
A0A452E3G1_BBC3-01      ----------------------------------atggcccgagcacgcc
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      ----------------------------------atggcccgcgcacgcc
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      ctgcaggtgtctcgcctgggccccagggagcgccatggcccgcgcacgcc
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          ----------------------------------atggcccgcgcacggc
A0A2I3RGH5_BBC3-01      ----------------------------------atggcccgcgcacgcc
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          ------------------ggccccagggagcgccatggcccgcgcacgcc
Q9BXH1_BBC3-03          ------------------ggccccagggagcgccatggcccgcgcacgcc
A0A0D9S2H2_BBC3-01      ------------------ggccccagggagcgccatggcccgcgcacgcc
A0A2K6QZT2_BBC3-01      ----------------------------------atggcccgcgcacgcc
                                                                          

F7GL32_BBC3-02          aggatggcagctctccggagccggtggaggggctgccccgggagagcccc
F7GL32_BBC3-01          aggatggcagctctccggagccggtggaggggctgccccgggagagcccc
G3T2N1_BBC3-01          aggagggcagctcccccgagcccgtagagggtctggcccgcgagagcccg
G1LNV7_BBC3-01          -ggaag---------cggggcaagaggggacccgatttcaagaccacagg
M3Y0R3_BBC3-01          aggagggcagctccccggagcccgtagagggcctgtcccgcgacggcccg
A0A1U7R5N5_BBC3-01      aggagggcagctctccggagcccgtagagggcttggcccgcgacagtccg
Q99ML1_BBC3-02          aggagggcagctctccggagcccgtagagggtctagcccgcgacagtccg
Q80ZG6_BBC3-01          aggagggcagctctccggagcccgtagagggcctagcccgcgacagcccg
J9NTK9_BBC3-01          aggagggcagctccccggagcccgtagagggcctggcccgcgacggtccg
J9NTK9_BBC3-03          aggagggcagctccccggagcccgtagagggcctggcccgcgacggtccg
H0XQ00_BBC3-01          aagagggcagctccccggagcccgtagagggcctggctcgcgacggtccg
A0A250YBU3_BBC3-02      aggagggcagctctccggagcccgtagagggcttagctcgcgacggcccg
A0A250YBU3_BBC3-01      aggagggcagctctccggagcccgtagagggcttagctcgcgacggcccg
A0A3Q2GWE8_BBC3-01      aggagggcagctccccggagccggtagagggcctggcccgcgacggcccg
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          aggagggcagctccccggagcccgtagagggcctggcccgcgacggcccg
F1RM01_BBC3-02          aggagggcagctccccggagcccgtagagggcctggcccgcgacggcccg
F1RM01_BBC3-03          aggagggcagctccccggagcccgtagagggcctggcccgcgacggcccg
J9NTK9_BBC3-02          aggagggcagctccccggagcccgtagagggcctggcccgcgacggtccg
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      aggagggcagctccccggagcccgtagagggcctggcccgcgacggcccg
A0A452E3G1_BBC3-01      aggagggcagctcccccgagcccgtagagggcctggcccgcgacggcccg
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      aggagggcagctccccggagcccgtagagggcctggcccgcgacggcccg
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      aggagggcagctccccggagcccgtagagggcttggcccgcgacggcccg
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          aggagggcagctccccggagcccgtagagggcctggcccgcgacggcccg
A0A2I3RGH5_BBC3-01      aggagggcagctccccggagcccgtagagggcctggcccgcgacggcccg
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          aggagggcagctccccggagcccgtagagggcctggcccgcgacggcccg
Q9BXH1_BBC3-03          aggagggcagctccccggagcccgtagagggcctggcccgcgacggcccg
A0A0D9S2H2_BBC3-01      aggagggcagctccccggagcccgtagagggcctggcccgcgacggcccg
A0A2K6QZT2_BBC3-01      aggagggcagctccccggagcccgtagagggcctggcccgcgacggcccg
                                                                          

F7GL32_BBC3-02          aggaccttccccctgggccggctcatgccctctgcggtctcctgcagcct
F7GL32_BBC3-01          aggaccttccccctgggccggctcatgccctctgcggtctcctgcagcct
G3T2N1_BBC3-01          cgccccttcccactcggcagcctggtgccctcggccgtgtcctgtggcct
G1LNV7_BBC3-01          cacagg------------------------------------tgtggaaa
M3Y0R3_BBC3-01          cgcccctttcccctcagccgcctggtgccctcggccgtgtcctgtggcct
A0A1U7R5N5_BBC3-01      cgccccttcccgctcggccgcctggtgccctccgctgtgtcctgcggcct
Q99ML1_BBC3-02          cgccccttcccgctcggccgcctgatgccctccgctgtatcctgcagcct
Q80ZG6_BBC3-01          cgtcctttcccgctcggccgcctgatgccctccgctgtatcctgcggcct
J9NTK9_BBC3-01          cgcccgtttcccctcagccgcctggtgccctcggccgtgtcctgcggcct
J9NTK9_BBC3-03          cgcccgtttcccctcagccgcctggtgccctcggccgtgtcctgcggcct
H0XQ00_BBC3-01          cgccccttcccgctcggccgcctagtgccctcggccgtgtcctgcggcct
A0A250YBU3_BBC3-02      cgccccttcccgctcggtcgcctggtgccctcggccgtgtcctgcggcct
A0A250YBU3_BBC3-01      cgccccttcccgctcggtcgcctggtgccctcggccgtgtcctgcggcct
A0A3Q2GWE8_BBC3-01      cgccccttcccgctcagccgcctggtgccctcggccgtgtcctgcggcct
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          cgtcccttccccctcagccgcctggtgccctccgccgtgtcctgcggcct
F1RM01_BBC3-02          cgtcccttccccctcagccgcctggtgccctccgccgtgtcctgcggcct
F1RM01_BBC3-03          cgtcccttccccctcagccgcctggtgccctccgccgtgtcctgcggcct
J9NTK9_BBC3-02          cgcccgtttcccctcagccgcctggtgccctcggccgtgtcctgcggcct
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      cgccccttcccgctcagccgcctggtgccctcggcggtgtcctgcggcct
A0A452E3G1_BBC3-01      cgccccttcccgctcagccgcctggtgccctcggcggtgtcctgtggcct
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      cgccccttcccgctcggccgcctggtgccctcggccgtgtcctgcggcct
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      cgccccttcccgcttggccgcctggtgccctcggccgtgtcctgcggcct
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          cgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcct
A0A2I3RGH5_BBC3-01      cgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcct
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          cgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcct
Q9BXH1_BBC3-03          cgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcct
A0A0D9S2H2_BBC3-01      cgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcct
A0A2K6QZT2_BBC3-01      cgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcct
                                                                          

F7GL32_BBC3-02          ctgtgaggccggcttgaacccctctggcgactccatgtgcccagccccgg
F7GL32_BBC3-01          ctgtgaggccggcttgaacccctctggcgactccatgtgcccagccccgg
G3T2N1_BBC3-01          ctgcgagcccggcctt------cctcgagttgcag---------------
G1LNV7_BBC3-01          ctgaggccccgatgtg----------------------------------
M3Y0R3_BBC3-01          ctgggaatctga--------------------ctgcagtccccgagttgc
A0A1U7R5N5_BBC3-01      ctgcgagcccggcctg------cccgccgcccctgctgcccccgccctgc
Q99ML1_BBC3-02          ttgcgagcccggcctg------cccgccgcccctgctgcccctgccttgc
Q80ZG6_BBC3-01          ctgcgagcccggcctg------cccgctgcccctgctgcccctgccttgc
J9NTK9_BBC3-01          ctgcgagcccggcctg------cccgccgcccctgctgcccctgccctgc
J9NTK9_BBC3-03          ctgcgagcccggcctg------cccgccgcccctgctgcccctgccctgc
H0XQ00_BBC3-01          ctgcgagcccggcctg------cccgccgcccctgccgccccggctctgc
A0A250YBU3_BBC3-02      ctgcgagccgggcctg------cccgccgccccagccgccccggccctgc
A0A250YBU3_BBC3-01      ctgcgagccgggcctg------cccgccgccccagccgccccggccctgc
A0A3Q2GWE8_BBC3-01      ctgcgagcccggcctg------cccgccgcgcccgccgcgcccgccctgc
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          ctgcgaacccggtctg------cctgccgcccccgccgcccccaccctgc
F1RM01_BBC3-02          ctgcgaacccggtctg------cctgccgcccccgccgcccccaccctgc
F1RM01_BBC3-03          ctgcgaacccggtctg------cctgccgcccccgccgcccccaccctgc
J9NTK9_BBC3-02          ctgcgagcccggcctg------cccgccgcccctgctgcccctgccctgc
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      ctgcgaacccggcctg------cctgctgcccccgccgcccccgccctgc
A0A452E3G1_BBC3-01      ctgcgaacccggcctg------cctgctgcccccgccgcccccgccctgc
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      ctgcgagcccggcctg------cccgctgcccccgccgcccccgccctgc
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      ctgcgagtccggcctg------cccgccacccccgccgcccccgccttgc
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          ctgcgagcccggcctg------gccgccgcccccgccgcccccgccctgc
A0A2I3RGH5_BBC3-01      ctgcgagcccggcctg------gctgccgcccccgccgcccccaccctgc
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          ctgcgagcccggcctg------gctgccgcccccgccgcccccaccctgc
Q9BXH1_BBC3-03          ctgcgagcccggcctg------gctgccgcccccgccgcccccaccctgc
A0A0D9S2H2_BBC3-01      ctgcgagcccggcctg------gctgccgcccccgccgcccccgccctgc
A0A2K6QZT2_BBC3-01      ctgcgagcccggcctg------gctgccacccccgctgcccccgccctgc
                                                                          

F7GL32_BBC3-02          ggccagcgctggcaccctcttccctcctgcccctcgcttacttctgcacg
F7GL32_BBC3-01          ggccagcgctggcaccctcttccctcctgcccctcgcttacttctgcacg
G3T2N1_BBC3-01          -ggc--cacggctccttccggggcctcggacacagctgtttcccagcccc
G1LNV7_BBC3-01          ---------tgactggagggaagcacagactgc-----------------
M3Y0R3_BBC3-01          agcc--cacggcct-tttccgggccggggcagcagctgtttcccagcccc
A0A1U7R5N5_BBC3-01      tgcc--ggccgcctacctctgcgcccccaccgc--------cccgcccgc
Q99ML1_BBC3-02          tgcc--ggccgcctacctctgcgcccccaccgc--------tccacctgc
Q80ZG6_BBC3-01          tgcc--ggccgcctacctctgcgcccccaccgc--------cccgcctgc
J9NTK9_BBC3-01          tgcc--cgctgcctacctctgcgcccccaccgc--------cccgcccgc
J9NTK9_BBC3-03          tgcc--cgctgcctacctctgcgcccccaccgc--------cccgcccgc
H0XQ00_BBC3-01          tgcc--cgccgcctacctctgcgcccccaccgc--------cccgcccgc
A0A250YBU3_BBC3-02      tgcc--cgccgcctacctctgcgcccccaccgc--------cccgcccgc
A0A250YBU3_BBC3-01      tgcc--cgccgcctacctctgcgcccccaccgc--------cccgcccgc
A0A3Q2GWE8_BBC3-01      tgcc--cgctgcctacctctgcgcccccgccgc--------cccgcccgc
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          tgcc--cgctgcctacctctgcgcccccaccgc--------cccgcccgc
F1RM01_BBC3-02          tgcc--cgctgcctacctctgcgcccccaccgc--------cccgcccgc
F1RM01_BBC3-03          tgcc--cgctgcctacctctgcgcccccaccgc--------cccgcccgc
J9NTK9_BBC3-02          tgcc--cgctgcctacctctgcgcccccaccgc--------cccgcccgc
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      tgcc--cgccgcctacctctgcgcccccaccgc--------cccgcccgc
A0A452E3G1_BBC3-01      tgcc--cgccgcctacctctgcgcccccaccgc--------cccgcccgc
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      tacc--cgctgcctacctctgcgcccccaccgc--------cccgcccgc
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      tgcc--cgctgcctacctctgcgcccccgccgc--------cccacccgc
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          tgcc--cgctgcctacctctgcgcccccaccgc--------cccacccgc
A0A2I3RGH5_BBC3-01      tgcc--cgctgcctacctctgcgcccccaccgc--------cccacccgc
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          tgcc--cgctgcctacctctgcgcccccaccgc--------cccacccgc
Q9BXH1_BBC3-03          tgcc--cgctgcctacctctgcgcccccaccgc--------cccacccgc
A0A0D9S2H2_BBC3-01      tgcc--cgctgcctacctctgcgcccccaccgc--------cccacccgc
A0A2K6QZT2_BBC3-01      tgcc--cgctgcctacctctgcgcccccaccgc--------cccacccgc
                                                                          

F7GL32_BBC3-02          cgacagccccgtgcctatgggggcccccgctgggcacgggcggccagg--
F7GL32_BBC3-01          cgacagccccgtgcctatgggggcccccgctgggcacgggcggccagg--
G3T2N1_BBC3-01          -----tctcc--agtctggg----tctctgatctctcgggactgcagttg
G1LNV7_BBC3-01          -----------------ggggcggctcagaagggggtggggc--------
M3Y0R3_BBC3-01          cacctccccc--agtctgggtctccttaacctcccagaggacgatagttg
A0A1U7R5N5_BBC3-01      cgtcaccgcc--gccctggggggcccccgctggcctgggggtccccgc--
Q99ML1_BBC3-02          cgtcaccgcc--gccctggggggcccccgctggcctgggggtcaccgc--
Q80ZG6_BBC3-01          cgtcaccgcc--gccctggggggcccccgctggcctgggggtcaccgc--
J9NTK9_BBC3-01          cgtcaccgcc--gccctggggggcccccgctggcctgggggtccccgc--
J9NTK9_BBC3-03          cgtcaccgcc--gccctggggggcccccgctggcctgggggtccccgc--
H0XQ00_BBC3-01          cgtcactgcc--accctagggggcccccgctggcctgggggtccccgc--
A0A250YBU3_BBC3-02      cgtcaccgca--gccttggggggcccccgctggcctggaggtccccgc--
A0A250YBU3_BBC3-01      cgtcaccgca--gccttggggggcccccgctggcctggaggtccccgc--
A0A3Q2GWE8_BBC3-01      cgtcaccgcc--gccctggggggcccccgctggcctgggggcccccgc--
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          cgtcaccgcc--gccctggggggcccccgctggcctgggggtccccgc--
F1RM01_BBC3-02          cgtcaccgcc--gccctggggggcccccgctggcctgggggtccccgc--
F1RM01_BBC3-03          cgtcaccgcc--gccctggggggcccccgctggcctgggggtccccgc--
J9NTK9_BBC3-02          cgtcaccgcc--gccctggggggcccccgctggcctgggggtccccgc--
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      cgtcaccgcc--gccctgggggccccccgctggcctgggggtccccgc--
A0A452E3G1_BBC3-01      cgtcactgcc--gccctgggggccccccgctggcctgggggtccccgc--
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      cgtcaccgcc--gccctggggggcccccgctggcctgggggtccccgc--
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      cgtcaccgcc--gccctggggggcccccgctggcctgggggcccccgc--
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          cgtcaccgcc--gccctggggggcccccgctggcctgggggtccccgc--
A0A2I3RGH5_BBC3-01      cgtcaccgcc--gccctggggggtccccgctggcctgggggtccccgc--
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          cgtcaccgcc--gccctggggggttcccgctggcctgggggtccccgc--
Q9BXH1_BBC3-03          cgtcaccgcc--gccctggggggttcccgctggcctgggggtccccgc--
A0A0D9S2H2_BBC3-01      cgtcaccgcc--gccctggggggcccccgctggcctgggggtccccgc--
A0A2K6QZT2_BBC3-01      cgtcaccgcc--gccctggggggcccccgctggcctgggggtccccgc--
                                                                          

F7GL32_BBC3-02          ---------------agcccggcggccggcaaccagggcca---aagcgg
F7GL32_BBC3-01          ---------------agcccggcggccggcaaccagggcca---aagcgg
G3T2N1_BBC3-01          gagagaggtggggccgagtgggaggacagggcccctcgtcctctctcagg
G1LNV7_BBC3-01          -------aggaaggcatctcccgaatcccagccc----------cccagg
M3Y0R3_BBC3-01          gagggagtgtgggcagagcgagaggactgctttt----------cccagg
A0A1U7R5N5_BBC3-01      -----------agccgaccccgaggcccacgccc----------ggacgg
Q99ML1_BBC3-02          -----------agccggcccagaggcccgcgccc----------ggacgg
Q80ZG6_BBC3-01          -----------agccggccccgaggcccgcgccc----------ggacgg
J9NTK9_BBC3-01          -----------agccggccccgaggcccgcgccc----------cgacgg
J9NTK9_BBC3-03          -----------agccggccccgaggcccgcgccc----------cgacgg
H0XQ00_BBC3-01          -----------agccggccccgaggcccgcgcct----------ggatgg
A0A250YBU3_BBC3-02      -----------agccggccccgaggcccgcgtcc----------ggatgg
A0A250YBU3_BBC3-01      -----------agccggccccgaggcccgcgtcc----------ggatgg
A0A3Q2GWE8_BBC3-01      -----------agccgtccccgagccccgcgccc----------cgacgg
A0A3Q2GWE8_BBC3-02      ------------------------------------------------gg
F1RM01_BBC3-04          -----------agccggccccgaggcccgcgccc----------cgacgg
F1RM01_BBC3-02          -----------agccggccccgaggcccgcgccc----------cgacgg
F1RM01_BBC3-03          -----------agccggccccgaggcccgcgccc----------cgacgg
J9NTK9_BBC3-02          -----------agccggccccgaggcccgcgccc----------cgacgg
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      -----------agccggccccgaggcccgcgacc----------cgacgg
A0A452E3G1_BBC3-01      -----------agccggccccgaggcccgcgacc----------cgacgg
A0A2K6FQZ1_BBC3-04      ------------------------------------------------gg
A0A2K6STD6_BBC3-02      ------------------------------------------------gg
A0A2K5F6X4_BBC3-02      ------------------------------------------------gg
A0A2R8MW85_BBC3-02      ------------------------------------------------gg
A0A2K5QNS7_BBC3-02      ------------------------------------------------gg
A0A2K6FQZ1_BBC3-01      -----------agccgaccccgaggcccgcgccc----------ggacgg
A0A2K6QZT2_BBC3-04      ------------------------------------------------gg
A0A2K5P2T8_BBC3-03      ------------------------------------------------gg
A0A2K5V8J3_BBC3-03      ------------------------------------------------gg
A0A2K6ASP2_BBC3-03      ------------------------------------------------gg
A0A2I3N2Z9_BBC3-03      ------------------------------------------------gg
A0A2R8MW85_BBC3-03      -----------agccgcccccgaggcccgcgccc----------ggacgg
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      ------------------------------------------------gg
A0A2I3RGH5_BBC3-03      ------------------------------------------------gg
H2NZD3_BBC3-01          -----------agccggccccgaggcccgcgccc----------ggacgg
A0A2I3RGH5_BBC3-01      -----------agccggccccgaggcccgcgccc----------ggacgg
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          -----------agccggccccgaggcccgcgccc----------ggacgg
Q9BXH1_BBC3-03          -----------agccggccccgaggcccgcgccc----------ggacgg
A0A0D9S2H2_BBC3-01      -----------agccggccccgaggcccacgccc----------ggacgg
A0A2K6QZT2_BBC3-01      -----------agccggccccgaggcccacgccc----------ggacgg
                                                                          

F7GL32_BBC3-02          ttccctgccctccctgggccccaggtctgcccaggagga----gggggga
F7GL32_BBC3-01          ttccctgccctccctgggccccaggtctgcccaggagga----gggggga
G3T2N1_BBC3-01          tcctcagccctcact------ctcgccggcggagcagcacctggagtcgc
G1LNV7_BBC3-01          tcctcagccctcact------ctcgccggcagagcagcacctggaatcgc
M3Y0R3_BBC3-01          tcctcagccctcact------ctcgccggcggagccgcacctggaatcgc
A0A1U7R5N5_BBC3-01      tcctcagccctcgct------gtcaccggcccagcagcacctagagtcgc
Q99ML1_BBC3-02          tcctcagccctccct------gtcaccagcccagcagcacttagagtcgc
Q80ZG6_BBC3-01          tcctcagccctcgct------gtcaccagcccagcagcacctagagtcgc
J9NTK9_BBC3-01          tcctcagccctcact------gtcgccggcggaacagcacctggaatcgc
J9NTK9_BBC3-03          tcctcagccctcact------gtcgccggcggaacagcacctggaatcgc
H0XQ00_BBC3-01          tcctcagccatcact------cttgccggccgagcagcacctggagtcgc
A0A250YBU3_BBC3-02      tcctcagccatcact------atcaccagcccagcagcacctagagtcac
A0A250YBU3_BBC3-01      tcctcagccatcact------atcaccagcccagcagcacctagagtcac
A0A3Q2GWE8_BBC3-01      tccacagccctcact------cttgccggccgagcagcacctggagtcgc
A0A3Q2GWE8_BBC3-02      tccacagccctcact------cttgccggccgagcagcacctggagtcgc
F1RM01_BBC3-04          tcctcagccctcact------ctcgccggcggagcagcacctggaatcgc
F1RM01_BBC3-02          tcctcagccctcact------ctcgccggcggagcagcacctggaatcgc
F1RM01_BBC3-03          tcctcagccctcact------ctcgccggcggagcagcacctggaatcgc
J9NTK9_BBC3-02          tcctcagccctcact------gtcgccggcggaacagcacctggaatcgc
A0A2K6KS56_BBC3-02      -------------------------ctggcggagc-gcacctggagtcg-
A0A3Q1LXZ6_BBC3-01      tcctcagccttcact------ctcgcccgcggagcagcacctggaatcac
A0A452E3G1_BBC3-01      tcctcagccttcact------ctcgcccgcggagcagcacctggaatcgc
A0A2K6FQZ1_BBC3-04      tcctcagccatcact------ctcgctggcagagcagcacctggagtcgc
A0A2K6STD6_BBC3-02      ttctcagccctcgct------ctcgctggcggagcagcacctggagtcgc
A0A2K5F6X4_BBC3-02      tcctcagccctcgct------ctcgctggcggagcagcacctggagtcgc
A0A2R8MW85_BBC3-02      tcctcagccctcgct------ctcgctggcggagcagcacctggagtcgc
A0A2K5QNS7_BBC3-02      tcctcagccctcgct------ctcgctggcggagcagcacctggagtcgc
A0A2K6FQZ1_BBC3-01      tcctcagccatcact------ctcgctggcagagcagcacctggagtcgc
A0A2K6QZT2_BBC3-04      tcctcagccctcgct------ctcgctggcggagcagcacctggagtcgc
A0A2K5P2T8_BBC3-03      tcctcagccctcgct------cttgctggcggagcagcacctggagtcgc
A0A2K5V8J3_BBC3-03      tcctcagccctcgct------cttgctggcggagcagcacctggagtcgc
A0A2K6ASP2_BBC3-03      tcctcagccctcgct------cttgctggcggagcagcacctggagtcgc
A0A2I3N2Z9_BBC3-03      tcctcagccctcgct------cttgctggcggagcagcacctggagtcgc
A0A2R8MW85_BBC3-03      tcctcagccctcgct------ctcgctggcggagcagcacctggagtcgc
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      tcctcagccctcgct------ctcgctggcggagcagcacctggagtcgc
A0A2I3RGH5_BBC3-03      tcctcagccctcgct------ctcgctggcggagcagcacctggagtcgc
H2NZD3_BBC3-01          tcctcagccctcgct------ctcgctggcggagcagcacctggagtcgc
A0A2I3RGH5_BBC3-01      tcctcagccctcgct------ctcgctggcggagcagcacctggagtcgc
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          tcctcagccctcgct------ctcgctggcggagcagcacctggagtcgc
Q9BXH1_BBC3-03          tcctcagccctcgct------ctcgctggcggagcagcacctggagtcgc
A0A0D9S2H2_BBC3-01      tcctcagccctcgct------ttcgctggcggagcagcacctggagtcgc
A0A2K6QZT2_BBC3-01      tcctcagccctcgct------ctcgctggcggagcagcacctggagtcgc
                                                                          

F7GL32_BBC3-02          caggagggagagccccagggagcgtcccccatgtctggcggccccccggg
F7GL32_BBC3-01          caggagggagagccccagggagcgtcccccatgtctggcggccccccggg
G3T2N1_BBC3-01          cggtgcc-------------------------------------cacgca
G1LNV7_BBC3-01          cggtgcccagtgccccggggg-------ccctggcgggaggccccaccca
M3Y0R3_BBC3-01          cggtgcccagtgccccggggg-------ccctggcgggcggccccaccca
A0A1U7R5N5_BBC3-01      ccgtgcccagcgccccggagg-------ccctggcgggcggccccaccca
Q99ML1_BBC3-02          ccgtgcccagcgccccggagg-------ccctggcaggaggccccaccca
Q80ZG6_BBC3-01          ccgtgcccagcgccccggagg-------ccctggcgggaggccccaccca
J9NTK9_BBC3-01          cggtgcccagcgccccggggg-------ccctggcgggcggtcccaccca
J9NTK9_BBC3-03          cggtgcccagcgccccggggg-------ccctggcgggcggtcccaccca
H0XQ00_BBC3-01          ccgttcccagcaccccggggg-------ccctggcgggcggtcccaccca
A0A250YBU3_BBC3-02      ccgtgcccagcgtcccggagg-------ccctggcgggcggccccaccca
A0A250YBU3_BBC3-01      ccgtgcccagcgtcccggagg-------ccctggcgggcggccccaccca
A0A3Q2GWE8_BBC3-01      cggtgcccagcgccccggggg-------ccctggagggcggccccaccca
A0A3Q2GWE8_BBC3-02      cggtgcccagcgccccggggg-------ccctggagggcggccccaccca
F1RM01_BBC3-04          cagtgcccagcgctccggggg-------ccctggcgggcggccccaccca
F1RM01_BBC3-02          cagtgcccagcgctccggggg-------ccctggcgggcggccccaccca
F1RM01_BBC3-03          cagtgcccagcgctccggggg-------ccctggcgggcggccccaccca
J9NTK9_BBC3-02          cggtgcccagcgccccggggg-------ccctggcgggcggtcccaccca
A0A2K6KS56_BBC3-02      cggtgcc---agccccgggg--------------------------ccct
A0A3Q1LXZ6_BBC3-01      cagtgcccagcgccccggggg-------ccctggcgggcggccccaccca
A0A452E3G1_BBC3-01      cagtgcccagcgccccggggg-------ccctggcgggcggacccaccca
A0A2K6FQZ1_BBC3-04      ccgtccccagcgccccggggg-------ccctggcgggcggtcccaccca
A0A2K6STD6_BBC3-02      ccgtgcccagcgccccggggg-------ccctggcgggcggtcccaccca
A0A2K5F6X4_BBC3-02      ccgtgcccagcgccccggggg-------ccctggcgggcggtcccaccca
A0A2R8MW85_BBC3-02      ccgtgcccagcgccccagggg-------ccctggcgggcggtcccaccca
A0A2K5QNS7_BBC3-02      ccgtgcccagcgccccggggg-------ccctggcgggcggtcccaccca
A0A2K6FQZ1_BBC3-01      ccgtccccagcgccccggggg-------ccctggcgggcggtcccaccca
A0A2K6QZT2_BBC3-04      cggtgcccagcgccccggggg-------ccctggcgggcggtcccaccca
A0A2K5P2T8_BBC3-03      ccgtgcccagcgccccggggg-------ccctggcgggcggtcccaccca
A0A2K5V8J3_BBC3-03      ccgtgcccagcgccccggggg-------ccctggcgggcggtcccaccca
A0A2K6ASP2_BBC3-03      ccgtgcccagcgccccggggg-------ccctggcgggcggtcccaccca
A0A2I3N2Z9_BBC3-03      ccgtgcccagcgccccggggg-------ccctggcgggcggtcccaccca
A0A2R8MW85_BBC3-03      ccgtgcccagcgccccagggg-------ccctggcgggcggtcccaccca
A0A2I3HWI8_BBC3-03      ---------------------------------gcaggcggtcccaccca
A0A2R9BZA9_BBC3-01      ccgtgcccagcgccccggggg-------ctctggcgggcggtcccaccca
A0A2I3RGH5_BBC3-03      ccgtgcccagcgccccggggg-------ctctggcgggcggtcccaccca
H2NZD3_BBC3-01          ccgtgcccagcgccccggggg-------ctctggcgggcggtcccaccca
A0A2I3RGH5_BBC3-01      ccgtgcccagcgccccggggg-------ctctggcgggcggtcccaccca
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          ccgtgcccagcgccccggggg-------ctctggcgggcggtcccaccca
Q9BXH1_BBC3-03          ccgtgcccagcgccccggggg-------ctctggcgggcggtcccaccca
A0A0D9S2H2_BBC3-01      ccgtgcccagcgccccggggg-------ccctggcgggcggtcccaccca
A0A2K6QZT2_BBC3-01      cggtgcccagcgccccggggg-------ccctggcgggcggtcccaccca
                                                                          

F7GL32_BBC3-02          ggtgttaggcccggagcacggggaccaaggcgagcagcaggaccgggaga
F7GL32_BBC3-01          ggtgttaggcccggagcacggggaccaaggcgagcagcaggaccgggaga
G3T2N1_BBC3-01          ggcg---gccccgggggtccggggagaggatgagcaatgggcccgagaga
G1LNV7_BBC3-01          ggca---gccccgggagtccggggggaggaggagcagtgggcccgggaga
M3Y0R3_BBC3-01          ggca---gccccgggagtccggggggaggaggagcagtgggcccgggaga
A0A1U7R5N5_BBC3-01      agca---gccccgggagtgcgcggggaggaggaggagtgggcccgggaga
Q99ML1_BBC3-02          agct---gccccgggagtgcgtgtggaggaggaggagtgggcccgggaga
Q80ZG6_BBC3-01          agct---gccccgggagtgcgtgtggaggaggaggagtgggcccgggaga
J9NTK9_BBC3-01          agca---gccccgggagtccggggggaggaggagcagtgggcccgggaga
J9NTK9_BBC3-03          agca---gccccgggagtccggggggaggaggagcagtgggcccgggaga
H0XQ00_BBC3-01          ggcg---gccccggaggtccggggggaggaggagcagtgggccagagaga
A0A250YBU3_BBC3-02      ggcg---gcccccggagtccggggggaggaggagcagtgggcccgggaga
A0A250YBU3_BBC3-01      ggcg---gcccccggagtccggggggaggaggagcagtgggcccgggaga
A0A3Q2GWE8_BBC3-01      ggca---gccccgggagtccggggggaggaggagcagtgggcccgggaga
A0A3Q2GWE8_BBC3-02      ggca---gccccgggagtccggggggaggaggagcagtgggcccgggaga
F1RM01_BBC3-04          agca---gccccgggaatccggggggaggaggagcagtgggcccgagaga
F1RM01_BBC3-02          agca---gccccgggaatccggggggaggaggagcagtgggcccgagaga
F1RM01_BBC3-03          agca---gccccgggaatccggggggaggaggagcagtgggcccgagaga
J9NTK9_BBC3-02          agca---gccccgggagtccggggggaggaggagcagtgggcccgggaga
A0A2K6KS56_BBC3-02      ggcg---gccccgggagt-cgcggggaggaggcgaagtgggcc--gggaa
A0A3Q1LXZ6_BBC3-01      agcg---gccccgggagtccggggggaggaggagcagtgggcccgagaga
A0A452E3G1_BBC3-01      agcg---gccccgggagtccggggggaggaggagcagtgggcccgagaga
A0A2K6FQZ1_BBC3-04      ggcg---gccccgggagtccggggggaggaggagcagtgggcccgagaga
A0A2K6STD6_BBC3-02      ggcg---gccccgggagtccgcggggaggaggagcagtgggctcgggaga
A0A2K5F6X4_BBC3-02      ggcg---gccccgggagtccgcggggaggaggagcagtgggcccgggaga
A0A2R8MW85_BBC3-02      ggcg---gcccccggagtccgcggggaggaggagcagtgggcccgggaga
A0A2K5QNS7_BBC3-02      ggcg---gccctgggagtccgcggggaggaggagcagtgggcccgggaga
A0A2K6FQZ1_BBC3-01      ggcg---gccccgggagtccggggggaggaggagcagtgggcccgagaga
A0A2K6QZT2_BBC3-04      ggcg---gccccgggagtccgcggggaggaggaacagtgggcccgggaga
A0A2K5P2T8_BBC3-03      ggcg---gccccgggagtccgcggggaggaggaacagtgggcccgggaga
A0A2K5V8J3_BBC3-03      ggcg---gccccgggagtccgcggggaggaggaacagtgggcccgggaga
A0A2K6ASP2_BBC3-03      ggcg---gccccgggagtccgcggggaggaggaacagtgggcccgggaga
A0A2I3N2Z9_BBC3-03      ggcg---gccccgggagtccgcggggaggaggaacagtgggcccgggaga
A0A2R8MW85_BBC3-03      ggcg---gcccccggagtccgcggggaggaggagcagtgggcccgggaga
A0A2I3HWI8_BBC3-03      ggcg---gctccgggagtccgcggggaggaggaacagtgggcccgggaga
A0A2R9BZA9_BBC3-01      ggcg---gccccgggagtccgcggggaggaggaacagtgggcccgggaga
A0A2I3RGH5_BBC3-03      ggcg---gccccgggagtccgcggggaggaggaacagtgggcccgggaga
H2NZD3_BBC3-01          ggcg---gccccgggagtccgcggggaggaggaacagtgggcccgggaga
A0A2I3RGH5_BBC3-01      ggcg---gccccgggagtccgcggggaggaggaacagtgggcccgggaga
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          ggcg---gccccgggagtccgcggggaggaggaacagtgggcccgggaga
Q9BXH1_BBC3-03          ggcg---gccccgggagtccgcggggaggaggaacagtgggcccgggaga
A0A0D9S2H2_BBC3-01      ggcg---gccccgggagtccgcggggaggaggaacagtgggcccaggaga
A0A2K6QZT2_BBC3-01      ggcg---gccccgggagtccgcggggaggaggaacagtgggcccgggaga
                                                                          

F7GL32_BBC3-02          tcggcgcccagctgcgcaggatggcc-gatgacctcaacgccctgtacga
F7GL32_BBC3-01          tcggcgcccagctgcgcaggatggcc-gatgacctcaacgccctgtacga
G3T2N1_BBC3-01          tcggggcccagtttcggcggaaggcg-gacgacctctatgcgctgtacga
G1LNV7_BBC3-01          tcggggcccagctgcggcggatggcg-gacgacctcaacgcgctgtacga
M3Y0R3_BBC3-01          tcggggcccagctgcggaggatggcg-gacgacctcaacgcgctgtacga
A0A1U7R5N5_BBC3-01      tcggggctcagctgcggcggatggcg-gacgacctcaacgcgcagtacga
Q99ML1_BBC3-02          tcggggcccagctgcggcggatggcg-gacgacctcaacgcgcagtacga
Q80ZG6_BBC3-01          tcggggcccagctgcggaggatggcg-gacgacctcaacgcgcagtacga
J9NTK9_BBC3-01          tcggggcccagctgcggcggatggcg-gacgacctcaacgcgctgtacga
J9NTK9_BBC3-03          tcggggcccagctgcggcggatggcg-gacgacctcaacgcgctgtacga
H0XQ00_BBC3-01          taggggcccagctgcggcggatggcg-gacgacctcaacgcgcagtacga
A0A250YBU3_BBC3-02      tcggggcccagctgcggcggatggcg-gacgacctcaacgcgcagtacga
A0A250YBU3_BBC3-01      tcggggcccagctgcggcggatggcg-gacgacctcaacgcgcagtacga
A0A3Q2GWE8_BBC3-01      tcggggcccagctgcggcggatggcg-gacgacctgaacgcgctgtacga
A0A3Q2GWE8_BBC3-02      tcggggcccagctgcggcggatggcg-gacgacctgaacgcgctgtacga
F1RM01_BBC3-04          tcggggcccagctgcggcggatggct-gacgatctcaacgcgctgtacga
F1RM01_BBC3-02          tcggggcccagctgcggcggatggct-gacgatctcaacgcgctgtacga
F1RM01_BBC3-03          tcggggcccagctgcggcggatggct-gacgatctcaacgcgctgtacga
J9NTK9_BBC3-02          tcggggcccagctgcggcggatggcg-gacgacctcaacgcgctgtacga
A0A2K6KS56_BBC3-02      tcggggcccagctgcggcggatggcgagacga-ctcaacgcgcagtacag
A0A3Q1LXZ6_BBC3-01      tcggggcccagctgcggcggatggcg-gacgacctcaacgcgctatacga
A0A452E3G1_BBC3-01      tcggggcccagctgcggcggatggcg-gacgacctcaacgcgctatacga
A0A2K6FQZ1_BBC3-04      tcggggcccagctgcggcggatggca-gacgacctcaatgcgcagtacga
A0A2K6STD6_BBC3-02      tcggggcccagctgcggcggatggcg-gacgacctcaacgcgcagtacga
A0A2K5F6X4_BBC3-02      tcggggcccagctgcggcggatggcg-gacgacctcaacgcgcagtacga
A0A2R8MW85_BBC3-02      tcggggcccagctgcgacggatggcg-gacgacctcaacgcgctgtacga
A0A2K5QNS7_BBC3-02      tcggggcccagctgcagcggatggcg-gacgacctcaacgcgcagtacga
A0A2K6FQZ1_BBC3-01      tcggggcccagctgcggcggatggca-gacgacctcaatgcgcagtacga
A0A2K6QZT2_BBC3-04      tcggggcccagctgcggcggatggcg-gacgacctcaacgcgcagtacga
A0A2K5P2T8_BBC3-03      tcggggcccagctgcggcggatggcg-gacgacctcaacgcgcagtacga
A0A2K5V8J3_BBC3-03      tcggggcccagctgcggcggatggcg-gacgacctcaacgcgcaatacga
A0A2K6ASP2_BBC3-03      tcggggcccagctgcggcggatggcg-gacgacctcaacgcgcaatacga
A0A2I3N2Z9_BBC3-03      tcggggcccagctgcggcggatggcg-gacgacctcaacgcgcagtacga
A0A2R8MW85_BBC3-03      tcggggcccagctgcgacggatggcg-gacgacctcaacgcgctgtacga
A0A2I3HWI8_BBC3-03      tcggggcccagctgcggcggatggcg-gacgacctcaacgcgcagtacga
A0A2R9BZA9_BBC3-01      tcggggcccagctgcggcggatggcg-gacgacctcaacgcgcagtacga
A0A2I3RGH5_BBC3-03      tcggggcccagctgcggcggatggcg-gacgacctcaacgcgcagtacga
H2NZD3_BBC3-01          tcggggcccagctgcggcggatggcg-gacgacctcaacgcgcagtacga
A0A2I3RGH5_BBC3-01      tcggggcccagctgcggcggatggcg-gacgacctcaacgcgcagtacga
Q9BXH1_BBC3-04          --------------------------------------------------
B4DQK3_BBC3-01          tcggggcccagctgcggcggatggcg-gacgacctcaacgcacagtacga
Q9BXH1_BBC3-03          tcggggcccagctgcggcggatggcg-gacgacctcaacgcacagtacga
A0A0D9S2H2_BBC3-01      tcggggcccagctgcggcggatggcg-gacgacctcaacgcgcagtacga
A0A2K6QZT2_BBC3-01      tcggggcccagctgcggcggatggcg-gacgacctcaacgcgcagtacga
                                                                          

F7GL32_BBC3-02          gcagcgg--------------------agacg------------------
F7GL32_BBC3-01          gcagcgg--------------------agacg------------------
G3T2N1_BBC3-01          gcggtcggtg-----------------agaca------------------
G1LNV7_BBC3-01          gcggcgg--------------------agaca------------------
M3Y0R3_BBC3-01          gcggcgg--------------------agaca------------------
A0A1U7R5N5_BBC3-01      gcggcgg--------------------agaca------------------
Q99ML1_BBC3-02          gcggcgg--------------------agaca------------------
Q80ZG6_BBC3-01          gcggcgg--------------------agaca------------------
J9NTK9_BBC3-01          gcggcgggtgagtgttgggggaggggtagacggcaggtgggacttcccgc
J9NTK9_BBC3-03          gcggcgggtgagtgttgggggaggggtagacggcaggtgggacttcccgc
H0XQ00_BBC3-01          gcggcgg--------------------agaca------------------
A0A250YBU3_BBC3-02      gcggcgg--------------------agaca------------------
A0A250YBU3_BBC3-01      gcggcgg--------------------agaca------------------
A0A3Q2GWE8_BBC3-01      gcggcgg--------------------agaca------------------
A0A3Q2GWE8_BBC3-02      gcggcgg--------------------agaca------------------
F1RM01_BBC3-04          gcggcgggtgagtgctgggggaggggtagacggcaggtgggacttcccg-
F1RM01_BBC3-02          gcggcgg--------------------agaca------------------
F1RM01_BBC3-03          gcggcgg--------------------agaca------------------
J9NTK9_BBC3-02          gcggcgg--------------------agaca------------------
A0A2K6KS56_BBC3-02      acggcgg--------------------agaca------------------
A0A3Q1LXZ6_BBC3-01      gcggcgg--------------------agaca------------------
A0A452E3G1_BBC3-01      gcggcgg--------------------agaca------------------
A0A2K6FQZ1_BBC3-04      gcggcgg--------------------agaca------------------
A0A2K6STD6_BBC3-02      gcggcgg--------------------agaca------------------
A0A2K5F6X4_BBC3-02      gcggcgg--------------------agaca------------------
A0A2R8MW85_BBC3-02      gcggcgg--------------------agaca------------------
A0A2K5QNS7_BBC3-02      gcggcgg--------------------agaca------------------
A0A2K6FQZ1_BBC3-01      gcggcgg--------------------agaca------------------
A0A2K6QZT2_BBC3-04      gcggcgg--------------------agaca------------------
A0A2K5P2T8_BBC3-03      gcggcgg--------------------agaca------------------
A0A2K5V8J3_BBC3-03      gcggcgg--------------------agaca------------------
A0A2K6ASP2_BBC3-03      gcggcgg--------------------agaca------------------
A0A2I3N2Z9_BBC3-03      gcggcgg--------------------agaca------------------
A0A2R8MW85_BBC3-03      gcggcgg--------------------agaca------------------
A0A2I3HWI8_BBC3-03      gcggcgg--------------------agaca------------------
A0A2R9BZA9_BBC3-01      gcggcgg--------------------agaca------------------
A0A2I3RGH5_BBC3-03      gcggcgg--------------------agaca------------------
H2NZD3_BBC3-01          gcggcgg--------------------agaca------------------
A0A2I3RGH5_BBC3-01      gcggcgg--------------------agaca------------------
Q9BXH1_BBC3-04          ------g--------------------agaca------------------
B4DQK3_BBC3-01          gcggcgg--------------------agaca------------------
Q9BXH1_BBC3-03          gcggcgg--------------------agaca------------------
A0A0D9S2H2_BBC3-01      gcggcgg--------------------agaca------------------
A0A2K6QZT2_BBC3-01      gcggcgg--------------------agaca------------------
                              *                    ****                   

F7GL32_BBC3-02          ----------------------------ggaggaggagcagaggcgccac
F7GL32_BBC3-01          ----------------------------ggaggaggagcagaggcgccac
G3T2N1_BBC3-01          ----------------------------ggaggagcagcaccggcaccgt
G1LNV7_BBC3-01          ----------------------------agaggagcggcagcgacaccgc
M3Y0R3_BBC3-01          ----------------------------agaagagcagcagcgacaccgc
A0A1U7R5N5_BBC3-01      ----------------------------agaagagcaacatcgacaccgc
Q99ML1_BBC3-02          ----------------------------agaagagcagcatcgacaccga
Q80ZG6_BBC3-01          ----------------------------agaagagcaacatcgacaccga
J9NTK9_BBC3-01          ccgggagggggctgcgggcggccccgccagatgtgcggcagc--tgctgc
J9NTK9_BBC3-03          ccgggagggggctgcgggcggccccgccagatgtgcggcagc--tgctgc
H0XQ00_BBC3-01          ----------------------------agaggagcagcagcgacaccgc
A0A250YBU3_BBC3-02      ----------------------------agaagagcaacagcaacaccgc
A0A250YBU3_BBC3-01      ----------------------------agaagagcaacagcaacaccgc
A0A3Q2GWE8_BBC3-01      ----------------------------agaggagcagcagcgacaccgc
A0A3Q2GWE8_BBC3-02      ----------------------------agaggagcagcagcgacaccgc
F1RM01_BBC3-04          cggggagggggttgggggcgacccagccagatgtgcggcagc--tgctgc
F1RM01_BBC3-02          ----------------------------agaggagcagcagcgacaccgc
F1RM01_BBC3-03          ----------------------------agaggagcagcagcgacaccgc
J9NTK9_BBC3-02          ----------------------------agaggagcagcagcgacaccgc
A0A2K6KS56_BBC3-02      ----------------------------agaggagcagcagcgacaccgc
A0A3Q1LXZ6_BBC3-01      ----------------------------agaggagcggcagcgacaccgc
A0A452E3G1_BBC3-01      ----------------------------agaggagcggcaacgacaccgc
A0A2K6FQZ1_BBC3-04      ----------------------------agaggagcagcagagacaccgc
A0A2K6STD6_BBC3-02      ----------------------------agaagagcagccgcaacaccgc
A0A2K5F6X4_BBC3-02      ----------------------------agaggagcagccgcagcaccgc
A0A2R8MW85_BBC3-02      ----------------------------agaggagcagccgcagcaccgc
A0A2K5QNS7_BBC3-02      ----------------------------agaggagcagccgcagcaccgc
A0A2K6FQZ1_BBC3-01      ----------------------------agaggagcagcagagacaccgc
A0A2K6QZT2_BBC3-04      ----------------------------agaggagcagcagcgacaccgc
A0A2K5P2T8_BBC3-03      ----------------------------agaggagcagcagcgacaccgc
A0A2K5V8J3_BBC3-03      ----------------------------agaggagcagcagcgacaccgc
A0A2K6ASP2_BBC3-03      ----------------------------agaggagcagcagcgacaccgc
A0A2I3N2Z9_BBC3-03      ----------------------------agaggagcagcagcgacaccgc
A0A2R8MW85_BBC3-03      ----------------------------agaggagcagccgcagcaccgc
A0A2I3HWI8_BBC3-03      ----------------------------agaggagcaacagcggcaccgc
A0A2R9BZA9_BBC3-01      ----------------------------agaggagcagcagcggcaccgc
A0A2I3RGH5_BBC3-03      ----------------------------agaggagcagcagcggcaccgc
H2NZD3_BBC3-01          ----------------------------agaggagcagcagcggcaccgc
A0A2I3RGH5_BBC3-01      ----------------------------agaggagcagcagcggcaccgc
Q9BXH1_BBC3-04          ----------------------------agaggagcagcagcggcaccgc
B4DQK3_BBC3-01          ----------------------------agaggagcagcagcggcaccgc
Q9BXH1_BBC3-03          ----------------------------agaggagcagcagcggcaccgc
A0A0D9S2H2_BBC3-01      ----------------------------agaggagcagcagcgacaccgc
A0A2K6QZT2_BBC3-01      ----------------------------agaggagcagcagcgacaccgc
                                                     ** * *   *       *   

F7GL32_BBC3-02          ctg-----------tcgccctggagg------------------ctgctg
F7GL32_BBC3-01          ctg-----------tcgccctggagg------------------ctgctg
G3T2N1_BBC3-01          ccc-----------tcgccctggagg------------------gtcctg
G1LNV7_BBC3-01          ccc-----------tcaccctggagg------------------gtcctg
M3Y0R3_BBC3-01          ccc-----------tccccctggagg------------------gtcctg
A0A1U7R5N5_BBC3-01      ccg-----------tcgccctggagg------------------gtcatg
Q99ML1_BBC3-02          ccc-----------tcaccctggagg------------------gtcatg
Q80ZG6_BBC3-01          ccc-----------tcgccctggagg------------------gtcatg
J9NTK9_BBC3-01          ccggcgcggcggggtcgcgctggggacaggcaggtgggatgggcgacggg
J9NTK9_BBC3-03          ccggcgcggcggggtcgcgctggggacaggcaggtgggatgggcgacggg
H0XQ00_BBC3-01          ccc-----------tcaccctggaga------------------gtcctg
A0A250YBU3_BBC3-02      ccc-----------tcgccctggagg------------------gtgctg
A0A250YBU3_BBC3-01      ccc-----------tcgccctggagg------------------gtgctg
A0A3Q2GWE8_BBC3-01      ccc-----------tcgccctggagg------------------gtcctg
A0A3Q2GWE8_BBC3-02      ccc-----------tcgccctggagg------------------gtcctg
F1RM01_BBC3-04          cctgcgcggcggggtcgcgctggggacaggcaggtgggaggggcggcctg
F1RM01_BBC3-02          ccc-----------tcgccctggagg------------------gttctg
F1RM01_BBC3-03          ccc-----------tcgccctggagg------------------gttctg
J9NTK9_BBC3-02          ccc-----------tcaccctggagg------------------gtcctg
A0A2K6KS56_BBC3-02      ccc-----------tcgccctggagg------------------gtcctg
A0A3Q1LXZ6_BBC3-01      ccc-----------tcaccctggagg------------------gtcctg
A0A452E3G1_BBC3-01      ccc-----------tcgccctggagg------------------gtcctg
A0A2K6FQZ1_BBC3-04      ccc-----------tcaccctggagg------------------gtcctg
A0A2K6STD6_BBC3-02      ccc-----------tcaccctggagg------------------gtcctg
A0A2K5F6X4_BBC3-02      ccc-----------tcaccctggagg------------------gtcctg
A0A2R8MW85_BBC3-02      ccc-----------tcgccctggagg------------------gtcctg
A0A2K5QNS7_BBC3-02      ccc-----------tcgccctggagg------------------gtcctg
A0A2K6FQZ1_BBC3-01      ccc-----------tcaccctggagg------------------gtcctg
A0A2K6QZT2_BBC3-04      ccc-----------tcgccctggagg------------------gtcctg
A0A2K5P2T8_BBC3-03      ccc-----------tcgccctggagg------------------gtcctg
A0A2K5V8J3_BBC3-03      ccc-----------tcgccctggagg------------------gtcctg
A0A2K6ASP2_BBC3-03      ccc-----------tcgccctggagg------------------gtcctg
A0A2I3N2Z9_BBC3-03      ccc-----------tcgccctggagg------------------gtcctg
A0A2R8MW85_BBC3-03      ccc-----------tcgccctggagg------------------gtcctg
A0A2I3HWI8_BBC3-03      ccc-----------tcgccctggagg------------------gtcctg
A0A2R9BZA9_BBC3-01      ccc-----------tcgccctggagg------------------gtcctg
A0A2I3RGH5_BBC3-03      ccc-----------tcgccctggagg------------------gtcctg
H2NZD3_BBC3-01          ccc-----------tcgccctggagg------------------gtcctg
A0A2I3RGH5_BBC3-01      ccc-----------tcgccctggagg------------------gtcctg
Q9BXH1_BBC3-04          ccc-----------tcaccctggagg------------------gtcctg
B4DQK3_BBC3-01          ccc-----------tcaccctggagg------------------gtcctg
Q9BXH1_BBC3-03          ccc-----------tcaccctggagg------------------gtcctg
A0A0D9S2H2_BBC3-01      ccc-----------tcgccctggagg------------------gtcctg
A0A2K6QZT2_BBC3-01      ccc-----------tcgccctggagg------------------gtcctg
                        *             ** * **** *                        *

F7GL32_BBC3-02          t------------------------------------acaatctcatctc
F7GL32_BBC3-01          t------------------------------------acaatctcatctc
G3T2N1_BBC3-01          t------------------------------------acaatctcatcat
G1LNV7_BBC3-01          t------------------------------------acaatctcatcat
M3Y0R3_BBC3-01          t------------------------------------acaatctcatcat
A0A1U7R5N5_BBC3-01      t------------------------------------acaatctcttcat
Q99ML1_BBC3-02          t------------------------------------acaatctcttcat
Q80ZG6_BBC3-01          t------------------------------------ataatctcttcat
J9NTK9_BBC3-01          cccacggacctgccgaagggcccgcgccgcggctggcacgacccgggcaa
J9NTK9_BBC3-03          cccacggacctgccgaagggcccgcgccgcggctggcacgacccgggcaa
H0XQ00_BBC3-01          t------------------------------------acaatctcatcat
A0A250YBU3_BBC3-02      t------------------------------------acaatgtcatcat
A0A250YBU3_BBC3-01      t------------------------------------acaatgtcatcat
A0A3Q2GWE8_BBC3-01      t------------------------------------acaatctcatcat
A0A3Q2GWE8_BBC3-02      t------------------------------------acaatctcatcat
F1RM01_BBC3-04          tccgcggagccaccgtaaggcccgcgctgcggctggcaccaccgggtcga
F1RM01_BBC3-02          t------------------------------------acaatctcatcat
F1RM01_BBC3-03          t------------------------------------acaatctcatcat
J9NTK9_BBC3-02          t------------------------------------acaatctcatcat
A0A2K6KS56_BBC3-02      t------------------------------------acaatctcattat
A0A3Q1LXZ6_BBC3-01      t------------------------------------acaatctcatcat
A0A452E3G1_BBC3-01      t------------------------------------acaatctcatctt
A0A2K6FQZ1_BBC3-04      t------------------------------------acaatctcatcat
A0A2K6STD6_BBC3-02      t------------------------------------acaatctcatcat
A0A2K5F6X4_BBC3-02      t------------------------------------acaatctcatcat
A0A2R8MW85_BBC3-02      t------------------------------------acaatctcatcat
A0A2K5QNS7_BBC3-02      t------------------------------------acaatctcatcat
A0A2K6FQZ1_BBC3-01      t------------------------------------acaatctcatcat
A0A2K6QZT2_BBC3-04      t------------------------------------acaatctcattat
A0A2K5P2T8_BBC3-03      t------------------------------------acaatctcatcat
A0A2K5V8J3_BBC3-03      t------------------------------------acaatctcatcat
A0A2K6ASP2_BBC3-03      t------------------------------------acaatctcatcat
A0A2I3N2Z9_BBC3-03      t------------------------------------acaatctcatcat
A0A2R8MW85_BBC3-03      t------------------------------------acaatctcatcat
A0A2I3HWI8_BBC3-03      t------------------------------------acaatctcatcat
A0A2R9BZA9_BBC3-01      t------------------------------------acaatctcatcat
A0A2I3RGH5_BBC3-03      t------------------------------------acaatctcatcat
H2NZD3_BBC3-01          t------------------------------------acaatctcatcat
A0A2I3RGH5_BBC3-01      t------------------------------------acaatctcatcat
Q9BXH1_BBC3-04          t------------------------------------acaatctcatcat
B4DQK3_BBC3-01          t------------------------------------acaatctcatcat
Q9BXH1_BBC3-03          t------------------------------------acaatctcatcat
A0A0D9S2H2_BBC3-01      t------------------------------------acaatctcatcat
A0A2K6QZT2_BBC3-01      t------------------------------------acaatctcattat
                                                             *  *         

F7GL32_BBC3-02          ggggc---------------------------tcctggccccccagcgaa
F7GL32_BBC3-01          ggggc---------------------------tcctggccccccagcgaa
G3T2N1_BBC3-01          gggac---------------------------tactg--cccttaccaag
G1LNV7_BBC3-01          gggac---------------------------tcctg--ccattacccag
M3Y0R3_BBC3-01          gggac---------------------------tcctg--cccttacccag
A0A1U7R5N5_BBC3-01      gggac---------------------------tcctc--cccttacccag
Q99ML1_BBC3-02          gggac---------------------------tcctc--cccttacccag
Q80ZG6_BBC3-01          gggac---------------------------tcctc--cccttacccag
J9NTK9_BBC3-01          gggcc------gggaccgcctcgagcgccgcggcgcg--tccgtggccct
J9NTK9_BBC3-03          gggcc------gggaccgcctcgagcgccgcggcgcg--tccgtggccct
H0XQ00_BBC3-01          gggac---------------------------tcctg--cccttacccag
A0A250YBU3_BBC3-02      gggac---------------------------tcctg--cccttacccag
A0A250YBU3_BBC3-01      gggac---------------------------tcctg--cccttacccag
A0A3Q2GWE8_BBC3-01      gggac---------------------------tcctg--cccctacccag
A0A3Q2GWE8_BBC3-02      gggac---------------------------tcctg--cccctacccag
F1RM01_BBC3-04          gggccagggccggggcagcctcgagcgttacggtgtg--cccgcggccgg
F1RM01_BBC3-02          gggac---------------------------ttctg--cccttacccag
F1RM01_BBC3-03          gggac---------------------------ttctg--cccttacccag
J9NTK9_BBC3-02          gggac---------------------------tcctg--cccttacccag
A0A2K6KS56_BBC3-02      gggac---------------------------tcctg--cccttacccag
A0A3Q1LXZ6_BBC3-01      gggac---------------------------tcctg--ccctttcccgg
A0A452E3G1_BBC3-01      gggac---------------------------tcctg--cccttccccgg
A0A2K6FQZ1_BBC3-04      gggac---------------------------tcctg--cccttacccag
A0A2K6STD6_BBC3-02      gggac---------------------------tcctg--ccctttcccag
A0A2K5F6X4_BBC3-02      gggac---------------------------tcctg--ccctttcccag
A0A2R8MW85_BBC3-02      gggac---------------------------tcctg--ccctttcccag
A0A2K5QNS7_BBC3-02      gggac---------------------------tcctg--ccctttcccag
A0A2K6FQZ1_BBC3-01      gggac---------------------------tcctg--cccttacccag
A0A2K6QZT2_BBC3-04      gggac---------------------------tcctg--cccttacccag
A0A2K5P2T8_BBC3-03      gggac---------------------------tcctg--cccttacccag
A0A2K5V8J3_BBC3-03      gggac---------------------------tcctg--cccttacccag
A0A2K6ASP2_BBC3-03      gggac---------------------------tcctg--cccttacccag
A0A2I3N2Z9_BBC3-03      gggac---------------------------tcctg--cccttacccag
A0A2R8MW85_BBC3-03      gggac---------------------------tcctg--ccctttcccag
A0A2I3HWI8_BBC3-03      gggac---------------------------tcctg--cccttacccag
A0A2R9BZA9_BBC3-01      gggac---------------------------tcctg--cccttacccag
A0A2I3RGH5_BBC3-03      gggac---------------------------tcctg--cccttacccag
H2NZD3_BBC3-01          gggac---------------------------tcctg--cccttacccag
A0A2I3RGH5_BBC3-01      gggac---------------------------tcctg--cccttacccag
Q9BXH1_BBC3-04          gggac---------------------------tcctg--cccttacccag
B4DQK3_BBC3-01          gggac---------------------------tcctg--cccttacccag
Q9BXH1_BBC3-03          gggac---------------------------tcctg--cccttacccag
A0A0D9S2H2_BBC3-01      gggac---------------------------tcctg--cccttacccag
A0A2K6QZT2_BBC3-01      gggac---------------------------tcctg--cccttacccag
                        *** *                                   *     *   

F7GL32_BBC3-02          ggaacc-------ggatgccggacg--------tggagc-----------
F7GL32_BBC3-01          ggaacc-------ggatgccggacg--------tggagc-----------
G3T2N1_BBC3-01          ggacca-----tggcgcccccgaga--------tggagc-----------
G1LNV7_BBC3-01          gggccg-----cggagccccggaga--------tggagc-----------
M3Y0R3_BBC3-01          gggccg-----tggagccccagaga--------tggagc-----------
A0A1U7R5N5_BBC3-01      ggatcc-----tggagccccagaaa--------tggagc-----------
Q99ML1_BBC3-02          ggatcc-----tggagccccagaaa--------tggagc-----------
Q80ZG6_BBC3-01          ggatcc-----tggagccccagaaa--------tggagc-----------
J9NTK9_BBC3-01          cggccg-----cggggactga-----------------------------
J9NTK9_BBC3-03          cggccg-----cggggactgaggg---------cggcgctcggcggagca
H0XQ00_BBC3-01          gggcca-----cagagcccctgaga--------tggagc-----------
A0A250YBU3_BBC3-02      gggccc-----gggagccccggaga--------tggagc-----------
A0A250YBU3_BBC3-01      gggccc-----gggagccccggaga--------tggagc-----------
A0A3Q2GWE8_BBC3-01      gggccg-----agcggccccggaga--------tggagc-----------
A0A3Q2GWE8_BBC3-02      gggccg-----agcggccccggaga--------tggagc-----------
F1RM01_BBC3-04          cggccggcggccggcggccgcgagaactgagggcggcgctcagccgagcg
F1RM01_BBC3-02          gggccg-----tggagcccccgaga--------tggagc-----------
F1RM01_BBC3-03          gggccg-----tggagcccccgaga--------tggagc-----------
J9NTK9_BBC3-02          gggccg-----tggagccccggaga--------tggagc-----------
A0A2K6KS56_BBC3-02      gggcca-----cagagcccccgaaa--------tggagc-----------
A0A3Q1LXZ6_BBC3-01      gggccg-----cggagcccccgagg--------tggagc-----------
A0A452E3G1_BBC3-01      gggccg-----cggagcccccgagg--------tggagc-----------
A0A2K6FQZ1_BBC3-04      gggcca-----cagagcccctgaga--------tggagc-----------
A0A2K6STD6_BBC3-02      gggcca-----cagagccccagaga--------tggagc-----------
A0A2K5F6X4_BBC3-02      gggcca-----cagagcccccgaga--------tggagc-----------
A0A2R8MW85_BBC3-02      gggcca-----cagagccccggaga--------tggagc-----------
A0A2K5QNS7_BBC3-02      gggcca-----cagagcccccgaga--------tggagc-----------
A0A2K6FQZ1_BBC3-01      gggcca-----cagagcccctgaga--------tggagc-----------
A0A2K6QZT2_BBC3-04      gggcca-----cagagcccccgaaa--------tggagc-----------
A0A2K5P2T8_BBC3-03      gggcca-----cagagcccccgaaa--------tggagc-----------
A0A2K5V8J3_BBC3-03      gggcca-----cagagcccccgaaa--------tggagc-----------
A0A2K6ASP2_BBC3-03      gggcca-----cagagcccccgaaa--------tggagc-----------
A0A2I3N2Z9_BBC3-03      gggcca-----cagagcccccgaaa--------tggagc-----------
A0A2R8MW85_BBC3-03      gggcca-----cagagccccggaga--------tggagc-----------
A0A2I3HWI8_BBC3-03      gggcca-----cagagcccccgaga--------tggagc-----------
A0A2R9BZA9_BBC3-01      gggcca-----cagagcccccgaga--------tggagc-----------
A0A2I3RGH5_BBC3-03      gggcca-----cagagcccccgaga--------tggagc-----------
H2NZD3_BBC3-01          gggcca-----cagagcccccgaga--------tggagc-----------
A0A2I3RGH5_BBC3-01      gggcca-----cagagcccccgaga--------tggagc-----------
Q9BXH1_BBC3-04          gggcca-----cagagcccccgaga--------tggagc-----------
B4DQK3_BBC3-01          gggcca-----cagagcccccgaga--------tggagc-----------
Q9BXH1_BBC3-03          gggcca-----cagagcccccgaga--------tggagc-----------
A0A0D9S2H2_BBC3-01      gggcca-----cagagcccccgaaa--------tggagc-----------
A0A2K6QZT2_BBC3-01      gggcca-----cagagcccccgaaa--------tggagc-----------
                         *  *                                             

F7GL32_BBC3-02          ----------------ccaactag--------------------------
F7GL32_BBC3-01          ----------------ccaactag--------------------------
G3T2N1_BBC3-01          ----------------ccaattag--------------------------
G1LNV7_BBC3-01          ----------------ccaat-----------------------------
M3Y0R3_BBC3-01          ----------------ccaattag--------------------------
A0A1U7R5N5_BBC3-01      ----------------ccaactag--------------------------
Q99ML1_BBC3-02          ----------------ccaactag--------------------------
Q80ZG6_BBC3-01          ----------------ccaactag--------------------------
J9NTK9_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-03          gctcatatatcccgggctatttat--------------------------
H0XQ00_BBC3-01          ----------------ccaattag--------------------------
A0A250YBU3_BBC3-02      ----------------ccaattag--------------------------
A0A250YBU3_BBC3-01      ----------------ccaattag--------------------------
A0A3Q2GWE8_BBC3-01      ----------------ccaactaggtgcctgcacccgcccgggggacgtc
A0A3Q2GWE8_BBC3-02      ----------------ccaactag--------------------------
F1RM01_BBC3-04          gctcatatatcccaggctatttat--------------------------
F1RM01_BBC3-02          ----------------ctaattag--------------------------
F1RM01_BBC3-03          ----------------ctaattag--------------------------
J9NTK9_BBC3-02          ----------------ccaattaggtgcctgcacccgcccggtggacatc
A0A2K6KS56_BBC3-02      ----------------ccaattag--------------------------
A0A3Q1LXZ6_BBC3-01      ----------------ccaattag--------------------------
A0A452E3G1_BBC3-01      ----------------ccaattag--------------------------
A0A2K6FQZ1_BBC3-04      ----------------ccaattag--------------------------
A0A2K6STD6_BBC3-02      ----------------ccaattag--------------------------
A0A2K5F6X4_BBC3-02      ----------------ccaattag--------------------------
A0A2R8MW85_BBC3-02      ----------------ccaattag--------------------------
A0A2K5QNS7_BBC3-02      ----------------ccaattag--------------------------
A0A2K6FQZ1_BBC3-01      ----------------ccaattag--------------------------
A0A2K6QZT2_BBC3-04      ----------------ccaattag--------------------------
A0A2K5P2T8_BBC3-03      ----------------ccaattag--------------------------
A0A2K5V8J3_BBC3-03      ----------------ccaattag--------------------------
A0A2K6ASP2_BBC3-03      ----------------ccaattag--------------------------
A0A2I3N2Z9_BBC3-03      ----------------ccaattag--------------------------
A0A2R8MW85_BBC3-03      ----------------ccaattag--------------------------
A0A2I3HWI8_BBC3-03      ----------------ccaattag--------------------------
A0A2R9BZA9_BBC3-01      ----------------ccaattag--------------------------
A0A2I3RGH5_BBC3-03      ----------------ccaattag--------------------------
H2NZD3_BBC3-01          ----------------ccaattag--------------------------
A0A2I3RGH5_BBC3-01      ----------------ccaattag--------------------------
Q9BXH1_BBC3-04          ----------------ccaattaggtgcctgcacccgcccggtggacgtc
B4DQK3_BBC3-01          ----------------ccaattag--------------------------
Q9BXH1_BBC3-03          ----------------ccaattaggtgcctgcacccgcccggtggacgtc
A0A0D9S2H2_BBC3-01      ----------------ccaattag--------------------------
A0A2K6QZT2_BBC3-01      ----------------ccaattag--------------------------
                                                                          

F7GL32_BBC3-02          --------------------------------------------------
F7GL32_BBC3-01          --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
G1LNV7_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-03          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      ggggacttggggggcaggaccctcccacctcctgacgccctggccagcgc
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
F1RM01_BBC3-04          --------------------------------------------------
F1RM01_BBC3-02          --------------------------------------------------
F1RM01_BBC3-03          --------------------------------------------------
J9NTK9_BBC3-02          agggacttggggggcaggaccctcccacctcctgatgccctggccagcgc
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          agggactcggggggcaggcccctcccacctcctgacaccctggccagcgc
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-03          agggactcggggggcaggcccctcccacctcctgacaccctggccagcgc
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
                                                                          

F7GL32_BBC3-02          -------------------------
F7GL32_BBC3-01          -------------------------
G3T2N1_BBC3-01          -------------------------
G1LNV7_BBC3-01          -------------------------
M3Y0R3_BBC3-01          -------------------------
A0A1U7R5N5_BBC3-01      -------------------------
Q99ML1_BBC3-02          -------------------------
Q80ZG6_BBC3-01          -------------------------
J9NTK9_BBC3-01          -------------------------
J9NTK9_BBC3-03          ----------------agccggtga
H0XQ00_BBC3-01          -------------------------
A0A250YBU3_BBC3-02      -------------------------
A0A250YBU3_BBC3-01      -------------------------
A0A3Q2GWE8_BBC3-01      ggggggctctttctgcaccatgtag
A0A3Q2GWE8_BBC3-02      -------------------------
F1RM01_BBC3-04          ----------------agccggtga
F1RM01_BBC3-02          -------------------------
F1RM01_BBC3-03          -------------------------
J9NTK9_BBC3-02          gggggactttttctgcaccatgtag
A0A2K6KS56_BBC3-02      -------------------------
A0A3Q1LXZ6_BBC3-01      -------------------------
A0A452E3G1_BBC3-01      -------------------------
A0A2K6FQZ1_BBC3-04      -------------------------
A0A2K6STD6_BBC3-02      -------------------------
A0A2K5F6X4_BBC3-02      -------------------------
A0A2R8MW85_BBC3-02      -------------------------
A0A2K5QNS7_BBC3-02      -------------------------
A0A2K6FQZ1_BBC3-01      -------------------------
A0A2K6QZT2_BBC3-04      -------------------------
A0A2K5P2T8_BBC3-03      -------------------------
A0A2K5V8J3_BBC3-03      -------------------------
A0A2K6ASP2_BBC3-03      -------------------------
A0A2I3N2Z9_BBC3-03      -------------------------
A0A2R8MW85_BBC3-03      -------------------------
A0A2I3HWI8_BBC3-03      -------------------------
A0A2R9BZA9_BBC3-01      -------------------------
A0A2I3RGH5_BBC3-03      -------------------------
H2NZD3_BBC3-01          -------------------------
A0A2I3RGH5_BBC3-01      -------------------------
Q9BXH1_BBC3-04          gggggactttctctgcaccatgtag
B4DQK3_BBC3-01          -------------------------
Q9BXH1_BBC3-03          gggggactttctctgcaccatgtag
A0A0D9S2H2_BBC3-01      -------------------------
A0A2K6QZT2_BBC3-01      -------------------------
                                                 

© 1998-2020Legal notice