Dataset for CDS BBC3 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

82 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4X2LVY2_BBC3-01      --------------------------------------------------
A0A4X2LVY2_BBC3-02      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
F7GL32_BBC3-01          atgggtgtgcggccccgcggcgccccctggcgcccggagccggcgggggg
F7GL32_BBC3-02          --------------------------------------------------
A0A5F9DGT6_BBC3-01      --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
B2RVL4_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-03          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A673UKJ9_BBC3-02      --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      --------------------------------------------------
A0A671F3X5_BBC3-02      --------------------------------------------------
A0A673UKJ9_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A2Y9PEE3_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      ------------------------------------------atgaccgt
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      ---------------------------------------------atggc
A0A480SCP6_BBC3-03      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A5F5PGZ4_BBC3-01      --------------------------------------------------
A0A5F5PGZ4_BBC3-02      --------------------------------------------------
A0A337SJI7_BBC3-01      --------------------------------------------------
A0A667IM83_BBC3-01      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6KS56_BBC3-01      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
H2NZD3_BBC3-02          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K5V8L0_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
                                                                          

A0A4X2LVY2_BBC3-01      --------------------------------------------------
A0A4X2LVY2_BBC3-02      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
F7GL32_BBC3-01          cggcggggctgggggccgggcgaggggcacggccgggcgggcgcgtgcca
F7GL32_BBC3-02          --------------------------------------------------
A0A5F9DGT6_BBC3-01      --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
B2RVL4_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-03          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A673UKJ9_BBC3-02      --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      --------------------------------------------------
A0A671F3X5_BBC3-02      --------------------------------------------------
A0A673UKJ9_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A2Y9PEE3_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      gtttgtgggaggttgtgctggccagccagtgccttgggtcagccccccca
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      ttctggagcgtgtcccatcagtgggccagtgagcaggaacc---------
A0A480SCP6_BBC3-03      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A5F5PGZ4_BBC3-01      --------------------------------------------------
A0A5F5PGZ4_BBC3-02      --------------------------------------------------
A0A337SJI7_BBC3-01      --------------------------------------------------
A0A667IM83_BBC3-01      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6KS56_BBC3-01      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
H2NZD3_BBC3-02          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K5V8L0_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
                                                                          

A0A4X2LVY2_BBC3-01      --------------------------------------------------
A0A4X2LVY2_BBC3-02      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
F7GL32_BBC3-01          ctgggcgtgttgttttccaggggctcggcgtgggcctccgcagtggtgag
F7GL32_BBC3-02          --------------------------------------------------
A0A5F9DGT6_BBC3-01      --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
B2RVL4_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-03          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A673UKJ9_BBC3-02      --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      --------------------------------------------------
A0A671F3X5_BBC3-02      --------------------------------------------------
A0A673UKJ9_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A2Y9PEE3_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      ccatggggggggcgtgtctcttggggccttctcacctgcctcccctccat
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A5F5PGZ4_BBC3-01      --------------------------------------------------
A0A5F5PGZ4_BBC3-02      --------------------------------------------------
A0A337SJI7_BBC3-01      --------------------------------------------------
A0A667IM83_BBC3-01      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6KS56_BBC3-01      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
H2NZD3_BBC3-02          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K5V8L0_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
                                                                          

A0A4X2LVY2_BBC3-01      --------------------------------------------------
A0A4X2LVY2_BBC3-02      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
F7GL32_BBC3-01          tgtgcgccgcggctgggggtgcgcgtgccgtgccgtgagcgggggccgct
F7GL32_BBC3-02          --------------------------------------------------
A0A5F9DGT6_BBC3-01      --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
B2RVL4_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-03          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A673UKJ9_BBC3-02      --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      --------------------------------------------------
A0A671F3X5_BBC3-02      --------------------------------------------------
A0A673UKJ9_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A2Y9PEE3_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      ctgggccttgtgtgtgttgtgggtgccagccctgggcttccctgcctgcc
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A5F5PGZ4_BBC3-01      --------------------------------------------------
A0A5F5PGZ4_BBC3-02      --------------------------------------------------
A0A337SJI7_BBC3-01      --------------------------------------------------
A0A667IM83_BBC3-01      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6KS56_BBC3-01      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
H2NZD3_BBC3-02          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K5V8L0_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
                                                                          

A0A4X2LVY2_BBC3-01      --------------------------------------------------
A0A4X2LVY2_BBC3-02      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
F7GL32_BBC3-01          gtcaccgcgctgctgctgccgctgtgagtgcggggccggactggggaaac
F7GL32_BBC3-02          --------------------------------------------------
A0A5F9DGT6_BBC3-01      --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
B2RVL4_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-03          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A673UKJ9_BBC3-02      --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      --------------------------------------------------
A0A671F3X5_BBC3-02      --------------------------------------------------
A0A673UKJ9_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A2Y9PEE3_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      acgtgtcctcatgcctgggttcaagagtggggtgccctgtgtaccccagg
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A5F5PGZ4_BBC3-01      --------------------------------------------------
A0A5F5PGZ4_BBC3-02      --------------------------------------------------
A0A337SJI7_BBC3-01      --------------------------------------------------
A0A667IM83_BBC3-01      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6KS56_BBC3-01      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
H2NZD3_BBC3-02          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K5V8L0_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
                                                                          

A0A4X2LVY2_BBC3-01      --------------atggtgctggagggggcagcggcggagcccgctctg
A0A4X2LVY2_BBC3-02      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
F7GL32_BBC3-01          tgaggcggggccgggcccgaggggtggcaccgccgctcacctgctccgcc
F7GL32_BBC3-02          --------------------------------------------------
A0A5F9DGT6_BBC3-01      --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
B2RVL4_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-03          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A673UKJ9_BBC3-02      --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      --------------------------------------------------
A0A671F3X5_BBC3-02      --------------------------------------------------
A0A673UKJ9_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A2Y9PEE3_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      gaggggggtgccctgggggccggcctgatgccccctgcacttctcagctg
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A5F5PGZ4_BBC3-01      --------------------------------------------------
A0A5F5PGZ4_BBC3-02      --------------------------------------------------
A0A337SJI7_BBC3-01      --------------------------------------------------
A0A667IM83_BBC3-01      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6KS56_BBC3-01      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
H2NZD3_BBC3-02          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K5V8L0_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
                                                                          

A0A4X2LVY2_BBC3-01      acctgctccgcccacctgtctccacaggctccccggtgtggcatg-----
A0A4X2LVY2_BBC3-02      ------------------------------------------atg-----
G3T2N1_BBC3-01          ------------------------------------------atg-----
F7GL32_BBC3-01          cacctgtctgtgtccctccgcaggctccctccccactggggcatg-----
F7GL32_BBC3-02          ------------------------------------------atg-----
A0A5F9DGT6_BBC3-01      ------------------------------------------atg-----
Q80ZG6_BBC3-01          ------------------------------------------atg-----
B2RVL4_BBC3-01          ------------------------------------------atg-----
Q99ML1_BBC3-01          ------------------------------------------atg-----
Q99ML1_BBC3-02          ------------------------------------------atg-----
Q99ML1_BBC3-03          ------------------------------------------atg-----
M3Y0R3_BBC3-01          ------------------------caggccccagggagcgccatg-----
A0A673UKJ9_BBC3-02      ------------------------------------------atgtatag
A0A671F3X5_BBC3-03      ----------------------------------------------agag
A0A671F3X5_BBC3-01      ----------------------------------------------agag
A0A671F3X5_BBC3-02      ----------------------------------------------agag
A0A673UKJ9_BBC3-01      ------------------------------------------atg-tata
A0A7N5KJL4_BBC3-01      ------------------------------------------atg-----
A0A7N5KJL4_BBC3-02      ------------------------------------------atg-----
A0A2Y9PEE3_BBC3-01      ------------------------------------------atg-----
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      accgtgcccctctgtcctgtcctgcaggccccagggagcgccatg-----
A0A4X1VVX9_BBC3-02      ------------------------------------------atg-----
A0A480SCP6_BBC3-02      -------------------tgtcacaggccccagggagcgccatg-----
A0A480SCP6_BBC3-03      ------------------------------------------atg-----
A0A4W2EKD9_BBC3-01      ------------------------------------------gtg-agag
A0A4W2EKD9_BBC3-01      ------------------------------------------gtg-agag
A0A4W2EKD9_BBC3-02      ------------------------------------------atg-----
A0A3Q1LXZ6_BBC3-01      ------------------------------------------atg-----
A0A4W2EKD9_BBC3-02      ------------------------------------------atg-----
A0A452E3G1_BBC3-01      ------------------------------------------atg-----
A0A5F5PGZ4_BBC3-01      ------------------------------------------gtg-agag
A0A5F5PGZ4_BBC3-02      ------------------------------------------gtg-agag
A0A337SJI7_BBC3-01      ------------------------------------------atg-----
A0A667IM83_BBC3-01      ------------------------------------------atg-----
H0XQ00_BBC3-01          ------------------------------------------atg-----
A0A2K6KS56_BBC3-01      ------------------------------------------atg-ccgc
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      ------------------------------------------atg-aaat
A0A2K6FQZ1_BBC3-01      ------------------------------------------atg-----
A0A2K6FQZ1_BBC3-02      ------------------------------------------atg-aaat
A0A2K6FQZ1_BBC3-03      ------------------------------------------atg-aaat
A0A2I3HWI8_BBC3-01      ------------------------------------------atg-aaat
A0A2I3HWI8_BBC3-02      ------------------------------------------atg-aaat
A0A2I3HWI8_BBC3-03      ------------------------------------------atg-aaat
Q9BXH1_BBC3-04          ------------------------------------------atg-aaat
Q9BXH1_BBC3-05          ------------------------------------------atg-aaat
Q9BXH1_BBC3-03          ------------------------------------------atg-aaat
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
H2NZD3_BBC3-01          ------------------------------------------atg-aaat
H2NZD3_BBC3-02          ------------------------------------------atg-aaat
A0A2R9BZA9_BBC3-02      ------------------------------------------atg-aaat
A0A2R9BZA9_BBC3-01      ------------------------------------------atg-aaat
A0A2I3RGH5_BBC3-05      ------------------------------------------atg-aaat
A0A2I3RGH5_BBC3-03      ------------------------------------------atg-aaat
A0A2I3RGH5_BBC3-04      ------------------------------------------atg-aaat
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      ------------------------------------------atg-aaat
A0A2K5P2T8_BBC3-02      ------------------------------------------ata-aaat
A0A2K5P2T8_BBC3-01      ------------------------------------------ata-aaat
A0A2K5P2T8_BBC3-03      ------------------------------------------ata-aaat
A0A2K6ASP2_BBC3-02      ------------------------------------------ata-aaat
A0A2K5V8L0_BBC3-01      ------------------------------------------ata-aaat
A0A2K6ASP2_BBC3-01      ------------------------------------------ata-aaat
A0A2K6ASP2_BBC3-03      ------------------------------------------ata-aaat
A0A2K6QZT2_BBC3-03      ------------------------------------------ata-aaat
A0A2K6QZT2_BBC3-04      ------------------------------------------ata-aaat
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-02      ------------------------------------------ata-aaat
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-01      ------------------------------------------ata-aaat
A0A2I3N2Z9_BBC3-02      ------------------------------------------ata-aaat
A0A2K6STD6_BBC3-02      ------------------------------------------atg-aaat
A0A2K6STD6_BBC3-01      ------------------------------------------atg-aaat
A0A2K5F6X4_BBC3-01      ----------------------------------------------aaat
A0A2K5F6X4_BBC3-03      --------------------------------------------------
A0A2K5F6X4_BBC3-02      ----------------------------------------------aaat
A0A2K5QNS7_BBC3-03      ------------------------------------------atg-aaat
A0A2K5QNS7_BBC3-01      ------------------------------------------atg-aaat
A0A2K5QNS7_BBC3-02      ------------------------------------------atg-aaat
                                                                          

A0A4X2LVY2_BBC3-01      ----------------gccagagcacagc---------------------
A0A4X2LVY2_BBC3-02      ----------------gccagagcacagc---------------------
G3T2N1_BBC3-01          ----------------gcccgcgcacgcc---------------------
F7GL32_BBC3-01          ----------------gccagagcccagc---------------------
F7GL32_BBC3-02          ----------------gccagagcccagc---------------------
A0A5F9DGT6_BBC3-01      ----------------gcccgcgcacgcc---------------------
Q80ZG6_BBC3-01          ----------------gcccgcgcacgcc---------------------
B2RVL4_BBC3-01          ----------------gcccgcgcacgcc---------------------
Q99ML1_BBC3-01          ----------------gcccgcgcacgcc---------------------
Q99ML1_BBC3-02          ----------------gcccgcgcacgcc---------------------
Q99ML1_BBC3-03          ----------------gcccgcgcacgcc---------------------
M3Y0R3_BBC3-01          ----------------gcccgagcacgcc---------------------
A0A673UKJ9_BBC3-02      -cagtgcagg--ggctgcccgggcatgtccctggaaggtg---ggggctt
A0A671F3X5_BBC3-03      tcagtgcagg--ggctgcccgggcatgtccatgccaggtgcc-gaggctt
A0A671F3X5_BBC3-01      tcagtgcagg--ggctgcccgggcatgtccatgccaggtgcc-gaggctt
A0A671F3X5_BBC3-02      tcagtgcagg--ggctgcccgggcatgtccatgccaggtgcc-gaggctt
A0A673UKJ9_BBC3-01      gcagtgcagg--ggctgcccgggcatgtccctggaaggtg---ggggctt
A0A7N5KJL4_BBC3-01      ----------------gcccgagcacgcc---------------------
A0A7N5KJL4_BBC3-02      ----------------gcccgagcacgcc---------------------
A0A2Y9PEE3_BBC3-01      ----------------gcccgagcacgcc---------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      ----------------gcccgagcacgcc---------------------
A0A4X1VVX9_BBC3-02      ----------------gcccgagcacgcc---------------------
A0A480SCP6_BBC3-02      ----------------gcccgagcacgcc---------------------
A0A480SCP6_BBC3-03      ----------------gcccgagcacgcc---------------------
A0A4W2EKD9_BBC3-01      ccactgcaga--ggctgcccgggcatgtc---------------------
A0A4W2EKD9_BBC3-01      ccactgcaga--ggctgcccgggcatgtc---------------------
A0A4W2EKD9_BBC3-02      ----------------gcccgagcacgcc---------------------
A0A3Q1LXZ6_BBC3-01      ----------------gcccgagcacgcc---------------------
A0A4W2EKD9_BBC3-02      ----------------gcccgagcacgcc---------------------
A0A452E3G1_BBC3-01      ----------------gcccgagcacgcc---------------------
A0A5F5PGZ4_BBC3-01      tcagcgcagg--ggctgcccgggcatgtctgtgccaggcgcctggggctt
A0A5F5PGZ4_BBC3-02      tcagcgcagg--ggctgcccgggcatgtctgtgccaggcgcctggggctt
A0A337SJI7_BBC3-01      ----------------gcccgagcacgcc---------------------
A0A667IM83_BBC3-01      ----------------gcccgagcacgcc---------------------
H0XQ00_BBC3-01          ----------------gcccgcgcacgccaa-------------------
A0A2K6KS56_BBC3-01      gcaccagaggcagctcccccggacccgtagagggctggccgcgacggccg
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      ttggtgcggg--gtctgcccgggcatgtccctgccaggtgcccgggactt
A0A2K6FQZ1_BBC3-01      ----------------gcccgcgcacgcc---------------------
A0A2K6FQZ1_BBC3-02      ttggtgcggg--gtctgcccgggcatgtccctgccaggtgcccgggactt
A0A2K6FQZ1_BBC3-03      ttggtgcggg--gtctgcccgggcatgtccctgccaggtgcccgggactt
A0A2I3HWI8_BBC3-01      ttggcatggg--gtctgcccgggcatgtccatgccaggtgcccagggctt
A0A2I3HWI8_BBC3-02      ttggcatggg--gtctgcccgggcatgtccatgccaggtgcccagggctt
A0A2I3HWI8_BBC3-03      ttggcatggg--gtctgcccgggcatgtccatgccaggtgcccagggctt
Q9BXH1_BBC3-04          ttg-----------------------------------------------
Q9BXH1_BBC3-05          ttg-----------------------------------------------
Q9BXH1_BBC3-03          ttggcatggg--gtctgcccaggcatgtccatgccaggtgcccagggctg
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
H2NZD3_BBC3-01          ttggcatggg--gtctgcccaggcatgtccatgccaggtgcccagggctt
H2NZD3_BBC3-02          ttggcatggg--gtctgcccaggcatgtccatgccaggtgcccagggctt
A0A2R9BZA9_BBC3-02      ttggcatggg--gtctgcccaggcatgtccatgccaggtgcccagggctg
A0A2R9BZA9_BBC3-01      ttggcatggg--gtctgcccaggcatgtccatgccaggtgcccagggctg
A0A2I3RGH5_BBC3-05      ttggcatggg--gtctgcccaggcatgtccatgccaggtgcccagggctg
A0A2I3RGH5_BBC3-03      ttggcatggg--gtctgcccaggcatgtccatgccaggtgcccagggctg
A0A2I3RGH5_BBC3-04      ttggcatggg--gtctgcccaggcatgtccatgccaggtgcccagggctg
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      ttggcatggg--gtctgcccaggcatgtccatgccaggtgcccagggctg
A0A2K5P2T8_BBC3-02      ttggcgtggg--gtctgcccgggcatgtccatgccaggtgcccagggctg
A0A2K5P2T8_BBC3-01      ttggcgtggg--gtctgcccgggcatgtccatgccaggtgcccagggctg
A0A2K5P2T8_BBC3-03      ttggcgtggg--gtctgcccgggcatgtccatgccaggtgcccagggctg
A0A2K6ASP2_BBC3-02      ttggcgtggg--gtctgcccgggcatgtccat------------------
A0A2K5V8L0_BBC3-01      ttggcgtggg--gtctgcccgggcatgtccat------------------
A0A2K6ASP2_BBC3-01      ttggcgtggg--gtctgcccgggcatgtccat------------------
A0A2K6ASP2_BBC3-03      ttggcgtggg--gtctgcccgggcatgtccat------------------
A0A2K6QZT2_BBC3-03      ttggcgtggg--gtctgcccgggcatgtccat------------------
A0A2K6QZT2_BBC3-04      ttggcgtggg--gtctgcccgggcatgtccat------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-02      ttggcgtggg--gtctgcccgggcatgtccatgccaggtgcccagggctt
A0A0D9S2H2_BBC3-01      -------------------caggc----------------cccaggg---
A0A2I3N2Z9_BBC3-01      ttggcgtggg--gtctgcccgggcatgtccatgccaggtgcccagggctt
A0A2I3N2Z9_BBC3-02      ttggcgtggg--gtctgcccgggcatgtccatgccaggtgcccagggctt
A0A2K6STD6_BBC3-02      gtggcatggg--gtctgcctgggcatgtccatgccaagtgcccagggctt
A0A2K6STD6_BBC3-01      gtggcatggg--gtctgcctgggcatgtccatgccaagtgcccagggctt
A0A2K5F6X4_BBC3-01      gtggcgtggg--gtctgcctgggcatgtccatgccaagtgcctagggctt
A0A2K5F6X4_BBC3-03      -------------tctgcctgggcatgtccatgccaagtgcctagggctt
A0A2K5F6X4_BBC3-02      gtggcgtggg--gtctgcctgggcatgtccatgccaagtgcctagggctt
A0A2K5QNS7_BBC3-03      gtggcgtggg--gtctgcctgggcatgtccatgccaagtgcccagggctt
A0A2K5QNS7_BBC3-01      gtggcgtggg--gtctgcctgggcatgtccatgccaagtgcccagggctt
A0A2K5QNS7_BBC3-02      gtggcgtggg--gtctgcctgggcatgtccatgccaagtgcccagggctt
                                                                          

A0A4X2LVY2_BBC3-01      --------------------------------------------------
A0A4X2LVY2_BBC3-02      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
F7GL32_BBC3-01          --------------------------------------------------
F7GL32_BBC3-02          --------------------------------------------------
A0A5F9DGT6_BBC3-01      --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
B2RVL4_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-03          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A673UKJ9_BBC3-02      ccttagtgccccgggtgccccgtcagatttgt------------------
A0A671F3X5_BBC3-03      ccttctgg--ttgggtcccccatcagatttgt------------------
A0A671F3X5_BBC3-01      ccttctgg--ttgggtcccccatcagatttgtggccccagggagcgccat
A0A671F3X5_BBC3-02      ccttctgg--ttgggtcccccatcagatttgt------------------
A0A673UKJ9_BBC3-01      ccttagtgccccgggtgccccgtcagatttgtg-----------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A2Y9PEE3_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      --------------------------------------------------
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A5F5PGZ4_BBC3-01      ccttctcaccctgggtcccccagcagactcgtggccccagggagcgccat
A0A5F5PGZ4_BBC3-02      ccttctcaccctgggtcccccagcagactcgt------------------
A0A337SJI7_BBC3-01      --------------------------------------------------
A0A667IM83_BBC3-01      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6KS56_BBC3-01      tcgccccttcccgctcggcctgtc--------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      ccttctcatggtgggtcctgggccatattcct------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-02      ccttctcatggtgggtcctgggccatattcctggccccagggagcgccat
A0A2K6FQZ1_BBC3-03      ccttctcatggtgggtcctgggccatattcct------------------
A0A2I3HWI8_BBC3-01      cttccgtgacgtgggtcccctgccagatttgt------------------
A0A2I3HWI8_BBC3-02      cttccgtgacgtgggtcccctgccagatttgtggccccagggagcgccat
A0A2I3HWI8_BBC3-03      cttccgtgacgtgggtcccctgccagatttgt------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          cttccacgacgtgggtcccctgccagatttgtggccccagggagcgccat
B4DQK3_BBC3-01          ------------------------------atggccccagggagcgccat
Q9BXH1_BBC3-06          ------------------------------------------------at
H2NZD3_BBC3-01          cttctgcgacgtgggtcccctgccagatttgtggccccagggagcgccat
H2NZD3_BBC3-02          cttctgcgacgtgggtcccctgccagatttgt------------------
A0A2R9BZA9_BBC3-02      cttccgtgacgtgggtcccctgccagatttgtg-----------------
A0A2R9BZA9_BBC3-01      cttccgtgacgtgggtcccctgccagatttgtg-----------------
A0A2I3RGH5_BBC3-05      cttccgcgacgtgggtcccctgccagatttgtg-----------------
A0A2I3RGH5_BBC3-03      cttccgcgacgtgggtcccctgccagatttgtg-----------------
A0A2I3RGH5_BBC3-04      cttccgcgacgtgggtcccctgccagatttgtggccccagggagcgccat
A0A2I3RGH5_BBC3-01      ------------------------------------------------at
A0A2I3RGH5_BBC3-02      cttccgcgacgtgggtcccctgccagatttgtggccccagggagcgccat
A0A2K5P2T8_BBC3-02      cttctgcgacgtgggtcctctgccagatttgt------------------
A0A2K5P2T8_BBC3-01      cttctgcgacgtgggtcctctgccagatttgtggccccagggagcgccat
A0A2K5P2T8_BBC3-03      cttctgcgacgtgggtcctctgccagatttgt------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K5V8L0_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K6QZT2_BBC3-01      ------------------------------------------------at
A0A2K6QZT2_BBC3-02      cttctgcgacgtgggtcccctgccagatttgtggccccagggagcgccat
A0A0D9S2H2_BBC3-01      ------------------------------------------agcgccat
A0A2I3N2Z9_BBC3-01      cttctgcgacgtgggtcccctgccagatttgtggccccagggagcgccat
A0A2I3N2Z9_BBC3-02      cttctgcgacgtgggtcccctgccagatttgt------------------
A0A2K6STD6_BBC3-02      cttccttgacgtgggtcccctgccagatgtgt------------------
A0A2K6STD6_BBC3-01      cttccttgacgtgggtcccctgccagatgtgt------------------
A0A2K5F6X4_BBC3-01      cttcctcgacgtgggtcccctgccagatgtgt------------------
A0A2K5F6X4_BBC3-03      cttcctcgacgtgggtcccctgccagatgtgtggccccagggagcgccat
A0A2K5F6X4_BBC3-02      cttcctcgacgtgggtcccctgccagatgtgt------------------
A0A2K5QNS7_BBC3-03      cttcctcggtgtgggttccttgccagatgtgt------------------
A0A2K5QNS7_BBC3-01      cttcctcggtgtgggttccttgccagatgtgtggccccagggagcgccat
A0A2K5QNS7_BBC3-02      cttcctcggtgtgggttccttgccagatgtgt------------------
                                                                          

A0A4X2LVY2_BBC3-01      --------------aggacggcagctcccgagaaccagtagagggtctgc
A0A4X2LVY2_BBC3-02      --------------aggacggcagctcccgagaaccagtagagggtctgc
G3T2N1_BBC3-01          --------------aggagggcagctcccccgagcccgtagagggtctgg
F7GL32_BBC3-01          --------------aggatggcagctctccggagccggtggaggggctgc
F7GL32_BBC3-02          --------------aggatggcagctctccggagccggtggaggggctgc
A0A5F9DGT6_BBC3-01      --------------aggagggcagctctccggagcccgtagagggcctgg
Q80ZG6_BBC3-01          --------------aggagggcagctctccggagcccgtagagggcctag
B2RVL4_BBC3-01          --------------aggagggcagctctccggagcccgtagagggtctag
Q99ML1_BBC3-01          --------------aggagggcagctctccggagcccgtagagggtctag
Q99ML1_BBC3-02          --------------aggagggcagctctccggagcccgtagagggtctag
Q99ML1_BBC3-03          --------------aggagggcagctctccggagcccgtagagggtctag
M3Y0R3_BBC3-01          --------------aggagggcagctccccggagcccgtagagggcctgt
A0A673UKJ9_BBC3-02      --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      ggcccgagcactccaggagggcagctccccggagcccgtagagggcctgg
A0A671F3X5_BBC3-02      --------------------------------------------------
A0A673UKJ9_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-01      --------------aggagggcagctccccggagcccgtagagggcctgg
A0A7N5KJL4_BBC3-02      --------------aggagggcagctccccggagcccgtagagggcctgg
A0A2Y9PEE3_BBC3-01      --------------aggagggcagctcccccgagcccgtagagggcctgg
A0A480SCP6_BBC3-01      ---------------------------gcgagagtcagtgcaggggct-g
A0A4X1VVX9_BBC3-01      ---------------------------gcgagagtcagtgcaggggct-g
A0A480SCP6_BBC3-04      --------------aggagggcagctccccggagcccgtagagggcctgg
A0A4X1VVX9_BBC3-02      --------------aggagggcagctccccggagcccgtagagggcctgg
A0A480SCP6_BBC3-02      --------------aggagggcagctccccggagcccgtagagggcctgg
A0A480SCP6_BBC3-03      --------------aggagggcagctccccggagcccgtagagggcctgg
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------aggagggcagctccccggagcccgtagagggcctgg
A0A3Q1LXZ6_BBC3-01      --------------aggagggcagctccccggagcccgtagagggcctgg
A0A4W2EKD9_BBC3-02      --------------aggagggcagctccccggagcccgtagagggcctgg
A0A452E3G1_BBC3-01      --------------aggagggcagctcccccgagcccgtagagggcctgg
A0A5F5PGZ4_BBC3-01      ggcccgagcacgccaggagggcagctccccggagccggtagagggcctgg
A0A5F5PGZ4_BBC3-02      --------------------------------------------------
A0A337SJI7_BBC3-01      --------------aggagggcagctccccggagcccgtagagggcctgg
A0A667IM83_BBC3-01      --------------aggagggcagctccccggagcccgtagagggcctgg
H0XQ00_BBC3-01          ----------------gagggcagctccccggagcccgtagagggcctgg
A0A2K6KS56_BBC3-01      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------aggagggcagctccccggagcccgtagagggcctgg
A0A2K6FQZ1_BBC3-02      ggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctgg
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      ggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctgg
A0A2I3HWI8_BBC3-03      --------------------------------------------------
Q9BXH1_BBC3-04          -------------------------------------gcatggggtctgc
Q9BXH1_BBC3-05          -------------------------------------gcatggggtctgc
Q9BXH1_BBC3-03          ggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctgg
B4DQK3_BBC3-01          ggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctgg
Q9BXH1_BBC3-06          ggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctgg
H2NZD3_BBC3-01          ggcccgcgcacggcaggagggcagctccccggagcccgtagagggcctgg
H2NZD3_BBC3-02          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      ggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctgg
A0A2I3RGH5_BBC3-01      ggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctgg
A0A2I3RGH5_BBC3-02      ggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctgg
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      ggcccgcgcacgccaggagggcagctctccggagcccgtagagggcctgg
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K5V8L0_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K6QZT2_BBC3-01      ggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctgg
A0A2K6QZT2_BBC3-02      ggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctgg
A0A0D9S2H2_BBC3-01      ggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctgg
A0A2I3N2Z9_BBC3-01      ggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctgg
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      ggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctgg
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      ggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctgg
A0A2K5QNS7_BBC3-02      --------------------------------------------------
                                                                          

A0A4X2LVY2_BBC3-01      cccgggagggccccag-aacctttcccctggggcggctcatgccctctgc
A0A4X2LVY2_BBC3-02      cccgggagggccccag-aacctttcccctggggcggctcatgccctctgc
G3T2N1_BBC3-01          cccgcgagagcccgcg-ccccttcccactcggcagcctggtgccctcggc
F7GL32_BBC3-01          cccgggagagccccag-gaccttccccctgggccggctcatgccctctgc
F7GL32_BBC3-02          cccgggagagccccag-gaccttccccctgggccggctcatgccctctgc
A0A5F9DGT6_BBC3-01      cccgcgacggccctcgcccccttcccgcttggtcgcctggtgccctcggc
Q80ZG6_BBC3-01          cccgcgacagcccgcg-tcctttcccgctcggccgcctgatgccctccgc
B2RVL4_BBC3-01          cccgcgacagtccgcg-ccccttcccgctcggccgcctgatgccctccgc
Q99ML1_BBC3-01          cccgcgacagtccgcg-ccccttcccgctcggccgcctgatgccctccgc
Q99ML1_BBC3-02          cccgcgacagtccgcg-ccccttcccgctcggccgcctgatgccctccgc
Q99ML1_BBC3-03          cccgcgacagtccgcg-ccccttcccgctcggccgcctgatgccctccgc
M3Y0R3_BBC3-01          cccgcgacggcccgcg-cccctttcccctcagccgcctggtgccctcggc
A0A673UKJ9_BBC3-02      --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      cccgcgacggcccgcg-ccccttcccactcagccgcctggtgccctcggc
A0A671F3X5_BBC3-02      --------------------------------------------------
A0A673UKJ9_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-01      cccgcgacggcccgcg-cccctttcccctcagccgcctggtgccctcagc
A0A7N5KJL4_BBC3-02      cccgcgacggcccgcg-cccctttcccctcagccgcctggtgccctcagc
A0A2Y9PEE3_BBC3-01      cccgcgacggcccgcg-tcccttccccctcagccgcctggtgccctcggc
A0A480SCP6_BBC3-01      cccgggcatgtccgtg-cc------------------------------c
A0A4X1VVX9_BBC3-01      cccgggcatgtccgtg-cc------------------------------c
A0A480SCP6_BBC3-04      cccgcgacggcccgcg-tcccttccccctcagccgcctggtgccctccgc
A0A4X1VVX9_BBC3-02      cccgcgacggcccgcg-tcccttccccctcagccgcctggtgccctccgc
A0A480SCP6_BBC3-02      cccgcgacggcccgcg-tcccttccccctcagccgcctggtgccctccgc
A0A480SCP6_BBC3-03      cccgcgacggcccgcg-tcccttccccctcagccgcctggtgccctccgc
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      cccgcgacggcccgcg-ccccttcccgctcagccgcctggtgccctcggc
A0A3Q1LXZ6_BBC3-01      cccgcgacggcccgcg-ccccttcccgctcagccgcctggtgccctcggc
A0A4W2EKD9_BBC3-02      cccgcgacggcccgcg-ccccttcccgctcagccgcctggtgccctcggc
A0A452E3G1_BBC3-01      cccgcgacggcccgcg-ccccttcccgctcagccgcctggtgccctcggc
A0A5F5PGZ4_BBC3-01      cccgcgacggcccgcg-ccccttcccgctcagccgcctggtgccctcggc
A0A5F5PGZ4_BBC3-02      --------------------------------------------------
A0A337SJI7_BBC3-01      cccgcgacggcccgcg-cccctttcccctcagccgcctggtgccctcggc
A0A667IM83_BBC3-01      cccgcgacggcccgcg-cccctttcccctcagccgcctggtgccctcggc
H0XQ00_BBC3-01          ctcgcgacggtccgcg-ccccttcccgctcggccgcctagtgccctcggc
A0A2K6KS56_BBC3-01      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      cccgcgacggcccgcg-ccccttcccgctcggccgcctggtgccctcggc
A0A2K6FQZ1_BBC3-02      cccgcgacggcccgcg-ccccttcccgctcggccgcctggtgccctcggc
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      cccgcgacggcccgcg-ccccttcccgctcggccgcctggtgccctcggc
A0A2I3HWI8_BBC3-03      --------------------------------------------------
Q9BXH1_BBC3-04          ccaggcatgtcc--------------------atgccaggtgcccagg--
Q9BXH1_BBC3-05          ccaggcatgtcc--------------------atgccaggtgcccagg--
Q9BXH1_BBC3-03          cccgcgacggcccgcg-ccccttcccgctcggccgcctggtgccctcggc
B4DQK3_BBC3-01          cccgcgacggcccgcg-ccccttcccgctcggccgcctggtgccctcggc
Q9BXH1_BBC3-06          cccgcgacggcccgcg-ccccttcccgctcggccgcctggtgccctcggc
H2NZD3_BBC3-01          cccgcgacggcccgcg-ccccttcccgctcggccgcctggtgccctcggc
H2NZD3_BBC3-02          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      cccgcgacggcccgcg-ccccttcccgctcggccgcctggtgccctcggc
A0A2I3RGH5_BBC3-01      cccgcgacggcccgcg-ccccttcccgctcggccgcctggtgccctcggc
A0A2I3RGH5_BBC3-02      cccgcgacggcccgcg-ccccttcccgctcggccgcctggtgccctcggc
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      cccgcgacggcccgcg-ccccttcccgctcggccgcctggtgccctcggc
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-02      ----------------------------------gccaggtgcccaggg-
A0A2K5V8L0_BBC3-01      ----------------------------------gccaggtgcccaggg-
A0A2K6ASP2_BBC3-01      ----------------------------------gccaggtgcccaggg-
A0A2K6ASP2_BBC3-03      ----------------------------------gccaggtgcccaggg-
A0A2K6QZT2_BBC3-03      ----------------------------------gccaggtgcccaggg-
A0A2K6QZT2_BBC3-04      ----------------------------------gccaggtgcccaggg-
A0A2K6QZT2_BBC3-01      cccgcgacggcccgcg-ccccttcccgctcggccgcctggtgccctcggc
A0A2K6QZT2_BBC3-02      cccgcgacggcccgcg-ccccttcccgctcggccgcctggtgccctcggc
A0A0D9S2H2_BBC3-01      cccgcgacggcccgcg-ccccttcccgctcggccgcctggtgccctcggc
A0A2I3N2Z9_BBC3-01      cccgcgacggcccgcg-ccccttcccgctcggccgcctggtgccctcggc
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      cccgcgacggcccgcg-ccccttcccgct---------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      cccgcgacggcccgcg-ccccttcccgctcggccgcctggtgccctcggc
A0A2K5QNS7_BBC3-02      --------------------------------------------------
                                                                          

A0A4X2LVY2_BBC3-01      agtctcctgcagcc-tctgcgaggctggcctgaacccttctggtgactcc
A0A4X2LVY2_BBC3-02      agtctcctgcagcc-tctgcgaggctggcctgaacccttctggtgactcc
G3T2N1_BBC3-01          cgtgtcctgtggcc-tctgcgagcccggccttcctcgagttgcagggcca
F7GL32_BBC3-01          ggtctcctgcagcc-tctgtgaggccggcttgaacccctctggcgactcc
F7GL32_BBC3-02          ggtctcctgcagcc-tctgtgaggccggcttgaacccctctggcgactcc
A0A5F9DGT6_BBC3-01      cgtgtcctgcggccttctgcgagcgggaagtc---cctcctggaatctga
Q80ZG6_BBC3-01          tgtatcctgcggcc-tctgcgagcccggcctg---cccgctg-----ccc
B2RVL4_BBC3-01          tgtatcctgcagcc-tttgcgagcccggcctg---cccgccg-----ccc
Q99ML1_BBC3-01          tgtatcctgcagcc-tttgcgagcccggcctg---cccgccg-----ccc
Q99ML1_BBC3-02          tgtatcctgcagcc-tttgcgagcccggcctg---cccgccg-----ccc
Q99ML1_BBC3-03          tgtatcctgcagcc-tttgcgagcccggcctg---cccgccg-----ccc
M3Y0R3_BBC3-01          cgtgtcctgtggcc-tctgggaatctga----------------------
A0A673UKJ9_BBC3-02      --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      tgtgtcctgcggcc-tctgcgagccaggcctg---cccgctg-----ccc
A0A671F3X5_BBC3-02      --------------------------------------------------
A0A673UKJ9_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-01      cgtctcctgcggcc-tctgtgagcccggcctg---cccgccg-----ccc
A0A7N5KJL4_BBC3-02      cgtctcctgcggcc-tctgtgagcccggcctg---cccgccg-----ccc
A0A2Y9PEE3_BBC3-01      cgtatcctgcggcc-tctgcgaacccggcctg---cctgccg-----ccc
A0A480SCP6_BBC3-01      agtgcccagggctt-tctgctcacc-------------------------
A0A4X1VVX9_BBC3-01      agtgcccagggctt-tctgctcacc-------------------------
A0A480SCP6_BBC3-04      cgtgtcctgcggcc-tctgcgaacccggtctg---cctgccg-----ccc
A0A4X1VVX9_BBC3-02      cgtgtcctgcggcc-tctgcgaacccggtctg---cctgccg-----ccc
A0A480SCP6_BBC3-02      cgtgtcctgcggcc-tctgcgaacccggtctg---cctgccg-----ccc
A0A480SCP6_BBC3-03      cgtgtcctgcggcc-tctgcgaacccggtctg---cctgccg-----ccc
A0A4W2EKD9_BBC3-01      cgtg----------------------------------------------
A0A4W2EKD9_BBC3-01      cgtg----------------------------------------------
A0A4W2EKD9_BBC3-02      ggtgtcctgcggcc-tctgcgaacccggcctg---cctgctg-----ccc
A0A3Q1LXZ6_BBC3-01      ggtgtcctgcggcc-tctgcgaacccggcctg---cctgctg-----ccc
A0A4W2EKD9_BBC3-02      ggtgtcctgcggcc-tctgcgaacccggcctg---cctgctg-----ccc
A0A452E3G1_BBC3-01      ggtgtcctgtggcc-tctgcgaacccggcctg---cctgctg-----ccc
A0A5F5PGZ4_BBC3-01      cgtgtcctgcggcc-tctgcgagcccggcctg---cccgccg-----cgc
A0A5F5PGZ4_BBC3-02      --------------------------------------------------
A0A337SJI7_BBC3-01      cgtgtcctgcggcc-tctgcgagcccggcctg---cccgccg-----ccc
A0A667IM83_BBC3-01      cgtgtcctgcggcc-tctgcgagcccggcctg---cccgccg-----ccc
H0XQ00_BBC3-01          cgtgtcctgcggcc-tctgcgagcccggcctg---cccgccg-----ccc
A0A2K6KS56_BBC3-01      ------ctgcggcc-tctgcgagcccggccgg---ctgccgc-----ccc
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      cgtgtcctgcggcc-tctgcgagcccggcctg---cccgctg-----ccc
A0A2K6FQZ1_BBC3-02      cgtgtcctgcggcc-tctgcgagcccggcctg---cccgctg-----ccc
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      agtgtcctgcggcc-tctgcgagcccggccta---gctgccg-----ccc
A0A2I3HWI8_BBC3-03      --------------------------------------------------
Q9BXH1_BBC3-04          --------gctgct-tccacga----------------------------
Q9BXH1_BBC3-05          --------gctgct-tccacga----------------------------
Q9BXH1_BBC3-03          agtgtcctgcggcc-tctgcgagcccggcctg---gctgccg-----ccc
B4DQK3_BBC3-01          agtgtcctgcggcc-tctgcgagcccggcctg---gctgccg-----ccc
Q9BXH1_BBC3-06          agtgtcctgcggcc-tctgcgagcccggcctg---gctgccg-----ccc
H2NZD3_BBC3-01          agtgtcctgcggcc-tctgcgagcccggcctg---gccgccg-----ccc
H2NZD3_BBC3-02          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      agtgtcctgcggcc-tctgcgagcccggcctg---gctgccg-----ccc
A0A2I3RGH5_BBC3-01      agtgtcctgcggcc-tctgcgagcccggcctg---gctgccg-----ccc
A0A2I3RGH5_BBC3-02      agtgtcctgcggcc-tctgcgagcccggcctg---gctgccg-----ccc
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      agtgtcctgcggcc-tctgcgagcccggcctg---gctgccg-----ccc
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K5V8L0_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K6QZT2_BBC3-01      agtgtcctgcggcc-tctgcgagcccggcctg---gctgcca-----ccc
A0A2K6QZT2_BBC3-02      agtgtcctgcggcc-tctgcgagcccggcctg---gctgcca-----ccc
A0A0D9S2H2_BBC3-01      agtgtcctgcggcc-tctgcgagcccggcctg---gctgccg-----ccc
A0A2I3N2Z9_BBC3-01      agtgtcctgcggcc-tctgcgagcccggcctg---gctgccg-----ccc
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      cgtgtcctgcggcc-tctgcgagtccggcctg---cccgccg-----ccc
A0A2K5QNS7_BBC3-02      --------------------------------------------------
                                                                          

A0A4X2LVY2_BBC3-01      atgtgtccagcccctggccccgcgctggcacccccttccctcctgcccct
A0A4X2LVY2_BBC3-02      atgtgtccagcccctggccccgcgctggcacccccttccctcctgcccct
G3T2N1_BBC3-01          cgg----ctccttccggggcctcggacacagc--------------tgtt
F7GL32_BBC3-01          atgtgcccagccccggggccagcgctggcaccctcttccctcctgcccct
F7GL32_BBC3-02          atgtgcccagccccggggccagcgctggcaccctcttccctcctgcccct
A0A5F9DGT6_BBC3-01      ctg----cagtccccgagctgcggccggcgggctcctcc-----------
Q80ZG6_BBC3-01          ctg----ctgcccctgccttgctgccggccgcctacctc-------tgcg
B2RVL4_BBC3-01          ctg----ctgcccctgccttgctgccggccgcctacctc-------tgcg
Q99ML1_BBC3-01          ctg----ctgcccctgccttgctgccggccgcctacctc-------tgcg
Q99ML1_BBC3-02          ctg----ctgcccctgccttgctgccggccgcctacctc-------tgcg
Q99ML1_BBC3-03          ctg----ctgcccctgccttgctgccggccgcctacctc-------tgcg
M3Y0R3_BBC3-01          ctg----cagtccccgagttgcagcccacggccttttccgggccggggca
A0A673UKJ9_BBC3-02      --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      ccg----ccgcccctgccctgctgccagctgcctacctc-------tgcg
A0A671F3X5_BBC3-02      --------------------------------------------------
A0A673UKJ9_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-01      ccg----ccgcccccgccctgctgcccgctgcctacctc-------tgc-
A0A7N5KJL4_BBC3-02      ccg----ccgcccccgccctgctgcccgctgcctacctc-------tg--
A0A2Y9PEE3_BBC3-01      ccg----ccgcccccgccctgctgcccgccgcctacctc-------tgcg
A0A480SCP6_BBC3-01      -------ctggccccacc--------------------------------
A0A4X1VVX9_BBC3-01      -------ctggccccacc--------------------------------
A0A480SCP6_BBC3-04      ccg----ccgcccccaccctgctgcccgctgcctacctc-------tgcg
A0A4X1VVX9_BBC3-02      ccg----ccgcccccaccctgctgcccgctgcctacctc-------tgcg
A0A480SCP6_BBC3-02      ccg----ccgcccccaccctgctgcccgctgcctacctc-------tgcg
A0A480SCP6_BBC3-03      ccg----ccgcccccaccctgctgcccgctgcctacctc-------tgcg
A0A4W2EKD9_BBC3-01      -----------------ccagctgcccggggctttcttc-------t---
A0A4W2EKD9_BBC3-01      -----------------ccagctgcccggggctttcttc-------t---
A0A4W2EKD9_BBC3-02      ccg----ccgcccccgccctgctgcccgccgcctacctc-------tgcg
A0A3Q1LXZ6_BBC3-01      ccg----ccgcccccgccctgctgcccgccgcctacctc-------tgcg
A0A4W2EKD9_BBC3-02      ccg----ccgcccccgccctgctgcccgccgcctacctc-------tgcg
A0A452E3G1_BBC3-01      ccg----ccgcccccgccctgctgcccgccgcctacctc-------tgcg
A0A5F5PGZ4_BBC3-01      ccg----ccgcgcccgccctgctgcccgctgcctacctc-------tgcg
A0A5F5PGZ4_BBC3-02      --------------------------------------------------
A0A337SJI7_BBC3-01      ccg----ccgcccccgccctgctgcccgccgcctacctc-------tgcg
A0A667IM83_BBC3-01      ccg----ccgcccccgccctgctgcccgccgcctacctc-------tgcg
H0XQ00_BBC3-01          ctg----ccgccccggctctgctgcccgccgcctacctc-------tgcg
A0A2K6KS56_BBC3-01      cgc----tgcccccgccctgctcgcccgcctgccacctc-------tgcg
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      ccg----ccgcccccgccctgctacccgctgcctacctc-------tgcg
A0A2K6FQZ1_BBC3-02      ccg----ccgcccccgccctgctacccgctgcctacctc-------tgcg
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      ccg----ccgcccccgccctgctgcccgctgcctacctc-------tgcg
A0A2I3HWI8_BBC3-03      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          ccg----ccgcccccaccctgctgcccgctgcctacctc-------tgcg
B4DQK3_BBC3-01          ccg----ccgcccccaccctgctgcccgctgcctacctc-------tgcg
Q9BXH1_BBC3-06          ccg----ccgcccccaccctgctgcccgctgcctacctc-------tgcg
H2NZD3_BBC3-01          ccg----ccgcccccgccctgctgcccgctgcctacctc-------tgcg
H2NZD3_BBC3-02          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      ccg----ccgcccccaccctgctgcccgctgcctacctc-------tgcg
A0A2I3RGH5_BBC3-01      ccg----ccgcccccaccctgctgcccgctgcctacctc-------tgcg
A0A2I3RGH5_BBC3-02      ccg----ccgcccccaccctgctgcccgctgcctacctc-------tgcg
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      ccg----ccgcccccgccctgctgcccgctgcctacctc-------tgcg
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------cttcttc-------tgcg
A0A2K5V8L0_BBC3-01      --------------------------------cttcttc-------tgcg
A0A2K6ASP2_BBC3-01      --------------------------------cttcttc-------tgcg
A0A2K6ASP2_BBC3-03      --------------------------------cttcttc-------tgcg
A0A2K6QZT2_BBC3-03      --------------------------------cttcttc-------tgcg
A0A2K6QZT2_BBC3-04      --------------------------------cttcttc-------tgcg
A0A2K6QZT2_BBC3-01      ccg----ctgcccccgccctgctgcccgctgcctacctc-------tgcg
A0A2K6QZT2_BBC3-02      ccg----ctgcccccgccctgctgcccgctgcctacctc-------tgcg
A0A0D9S2H2_BBC3-01      ccg----ccgcccccgccctgctgcccgctgcctacctc-------tgcg
A0A2I3N2Z9_BBC3-01      ccg----ccgcccccgccctgctgcccgctgcctacctc-------tgcg
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      ctg----ccgcccccgccttgctgcccgctgcctacctc-------tgcg
A0A2K5QNS7_BBC3-02      --------------------------------------------------
                                                                          

A0A4X2LVY2_BBC3-01      cgcctacttctgcactcgacagccccgttcctatgggggcccccgctggg
A0A4X2LVY2_BBC3-02      cgcctacttctgcactcgacagccccgttcctatgggggcccccgctggg
G3T2N1_BBC3-01          tcccagcccctctccagtctgggtctctgatctctcgggactgcagttgg
F7GL32_BBC3-01          cgcttacttctgcacgcgacagccccgtgcctatgggggcccccgctggg
F7GL32_BBC3-02          cgcttacttctgcacgcgacagccccgtgcctatgggggcccccgctggg
A0A5F9DGT6_BBC3-01      ---------cggcctccagccacagcggtttcccagcgcccctcccccgg
Q80ZG6_BBC3-01          cccccaccgccccgcctgccgtcaccgccgccctggggggcccccgctgg
B2RVL4_BBC3-01          cccccaccgctccacctgccgtcaccgccgccctggggggcccccgctgg
Q99ML1_BBC3-01          cccccaccgctccacctgccgtcaccgccgccctggggggcccccgctgg
Q99ML1_BBC3-02          cccccaccgctccacctgccgtcaccgccgccctggggggcccccgctgg
Q99ML1_BBC3-03          cccccaccgctccacctgccgtcaccgccgccctggggggcccccgctgg
M3Y0R3_BBC3-01          gcagctgtttcccagcccccacctcccccagtctgggtctccttaacctc
A0A673UKJ9_BBC3-02      --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      cccccacagccccgcccaccgtcacctccaccctggggggcccccgctgg
A0A671F3X5_BBC3-02      --------------------------------------------------
A0A673UKJ9_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-01      ---------cacagactgc---------------ggggcggctcagaagg
A0A7N5KJL4_BBC3-02      -------------gcctgc---------------agg-----------gg
A0A2Y9PEE3_BBC3-01      cccccaccgccccgcccgccgtcacagccgccctgggggccccccgctgg
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      cccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctgg
A0A4X1VVX9_BBC3-02      ccaccgcc------cccgccgtcaccgccgccctggggggcccccgctgg
A0A480SCP6_BBC3-02      cccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctgg
A0A480SCP6_BBC3-03      cccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctgg
A0A4W2EKD9_BBC3-01      ------------------------------ccccctgggtcccccaccag
A0A4W2EKD9_BBC3-01      ------------------------------ccccctgggtcccccaccag
A0A4W2EKD9_BBC3-02      cccccaccgccccgcccgccgtcaccgccgccctgggggccccccgctgg
A0A3Q1LXZ6_BBC3-01      cccccaccgccccgcccgccgtcaccgccgccctgggggccccccgctgg
A0A4W2EKD9_BBC3-02      cccccaccgccccgcccgccgtcaccgccgccctgggggccccccgctgg
A0A452E3G1_BBC3-01      cccccaccgccccgcccgccgtcactgccgccctgggggccccccgctgg
A0A5F5PGZ4_BBC3-01      cccccgccgccccgcccgccgtcaccgccgccctggggggcccccgctgg
A0A5F5PGZ4_BBC3-02      --------------------------------------------------
A0A337SJI7_BBC3-01      cccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctgg
A0A667IM83_BBC3-01      cccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctgg
H0XQ00_BBC3-01          cccccaccgccccgcccgccgtcactgccaccctagggggcccccgctgg
A0A2K6KS56_BBC3-01      cccccaccgcccacgccgtcccgcgccgcccctggggcgctggcc-----
A0A2K6KS56_BBC3-02      ---------------------------------------ctggc------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      cccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctgg
A0A2K6FQZ1_BBC3-02      cccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctgg
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      cccccaccgctccacccgccgtcaccgccgccctggggggcccccgctgg
A0A2I3HWI8_BBC3-03      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          cccccaccgccccacccgccgtcaccgccgccctggggggttcccgctgg
B4DQK3_BBC3-01          cccccaccgccccacccgccgtcaccgccgccctggggggttcccgctgg
Q9BXH1_BBC3-06          cccccaccgccccacccgccgtcaccgccgccctggggggttcccgctgg
H2NZD3_BBC3-01          cccccaccgccccacccgccgtcaccgccgccctggggggcccccgctgg
H2NZD3_BBC3-02          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      cccccaccgccccacccgccgtcaccgccgccctggggggtccccgctgg
A0A2I3RGH5_BBC3-01      cccccaccgccccacccgccgtcaccgccgccctggggggtccccgctgg
A0A2I3RGH5_BBC3-02      cccccaccgccccacccgccgtcaccgccgccctggggggtccccgctgg
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      cccccaccgccccacccgccgtcaccgccgccctggggggcccccgctgg
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-02      ac--------------------------------gtgggtcccctgccag
A0A2K5V8L0_BBC3-01      ac--------------------------------gtgggtcccctgccag
A0A2K6ASP2_BBC3-01      ac--------------------------------gtgggtcccctgccag
A0A2K6ASP2_BBC3-03      ac--------------------------------gtgggtcccctgccag
A0A2K6QZT2_BBC3-03      ac--------------------------------gtgggtcccctgccag
A0A2K6QZT2_BBC3-04      ac--------------------------------gtgggtcccctgccag
A0A2K6QZT2_BBC3-01      cccccaccgccccacccgccgtcaccgccgccctggggggcccccgctgg
A0A2K6QZT2_BBC3-02      cccccaccgccccacccgccgtcaccgccgccctggggggcccccgctgg
A0A0D9S2H2_BBC3-01      cccccaccgccccacccgccgtcaccgccgccctggggggcccccgctgg
A0A2I3N2Z9_BBC3-01      cccccaccgccccacccgccgtcaccgccgccctggggggcccccgctgg
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      --------------------------gccgcctgcgatgtttcccctccc
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      cccccgccaccccacccgccgtcaccgccgccctggggagcccccgctgg
A0A2K5QNS7_BBC3-02      --------------------------------------------------
                                                                          

A0A4X2LVY2_BBC3-01      cccggg--------------------------------------------
A0A4X2LVY2_BBC3-02      cccggg--------------------------------------------
G3T2N1_BBC3-01          agagag--------------------------------------------
F7GL32_BBC3-01          cacggg--------------------------------------------
F7GL32_BBC3-02          cacggg--------------------------------------------
A0A5F9DGT6_BBC3-01      cctggg--------------------------------------------
Q80ZG6_BBC3-01          cctggg--------------------------------------------
B2RVL4_BBC3-01          cctggg--------------------------------------------
Q99ML1_BBC3-01          cctggg--------------------------------------------
Q99ML1_BBC3-02          cctggg--------------------------------------------
Q99ML1_BBC3-03          cctggg--------------------------------------------
M3Y0R3_BBC3-01          ccagaggacgatagttgga-------------------------------
A0A673UKJ9_BBC3-02      --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      cctggg--------------------------------------------
A0A671F3X5_BBC3-02      --------------------------------------------------
A0A673UKJ9_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-01      gggtgg--------------------------------------------
A0A7N5KJL4_BBC3-02      tggtgg--------------------------------------------
A0A2Y9PEE3_BBC3-01      cctggg--------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      cctggg--------------------------------------------
A0A4X1VVX9_BBC3-02      cctggg--------------------------------------------
A0A480SCP6_BBC3-02      cctggg--------------------------------------------
A0A480SCP6_BBC3-03      cctggg--------------------------------------------
A0A4W2EKD9_BBC3-01      attcg---------------------------------------------
A0A4W2EKD9_BBC3-01      attcg---------------------------------------------
A0A4W2EKD9_BBC3-02      cctggg--------------------------------------------
A0A3Q1LXZ6_BBC3-01      cctggg--------------------------------------------
A0A4W2EKD9_BBC3-02      cctggg--------------------------------------------
A0A452E3G1_BBC3-01      cctggg--------------------------------------------
A0A5F5PGZ4_BBC3-01      cctggg--------------------------------------------
A0A5F5PGZ4_BBC3-02      --------------------------------------------------
A0A337SJI7_BBC3-01      cctggg--------------------------------------------
A0A667IM83_BBC3-01      cctggg--------------------------------------------
H0XQ00_BBC3-01          cctggg--------------------------------------------
A0A2K6KS56_BBC3-01      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      cctggg--------------------------------------------
A0A2K6FQZ1_BBC3-02      cctggg--------------------------------------------
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      cccggg--------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
Q9BXH1_BBC3-04          --cgtg--------------------------------------------
Q9BXH1_BBC3-05          --cgtg--------------------------------------------
Q9BXH1_BBC3-03          cctggg--------------------------------------------
B4DQK3_BBC3-01          cctggg--------------------------------------------
Q9BXH1_BBC3-06          cctggg--------------------------------------------
H2NZD3_BBC3-01          ccgggg--------------------------------------------
H2NZD3_BBC3-02          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      cctggg--------------------------------------------
A0A2I3RGH5_BBC3-01      cctggg--------------------------------------------
A0A2I3RGH5_BBC3-02      cctggg--------------------------------------------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      cctggg--------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-02      atttgt--------------------------------------------
A0A2K5V8L0_BBC3-01      atttgt--------------------------------------------
A0A2K6ASP2_BBC3-01      atttgtggccccagggagcgccatggcccgcgcacgccaggagggcagct
A0A2K6ASP2_BBC3-03      atttgt--------------------------------------------
A0A2K6QZT2_BBC3-03      atttg---------------------------------------------
A0A2K6QZT2_BBC3-04      atttg---------------------------------------------
A0A2K6QZT2_BBC3-01      cctggg--------------------------------------------
A0A2K6QZT2_BBC3-02      cctggg--------------------------------------------
A0A0D9S2H2_BBC3-01      cctggg--------------------------------------------
A0A2I3N2Z9_BBC3-01      cctggg--------------------------------------------
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      gccgcc--------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      cctggg--------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
                                                                          

A0A4X2LVY2_BBC3-01      --------------------------------------------------
A0A4X2LVY2_BBC3-02      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
F7GL32_BBC3-01          --------------------------------------------------
F7GL32_BBC3-02          --------------------------------------------------
A0A5F9DGT6_BBC3-01      --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
B2RVL4_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-03          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A673UKJ9_BBC3-02      --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      --------------------------------------------------
A0A671F3X5_BBC3-02      --------------------------------------------------
A0A673UKJ9_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A2Y9PEE3_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      --------------------------------------------------
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A5F5PGZ4_BBC3-01      --------------------------------------------------
A0A5F5PGZ4_BBC3-02      --------------------------------------------------
A0A337SJI7_BBC3-01      --------------------------------------------------
A0A667IM83_BBC3-01      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6KS56_BBC3-01      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
H2NZD3_BBC3-02          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K5V8L0_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-01      ccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccg
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
                                                                          

A0A4X2LVY2_BBC3-01      --------------------------------------------------
A0A4X2LVY2_BBC3-02      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
F7GL32_BBC3-01          --------------------------------------------------
F7GL32_BBC3-02          --------------------------------------------------
A0A5F9DGT6_BBC3-01      --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
B2RVL4_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-03          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A673UKJ9_BBC3-02      --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      --------------------------------------------------
A0A671F3X5_BBC3-02      --------------------------------------------------
A0A673UKJ9_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A2Y9PEE3_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      --------------------------------------------------
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A5F5PGZ4_BBC3-01      --------------------------------------------------
A0A5F5PGZ4_BBC3-02      --------------------------------------------------
A0A337SJI7_BBC3-01      --------------------------------------------------
A0A667IM83_BBC3-01      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6KS56_BBC3-01      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
H2NZD3_BBC3-02          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K5V8L0_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-01      ctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccgg
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
                                                                          

A0A4X2LVY2_BBC3-01      --------------------------------------------------
A0A4X2LVY2_BBC3-02      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
F7GL32_BBC3-01          --------------------------------------------------
F7GL32_BBC3-02          --------------------------------------------------
A0A5F9DGT6_BBC3-01      --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
B2RVL4_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-03          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A673UKJ9_BBC3-02      --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      --------------------------------------------------
A0A671F3X5_BBC3-02      --------------------------------------------------
A0A673UKJ9_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A2Y9PEE3_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      --------------------------------------------------
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A5F5PGZ4_BBC3-01      --------------------------------------------------
A0A5F5PGZ4_BBC3-02      --------------------------------------------------
A0A337SJI7_BBC3-01      --------------------------------------------------
A0A667IM83_BBC3-01      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6KS56_BBC3-01      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
H2NZD3_BBC3-02          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K5V8L0_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-01      cctggctgccgcccccgccgcccccgccctgctgcccgctgcctacctct
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
                                                                          

A0A4X2LVY2_BBC3-01      --------------------------------------------------
A0A4X2LVY2_BBC3-02      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
F7GL32_BBC3-01          --------------------------------------------------
F7GL32_BBC3-02          --------------------------------------------------
A0A5F9DGT6_BBC3-01      --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
B2RVL4_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-03          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A673UKJ9_BBC3-02      --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      --------------------------------------------------
A0A671F3X5_BBC3-02      --------------------------------------------------
A0A673UKJ9_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A2Y9PEE3_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      --------------------------------------------------
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A5F5PGZ4_BBC3-01      --------------------------------------------------
A0A5F5PGZ4_BBC3-02      --------------------------------------------------
A0A337SJI7_BBC3-01      --------------------------------------------------
A0A667IM83_BBC3-01      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6KS56_BBC3-01      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
H2NZD3_BBC3-02          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K5V8L0_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-01      gcgcccccaccgccccacccgccgtcaccgccaccctggggggcccccgc
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      --------------------------------------------------
A0A2K5QNS7_BBC3-02      --------------------------------------------------
                                                                          

A0A4X2LVY2_BBC3-01      ---------tggccaggagcccagcccccagcagccagggccagagtg--
A0A4X2LVY2_BBC3-02      ---------tggccaggagcccagcccccagcagccagggccagagtg--
G3T2N1_BBC3-01          ------gtggggccgagtgggaggacagggcccctcgtcctctctcag--
F7GL32_BBC3-01          --cggccaggagcccggcggccggcaaccagggc-------caaagcg--
F7GL32_BBC3-02          --cggccaggagcccggcggccggcaaccagggc-------caaagcg--
A0A5F9DGT6_BBC3-01      -----------------------cccccgcgaccc---------------
Q80ZG6_BBC3-01          ---------ggtcaccgcagccggccccgaggcccgcgc--ccggacg--
B2RVL4_BBC3-01          ---------ggtcaccgcagccggcccagaggcccgcgc--ccggacg--
Q99ML1_BBC3-01          ---------ggtcaccgcagccggcccagaggcccgcgc--ccggacg--
Q99ML1_BBC3-02          ---------ggtcaccgcagccggcccagaggcccgcgc--ccggacg--
Q99ML1_BBC3-03          ---------ggtcaccgcagccggcccagaggcccgcgc--ccggacg--
M3Y0R3_BBC3-01          ---------gggagtgtgggcagagcgagaggactgcttttcccag----
A0A673UKJ9_BBC3-02      --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      ---------ggtccccgcagccggccccgaggcccgcgc--cccgacg--
A0A671F3X5_BBC3-02      -----------------------------------------------g--
A0A673UKJ9_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-01      ---------ggcagga--aggcatctcccgaatcccagc--cccccag--
A0A7N5KJL4_BBC3-02      ---------gtgctgaccacgcgccccctcccccccggcttttcccag--
A0A2Y9PEE3_BBC3-01      ---------ggtcctcgcagccggccccgaggcccgcgc--cccgacg--
A0A480SCP6_BBC3-01      -----------------------------agattc----------atg--
A0A4X1VVX9_BBC3-01      -----------------------------agattc----------atg--
A0A480SCP6_BBC3-04      ---------ggtccccgcagccggccccgaggcccgcgc--cccgacg--
A0A4X1VVX9_BBC3-02      ---------ggtccccgcagccggccccgaggcccgcgc--cccgacg--
A0A480SCP6_BBC3-02      ---------ggtccccgcagccggccccgaggcccgcgc--cccgacg--
A0A480SCP6_BBC3-03      ---------ggtccccgcagccggccccgaggcccgcgc--cccgacg--
A0A4W2EKD9_BBC3-01      ----------------------------------------------tg--
A0A4W2EKD9_BBC3-01      ----------------------------------------------tg--
A0A4W2EKD9_BBC3-02      ---------ggtccccgcagccggccccgaggcccgcga--cccgacg--
A0A3Q1LXZ6_BBC3-01      ---------ggtccccgcagccggccccgaggcccgcga--cccgacg--
A0A4W2EKD9_BBC3-02      ---------ggtccccgcagccggccccgaggcccgcga--cccgacg--
A0A452E3G1_BBC3-01      ---------ggtccccgcagccggccccgaggcccgcga--cccgacg--
A0A5F5PGZ4_BBC3-01      ---------ggcccccgcagccgtccccgagccccgcgc--cccgacg--
A0A5F5PGZ4_BBC3-02      -----------------------------------------------g--
A0A337SJI7_BBC3-01      ---------ggtccccgcagccggccccgagggccgcgc--cccgacg--
A0A667IM83_BBC3-01      ---------ggtccccgcagccggccccgaggtccgcgc--cccgacg--
H0XQ00_BBC3-01          ---------ggtccccgcagccggccccgaggcccgcgc--ctggatg--
A0A2K6KS56_BBC3-01      ---------tggtcccgcagccgccccgggcccacgccc--ggaggtg--
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      -----------------------------------------------g--
A0A2K6FQZ1_BBC3-01      ---------ggtccccgcagccgaccccgaggcccgcgc--ccggacg--
A0A2K6FQZ1_BBC3-02      ---------ggtccccgcagccgaccccgaggcccgcgc--ccggacg--
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      ---------ggtcctcgcagccggccccgaggcccgcgc--ccggacg--
A0A2I3HWI8_BBC3-03      -----------------------------------------------g--
Q9BXH1_BBC3-04          ---------ggtcccct--gccagatttg---------------------
Q9BXH1_BBC3-05          ---------ggtcccct--gccagatttg-----------------tg--
Q9BXH1_BBC3-03          ---------ggtccccgcagccggccccgaggcccgcgc--ccggacg--
B4DQK3_BBC3-01          ---------ggtccccgcagccggccccgaggcccgcgc--ccggacg--
Q9BXH1_BBC3-06          ---------ggtccccgcagccggccccgaggcccgcgc--ccggacg--
H2NZD3_BBC3-01          ---------ggtccccgcagccggccccgaggcccgcgc--ccggacg--
H2NZD3_BBC3-02          -----------------------------------------------g--
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      ---------ggtccccgcagccggccccgaggcccgcgc--ccggacggg
A0A2I3RGH5_BBC3-01      ---------ggtccccgcagccggccccgaggcccgcgc--ccggacg--
A0A2I3RGH5_BBC3-02      ---------ggtccccgcagccggccccgaggcccgcgc--ccggacg--
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      ---------ggtccccgcagccggccccgaggcccacgc--ccggacg--
A0A2K5P2T8_BBC3-03      -----------------------------------------------g--
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K5V8L0_BBC3-01      -----------------------------------------------g--
A0A2K6ASP2_BBC3-01      tggcctgggggtccccgcagccggccccgaggcccacgc--ccggacg--
A0A2K6ASP2_BBC3-03      -----------------------------------------------g--
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      ----------------------------------------------tg--
A0A2K6QZT2_BBC3-01      ---------ggtccccgcagccggccccgaggcccacgc--ccggacg--
A0A2K6QZT2_BBC3-02      ---------ggtccccgcagccggccccgaggcccacgc--ccggacg--
A0A0D9S2H2_BBC3-01      ---------ggtccccgcagccggccccgaggcccacgc--ccggacg--
A0A2I3N2Z9_BBC3-01      ---------ggtccccgcagccggccccgaggcccacgc--ccggacg--
A0A2I3N2Z9_BBC3-02      -----------------------------------------------g--
A0A2K6STD6_BBC3-02      -----------------------------------------------g--
A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      ---------acccgccgcaccgccgcctggccccgtggc--ctgggtg--
A0A2K5F6X4_BBC3-02      -----------------------------------------------g--
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      ---------ggcccccgcagccgcccccgaggcccgcgc--ccggacg--
A0A2K5QNS7_BBC3-02      -----------------------------------------------g--
                                                                          

A0A4X2LVY2_BBC3-01      -------------------------gctcccagccctcgttgggtgaaag
A0A4X2LVY2_BBC3-02      -------------------------gctcccagccctcgttgggtgaaag
G3T2N1_BBC3-01          -------------------------gtcctcagccctcact---------
F7GL32_BBC3-01          -------------------------gttccctgccctccctgggccccag
F7GL32_BBC3-02          -------------------------gttccctgccctccctgggccccag
A0A5F9DGT6_BBC3-01      ---------------------------ccacggggctcgca---------
Q80ZG6_BBC3-01          -------------------------gtcctcagccctcgct---------
B2RVL4_BBC3-01          -------------------------gtcctcagccctccct---------
Q99ML1_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-02          -------------------------gtcctcagccctccct---------
Q99ML1_BBC3-03          -------------------------gtcctcagccctccct---------
M3Y0R3_BBC3-01          -------------------------gtcctcagccctcact---------
A0A673UKJ9_BBC3-02      --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      -------------------------gtcctcagccctcact---------
A0A671F3X5_BBC3-02      -------------------------gtcctcagccctcact---------
A0A673UKJ9_BBC3-01      -------------------------gtcctcagccctcact---------
A0A7N5KJL4_BBC3-01      -------------------------gtcctcagccctcact---------
A0A7N5KJL4_BBC3-02      -------------------------gtcctcagccctcact---------
A0A2Y9PEE3_BBC3-01      -------------------------gtccacagccctcact---------
A0A480SCP6_BBC3-01      -------------------------gtcctcagccctcact---------
A0A4X1VVX9_BBC3-01      -------------------------gtcctcagccctcact---------
A0A480SCP6_BBC3-04      -------------------------gtcctcagccctcact---------
A0A4X1VVX9_BBC3-02      -------------------------gtcctcagccctcact---------
A0A480SCP6_BBC3-02      -------------------------gtcctcagccctcact---------
A0A480SCP6_BBC3-03      -------------------------gtcctcagccctcact---------
A0A4W2EKD9_BBC3-01      -------------------------gtcctcagccttcact---------
A0A4W2EKD9_BBC3-01      -------------------------gtcctcagccttcact---------
A0A4W2EKD9_BBC3-02      -------------------------gtcctcagccttcact---------
A0A3Q1LXZ6_BBC3-01      -------------------------gtcctcagccttcact---------
A0A4W2EKD9_BBC3-02      -------------------------gtcctcagccttcact---------
A0A452E3G1_BBC3-01      -------------------------gtcctcagccttcact---------
A0A5F5PGZ4_BBC3-01      -------------------------gtccacagccctcact---------
A0A5F5PGZ4_BBC3-02      -------------------------gtccacagccctcact---------
A0A337SJI7_BBC3-01      -------------------------gtcctcagccctcact---------
A0A667IM83_BBC3-01      -------------------------gtcctcagccctcact---------
H0XQ00_BBC3-01          -------------------------gtcctcagccatcact---------
A0A2K6KS56_BBC3-01      ------------------agtgcccgcccgccccccgggtt---------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      -------------------------gtcctcagccatcact---------
A0A2K6FQZ1_BBC3-01      -------------------------gtcctcagccatcact---------
A0A2K6FQZ1_BBC3-02      -------------------------gtcctcagccatcact---------
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          -------------------------gtcctcagccctcgct---------
Q9BXH1_BBC3-03          -------------------------gtcctcagccctcgct---------
B4DQK3_BBC3-01          -------------------------gtcctcagccctcgct---------
Q9BXH1_BBC3-06          -------------------------gtcctcagccctcgct---------
H2NZD3_BBC3-01          -------------------------gtcctcagccctcgct---------
H2NZD3_BBC3-02          -------------------------gtcctcagccctcgct---------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R9BZA9_BBC3-01      -------------------------gtcctcagccctcgct---------
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      -------------------------gtcctcagccctcgct---------
A0A2I3RGH5_BBC3-04      ctggagactcggaggaactggagaagtcctcagccctcgct---------
A0A2I3RGH5_BBC3-01      -------------------------gtcctcagccctcgct---------
A0A2I3RGH5_BBC3-02      -------------------------gtcctcagccctcgct---------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      -------------------------gtcctcagccctcgct---------
A0A2K5P2T8_BBC3-03      -------------------------gtcctcagccctcgct---------
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K5V8L0_BBC3-01      -------------------------gtcctcagccctcgct---------
A0A2K6ASP2_BBC3-01      -------------------------gtcctcagccctcgct---------
A0A2K6ASP2_BBC3-03      -------------------------gtcctcagccctcgct---------
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      -------------------------gtcctcagccctcgct---------
A0A2K6QZT2_BBC3-01      -------------------------gtcctcagccctcgct---------
A0A2K6QZT2_BBC3-02      -------------------------gtcctcagccctcgct---------
A0A0D9S2H2_BBC3-01      -------------------------gtcctcagccctcgct---------
A0A2I3N2Z9_BBC3-01      -------------------------gtcctcagccctcgct---------
A0A2I3N2Z9_BBC3-02      -------------------------gtcctcagccctcgct---------
A0A2K6STD6_BBC3-02      -------------------------gttctcagccctcgct---------
A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      -------------------------ggtccccgcagccgcc---------
A0A2K5F6X4_BBC3-02      -------------------------gtcctcagccctcgct---------
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      -------------------------gtcctcagccctcgct---------
A0A2K5QNS7_BBC3-02      -------------------------gtcctcagccctcgct---------
                                                                          

A0A4X2LVY2_BBC3-01      gtctgcagaggaccaggaggagggaggacaggaggtag------------
A0A4X2LVY2_BBC3-02      gtctgcagaggaccaggaggagggaggacaggaggtag------------
G3T2N1_BBC3-01          ---ctcg------ccggcggag-cagcacctggagtcg-ccggtg-----
F7GL32_BBC3-01          gtctgcc------caggaggaggggggacaggagggag------------
F7GL32_BBC3-02          gtctgcc------caggaggaggggggacaggagggag------------
A0A5F9DGT6_BBC3-01      ---gttg------gaaggagggccagtcactggagtcgtcccgtgcccag
Q80ZG6_BBC3-01          ---gtca------ccagcccag-cagcacctagagtcg-cccgtgcccag
B2RVL4_BBC3-01          ---gtca------ccagcccag-cagcacttagagtcg-cccgtgcccag
Q99ML1_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-02          ---gtca------ccagcccag-cagcacttagagtcg-cccgtgcccag
Q99ML1_BBC3-03          ---gtca------ccagcccag-cagcacttagagtcg-cccgtgcccag
M3Y0R3_BBC3-01          ---ctcg------ccggcggag-ccgcacctggaatcg-ccggtgcccag
A0A673UKJ9_BBC3-02      --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      ---ctca------cccgcggag-cagcacctggaatcg-ccggtgcccag
A0A671F3X5_BBC3-02      ---ctca------cccgcggag-cagcacctggaatcg-ccggtgcccag
A0A673UKJ9_BBC3-01      ---ctcg------ccggcggag-ccacacctggaatcg-ccggtgcccag
A0A7N5KJL4_BBC3-01      ---ctcg------ccggcagag-cagcacctggaatcg-ccggtgcccag
A0A7N5KJL4_BBC3-02      ---ctcg------ccggcagag-cagcacctggaatcg-ccggtgcccag
A0A2Y9PEE3_BBC3-01      ---ctcg------cccgcggag-cagcacctggaatcg-ctagtgcccag
A0A480SCP6_BBC3-01      ---ctcg------ccggcggag-cagcacctggaatcg-ccagtgcccag
A0A4X1VVX9_BBC3-01      ---ctcg------ccggcggag-cagcacctggaatcg-ccagtgcccag
A0A480SCP6_BBC3-04      ---ctcg------ccggcggag-cagcacctggaatcg-ccagtgcccag
A0A4X1VVX9_BBC3-02      ---ctcg------ccggcggag-cagcacctggaatcg-ccagtgcccag
A0A480SCP6_BBC3-02      ---ctcg------ccggcggag-cagcacctggaatcg-ccagtgcccag
A0A480SCP6_BBC3-03      ---ctcg------ccggcggag-cagcacctggaatcg-ccagtgcccag
A0A4W2EKD9_BBC3-01      ---ctcg------cccgcggag-cagcacctggaatca-ccagtgcccag
A0A4W2EKD9_BBC3-01      ---ctcg------cccgcggag-cagcacctggaatca-ccagtgcccag
A0A4W2EKD9_BBC3-02      ---ctcg------cccgcggag-cagcacctggaatca-ccagtgcccag
A0A3Q1LXZ6_BBC3-01      ---ctcg------cccgcggag-cagcacctggaatca-ccagtgcccag
A0A4W2EKD9_BBC3-02      ---ctcg------cccgcggag-cagcacctggaatca-ccagtgcccag
A0A452E3G1_BBC3-01      ---ctcg------cccgcggag-cagcacctggaatcg-ccagtgcccag
A0A5F5PGZ4_BBC3-01      ---cttg------ccggccgag-cagcacctggagtcg-ccggtgcccag
A0A5F5PGZ4_BBC3-02      ---cttg------ccggccgag-cagcacctggagtcg-ccggtgcccag
A0A337SJI7_BBC3-01      ---ctcg------ccggcagag-cagcacctggaatcg-ccggtgcccag
A0A667IM83_BBC3-01      ---ctcg------ccggcagag-cagcacctggaatcg-ccggtgcccag
H0XQ00_BBC3-01          ---cttg------ccggccgag-cagcacctggagtcg-cccgttcccag
A0A2K6KS56_BBC3-01      ---gata------ggagtcggg-c-gcacctggagtcg--cggtgc----
A0A2K6KS56_BBC3-02      ------------------ggag-c-gcacctggagtcg--cggtgc----
A0A2K6FQZ1_BBC3-04      ---ctcg------ctggcagag-cagcacctggagtcg-cccgtccccag
A0A2K6FQZ1_BBC3-01      ---ctcg------ctggcagag-cagcacctggagtcg-cccgtccccag
A0A2K6FQZ1_BBC3-02      ---ctcg------ctggcagag-cagcacctggagtcg-cccgtccccag
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          ---ctcg------ctggcggag-cagcacctggagtcg-cccgtgcccag
Q9BXH1_BBC3-03          ---ctcg------ctggcggag-cagcacctggagtcg-cccgtgcccag
B4DQK3_BBC3-01          ---ctcg------ctggcggag-cagcacctggagtcg-cccgtgcccag
Q9BXH1_BBC3-06          ---ctcg------ctggcggag-cagcacctggagtcg-cccgtgcccag
H2NZD3_BBC3-01          ---ctcg------ctggcggag-cagcacctggagtcg-cccgtgcccag
H2NZD3_BBC3-02          ---ctcg------ctggcggag-cagcacctggagtcg-cccgtgcccag
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R9BZA9_BBC3-01      ---ctcg------ctggcggag-cagcacctggagtcg-cccgtgcccag
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      ---ctcg------ctggcggag-cagcacctggagtcg-cccgtgcccag
A0A2I3RGH5_BBC3-04      ---ctcg------ctggcggag-cagcacctggagtcg-cccgtgcccag
A0A2I3RGH5_BBC3-01      ---ctcg------ctggcggag-cagcacctggagtcg-cccgtgcccag
A0A2I3RGH5_BBC3-02      ---ctcg------ctggcggag-cagcacctggagtcg-cccgtgcccag
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      ---cttg------ctggcggag-cagcacctggagtcg-cccgtgcccag
A0A2K5P2T8_BBC3-03      ---cttg------ctggcggag-cagcacctggagtcg-cccgtgcccag
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K5V8L0_BBC3-01      ---cttg------ctggcggag-cagcacctggagtcg-cccgtgcccag
A0A2K6ASP2_BBC3-01      ---cttg------ctggcggag-cagcacctggagtcg-cccgtgcccag
A0A2K6ASP2_BBC3-03      ---cttg------ctggcggag-cagcacctggagtcg-cccgtgcccag
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      ---ctcg------ctggcggag-cagcacctggagtcg-ccggtgcccag
A0A2K6QZT2_BBC3-01      ---ctcg------ctggcggag-cagcacctggagtcg-ccggtgcccag
A0A2K6QZT2_BBC3-02      ---ctcg------ctggcggag-cagcacctggagtcg-ccggtgcccag
A0A0D9S2H2_BBC3-01      ---ttcg------ctggcggag-cagcacctggagtcg-cccgtgcccag
A0A2I3N2Z9_BBC3-01      ---cttg------ctggcggag-cagcacctggagtcg-cccgtgcccag
A0A2I3N2Z9_BBC3-02      ---cttg------ctggcggag-cagcacctggagtcg-cccgtgcccag
A0A2K6STD6_BBC3-02      ---ctcg------ctggcggag-cagcacctggagtcg-cccgtgcccag
A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      ---cccg------aggcccgcg-cccggacgagagggc-ccggaggctcg
A0A2K5F6X4_BBC3-02      ---ctcg------ctggcggag-cagcacctggagtcg-cccgtgcccag
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      ---ctcg------ctggcggag-cagcacctggagtcg-cccgtgcccag
A0A2K5QNS7_BBC3-02      ---ctcg------ctggcggag-cagcacctggagtcg-cccgtgcccag
                                                                          

A0A4X2LVY2_BBC3-01      -------------aaccccagggagcatccccgatgtctggtggcccccc
A0A4X2LVY2_BBC3-02      -------------aaccccagggagcatccccgatgtctggtggcccccc
G3T2N1_BBC3-01          ---------------------------------------------cccac
F7GL32_BBC3-01          -------------agccccagggagcgtcccccatgtctggcggcccccc
F7GL32_BBC3-02          -------------agccccagggagcgtcccccatgtctggcggcccccc
A0A5F9DGT6_BBC3-01      -------------cgccccggggg------cccctggagggggtccccac
Q80ZG6_BBC3-01          -------------cgccccggagg-------ccctggcgggaggccccac
B2RVL4_BBC3-01          -------------cgccccggagg-------ccctggcaggaggccccac
Q99ML1_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-02          -------------cgccccggagg-------ccctggcaggaggccccac
Q99ML1_BBC3-03          -------------cgccccggagg-------ccctggcaggaggccccac
M3Y0R3_BBC3-01          -------------tgccccggggg-------ccctggcgggcggccccac
A0A673UKJ9_BBC3-02      --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      -------------cgccccgggtg-------ccctggcgggcggccccac
A0A671F3X5_BBC3-02      -------------cgccccgggtg-------ccctggcgggcggccccac
A0A673UKJ9_BBC3-01      -------------cgccccggggg-------ccctggcgggcggccccac
A0A7N5KJL4_BBC3-01      -------------tgccccggggg-------ccctggcgggaggccccac
A0A7N5KJL4_BBC3-02      -------------tgccccggggg-------ccctggcgggaggccccac
A0A2Y9PEE3_BBC3-01      -------------cgccccggggg-------ccctggcgggcggccccac
A0A480SCP6_BBC3-01      -------------cgctccggggg-------ccctggcgggcggccccac
A0A4X1VVX9_BBC3-01      -------------cgctccggggg-------ccctggcgggcggccccac
A0A480SCP6_BBC3-04      -------------cgctccggggg-------ccctggcgggcggccccac
A0A4X1VVX9_BBC3-02      -------------cgctccggggg-------ccctggcgggcggccccac
A0A480SCP6_BBC3-02      -------------cgctccggggg-------ccctggcgggcggccccac
A0A480SCP6_BBC3-03      -------------cgctccggggg-------ccctggcgggcggccccac
A0A4W2EKD9_BBC3-01      -------------cgccccggggg-------ccctggcgggcggccccac
A0A4W2EKD9_BBC3-01      -------------cgccccggggg-------ccctggcgggcggccccac
A0A4W2EKD9_BBC3-02      -------------cgccccggggg-------ccctggcgggcggccccac
A0A3Q1LXZ6_BBC3-01      -------------cgccccggggg-------ccctggcgggcggccccac
A0A4W2EKD9_BBC3-02      -------------cgccccggggg-------ccctggcgggcggccccac
A0A452E3G1_BBC3-01      -------------cgccccggggg-------ccctggcgggcggacccac
A0A5F5PGZ4_BBC3-01      -------------cgccccggggg-------ccctggagggcggccccac
A0A5F5PGZ4_BBC3-02      -------------cgccccggggg-------ccctggagggcggccccac
A0A337SJI7_BBC3-01      -------------cgccccggggg-------ccctggcgggcggccccac
A0A667IM83_BBC3-01      -------------cgccccggggg-------ccctggcgggcggccccac
H0XQ00_BBC3-01          -------------caccccggggg-------ccctggcgggcggtcccac
A0A2K6KS56_BBC3-01      -------------cagccccgggg-------ccctggcgggcggtcc--a
A0A2K6KS56_BBC3-02      -------------cagccccgggg-------ccct---------------
A0A2K6FQZ1_BBC3-04      -------------cgccccggggg-------ccctggcgggcggtcccac
A0A2K6FQZ1_BBC3-01      -------------cgccccggggg-------ccctggcgggcggtcccac
A0A2K6FQZ1_BBC3-02      -------------cgccccggggg-------ccctggcgggcggtcccac
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      -------------------------------------caggcggtcccac
A0A2I3HWI8_BBC3-03      -------------------------------------caggcggtcccac
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          -------------cgccccggggg-------ctctggcgggcggtcccac
Q9BXH1_BBC3-03          -------------cgccccggggg-------ctctggcgggcggtcccac
B4DQK3_BBC3-01          -------------cgccccggggg-------ctctggcgggcggtcccac
Q9BXH1_BBC3-06          -------------cgccccggggg-------ctctggcgggcggtcccac
H2NZD3_BBC3-01          -------------cgccccggggg-------ctctggcgggcggtcccac
H2NZD3_BBC3-02          -------------cgccccggggg-------ctctggcgggcggtcccac
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R9BZA9_BBC3-01      -------------cgccccggggg-------ctctggcgggcggtcccac
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      -------------cgccccggggg-------ctctggcgggcggtcccac
A0A2I3RGH5_BBC3-04      -------------cgccccggggg-------ctctggcgggcggtcccac
A0A2I3RGH5_BBC3-01      -------------cgccccggggg-------ctctggcgggcggtcccac
A0A2I3RGH5_BBC3-02      -------------cgccccggggg-------ctctggcgggcggtcccac
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      -------------cgccccggggg-------ccctggcgggcggtcccac
A0A2K5P2T8_BBC3-03      -------------cgccccggggg-------ccctggcgggcggtcccac
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K5V8L0_BBC3-01      -------------cgccccggggg-------ccctggcgggcggtcccac
A0A2K6ASP2_BBC3-01      -------------cgccccggggg-------ccctggcgggcggtcccac
A0A2K6ASP2_BBC3-03      -------------cgccccggggg-------ccctggcgggcggtcccac
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      -------------cgccccggggg-------ccctggcgggcggtcccac
A0A2K6QZT2_BBC3-01      -------------cgccccggggg-------ccctggcgggcggtcccac
A0A2K6QZT2_BBC3-02      -------------cgccccggggg-------ccctggcgggcggtcccac
A0A0D9S2H2_BBC3-01      -------------cgccccggggg-------ccctggcgggcggtcccac
A0A2I3N2Z9_BBC3-01      -------------cgccccggggg-------ccctggcgggcggtcccac
A0A2I3N2Z9_BBC3-02      -------------cgccccggggg-------ccctggcgggcggtcccac
A0A2K6STD6_BBC3-02      -------------cgccccggggg-------ccctggcgggcggtcccac
A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      gaggaactggagacgccccggggg-------ccctggcgggcggtcccac
A0A2K5F6X4_BBC3-02      -------------cgccccggggg-------ccctggcgggcggtcccac
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      -------------cgccccggggg-------ccctggcgggcggtcccac
A0A2K5QNS7_BBC3-02      -------------cgccccggggg-------ccctggcgggcggtcccac
                                                                          

A0A4X2LVY2_BBC3-01      aggggtgttaggcccagaccacgggggccaagcagagcagcaagaccggg
A0A4X2LVY2_BBC3-02      aggggtgttaggcccagaccacgggggccaagcagagcagcaagaccggg
G3T2N1_BBC3-01          gcaggcg---gccccgggggtccggggagaggatgagcaatgggcccgag
F7GL32_BBC3-01          gggggtgttaggcccggagcacggggaccaaggcgagcagcaggaccggg
F7GL32_BBC3-02          gggggtgttaggcccggagcacggggaccaaggcgagcagcaggaccggg
A0A5F9DGT6_BBC3-01      cccggcg---gccccgggagtctggggcgaggaggagcagtgggcccgag
Q80ZG6_BBC3-01          ccaagct---gccccgggagtgcgtgtggaggaggaggagtgggcccggg
B2RVL4_BBC3-01          ccaagct---gccccgggagtgcgtgtggaggaggaggagtgggcccggg
Q99ML1_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-02          ccaagct---gccccgggagtgcgtgtggaggaggaggagtgggcccggg
Q99ML1_BBC3-03          ccaagct---gccccgggagtgcgtgtgga--------------------
M3Y0R3_BBC3-01          ccaggca---gccccgggagtccggggggaggaggagcagtgggcccggg
A0A673UKJ9_BBC3-02      --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      ccacgca---gccccgggagtccggggggaggaggagcagtgggcccgag
A0A671F3X5_BBC3-02      ccacgca---gccccgggagtccggggggaggaggagcagtgggcccgag
A0A673UKJ9_BBC3-01      ccaggca---gccccgggaatccggggggaggaagagcagtgggcccggg
A0A7N5KJL4_BBC3-01      ccaggca---gccccgggagtccggggggaggaggagcagtgggcccggg
A0A7N5KJL4_BBC3-02      ccaggca---gccccgggagtccggggggaggaggagcagtgggcccggg
A0A2Y9PEE3_BBC3-01      ccaagcg---gccccgggagtccggggggaggaggagcagtgggcccgag
A0A480SCP6_BBC3-01      ccaagca---gccccgggaatccggggggaggaggagcagtgggcccgag
A0A4X1VVX9_BBC3-01      ccaagca---gccccgggaatccggggggaggaggagcagtgggcccgag
A0A480SCP6_BBC3-04      ccaagca---gccccgggaatccggggggaggaggagcagtgggcccgag
A0A4X1VVX9_BBC3-02      ccaagca---gccccgggaatccggggggaggaggagcagtgggcccgag
A0A480SCP6_BBC3-02      ccaagca---gccccgggaatccggggggaggaggagcagtgggcccgag
A0A480SCP6_BBC3-03      ccaagca---gccccgggaatccggggggaggaggagcagtgggcccgag
A0A4W2EKD9_BBC3-01      ccaagcg---gccccgggagtccggggggaggaggagcagtgggcccgag
A0A4W2EKD9_BBC3-01      ccaagcg---gccccgggagtccggggggaggaggagcagtgggcccgag
A0A4W2EKD9_BBC3-02      ccaagcg---gccccgggagtccggggggaggaggagcagtgggcccgag
A0A3Q1LXZ6_BBC3-01      ccaagcg---gccccgggagtccggggggaggaggagcagtgggcccgag
A0A4W2EKD9_BBC3-02      ccaagcg---gccccgggagtccggggggaggaggagcagtgggcccgag
A0A452E3G1_BBC3-01      ccaagcg---gccccgggagtccggggggaggaggagcagtgggcccgag
A0A5F5PGZ4_BBC3-01      ccaggca---gccccgggagtccggggggaggaggagcagtgggcccggg
A0A5F5PGZ4_BBC3-02      ccaggca---gccccgggagtccggggggaggaggagcagtgggcccggg
A0A337SJI7_BBC3-01      ccaggca---gccccgggagtccggggggaggaggagcagtgggcccggg
A0A667IM83_BBC3-01      ccaggca---gccccgggagtccggggggaggaggagcagtgggcccggg
H0XQ00_BBC3-01          ccaggcg---gccccggaggtccggggggaggaggagcagtgggccagag
A0A2K6KS56_BBC3-01      ccaggcg---gccccgggagt-cgcggggaggaggcgaagtgggcc--gg
A0A2K6KS56_BBC3-02      ---ggcg---gccccgggagt-cgcggggaggaggcgaagtgggcc--gg
A0A2K6FQZ1_BBC3-04      ccaggcg---gccccgggagtccggggggaggaggagcagtgggcccgag
A0A2K6FQZ1_BBC3-01      ccaggcg---gccccgggagtccggggggaggaggagcagtgggcccgag
A0A2K6FQZ1_BBC3-02      ccaggcg---gccccgggagtccggggggaggaggagcagtgggcccgag
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      ccaggcg---gctccgggagtccgcggggaggaggaacagtgggcccggg
A0A2I3HWI8_BBC3-03      ccaggcg---gctccgggagtccgcggggaggaggaacagtgggcccggg
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          ccaggcg---gccccgggagtccgcggggaggaggaacagtgggcccggg
Q9BXH1_BBC3-03          ccaggcg---gccccgggagtccgcggggaggaggaacagtgggcccggg
B4DQK3_BBC3-01          ccaggcg---gccccgggagtccgcggggaggaggaacagtgggcccggg
Q9BXH1_BBC3-06          ccaggcg---gccccgggagtccgcggggaggaggaacagtgggcccggg
H2NZD3_BBC3-01          ccaggcg---gccccgggagtccgcggggaggaggaacagtgggcccggg
H2NZD3_BBC3-02          ccaggcg---gccccgggagtccgcggggaggaggaacagtgggcccggg
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R9BZA9_BBC3-01      ccaggcg---gccccgggagtccgcggggaggaggaacagtgggcccggg
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      ccaggcg---gccccgggagtccgcggggaggaggaacagtgggcccggg
A0A2I3RGH5_BBC3-04      ccaggcg---gccccgggagtccgcggggaggaggaacagtgggcccggg
A0A2I3RGH5_BBC3-01      ccaggcg---gccccgggagtccgcggggaggaggaacagtgggcccggg
A0A2I3RGH5_BBC3-02      ccaggcg---gccccgggagtccgcggggaggaggaacagtgggcccggg
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      ccaggcg---gccccgggagtccgcggggaggaggaacagtgggcccggg
A0A2K5P2T8_BBC3-03      ccaggcg---gccccgggagtccgcggggaggaggaacagtgggcccggg
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K5V8L0_BBC3-01      ccaggcg---gccccgggagtccgc---gaggaggaacagtgggcccggg
A0A2K6ASP2_BBC3-01      ccaggcg---gccccgggagtccgcggggaggaggaacagtgggcccggg
A0A2K6ASP2_BBC3-03      ccaggcg---gccccgggagtccgcggggaggaggaacagtgggcccggg
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      ccaggcg---gccccgggagtccgcggggaggaggaacagtgggcccggg
A0A2K6QZT2_BBC3-01      ccaggcg---gccccgggagtccgcggggaggaggaacagtgggcccggg
A0A2K6QZT2_BBC3-02      ccaggcg---gccccgggagtccgcggggaggaggaacagtgggcccggg
A0A0D9S2H2_BBC3-01      ccaggcg---gccccgggagtccgcggggaggaggaacagtgggcccagg
A0A2I3N2Z9_BBC3-01      ccaggcg---gccccgggagtccgtggggaggaggaacagtgggcccggg
A0A2I3N2Z9_BBC3-02      ccaggcg---gccccgggagtccgtggggaggaggaacagtgggcccggg
A0A2K6STD6_BBC3-02      ccaggcg---gccccgggagtccgcggggaggaggagcagtgggctcggg
A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      ccaggcg---gccccgggagtccgcggggaggaggagcagtgggcccggg
A0A2K5F6X4_BBC3-02      ccaggcg---gccccgggagtccgcggggaggaggagcagtgggcccggg
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      ccaggcg---gccctgggagtccgcggggaggaggagcagtgggcccggg
A0A2K5QNS7_BBC3-02      ccaggcg---gccctgggagtccgcggggaggaggagcagtgggcccggg
                                                                          

A0A4X2LVY2_BBC3-01      agattggggcccagctccgaaggatggccgatgacctcaatgctctgtat
A0A4X2LVY2_BBC3-02      agattggggcccagctccgaaggatggccgatgacctcaatgctctgtat
G3T2N1_BBC3-01          agatcggggcccagtttcggcggaaggcggacgacctctatgcgctgtac
F7GL32_BBC3-01          agatcggcgcccagctgcgcaggatggccgatgacctcaacgccctgtac
F7GL32_BBC3-02          agatcggcgcccagctgcgcaggatggccgatgacctcaacgccctgtac
A0A5F9DGT6_BBC3-01      agatcgtggcccagctgcggtggatggcgtacgatctgtacgcgcagtat
Q80ZG6_BBC3-01          agatcggggcccagctgcggaggatggcggacgacctcaacgcgcagtac
B2RVL4_BBC3-01          agatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtac
Q99ML1_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-02          agatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtac
Q99ML1_BBC3-03          --------------------------------------------------
M3Y0R3_BBC3-01          agatcggggcccagctgcggaggatggcggacgacctcaacgcgctgtac
A0A673UKJ9_BBC3-02      --------------------------------------------------
A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      agatcggggcccagctgcggcgaatggcggacgacctcgacgcactgtac
A0A671F3X5_BBC3-02      agatcggggcccagctgcggcgaatggcggacgacctcgacgcactgtac
A0A673UKJ9_BBC3-01      agatcggggcccagctgcggcggatggcggacgacctcaacgcgctgtac
A0A7N5KJL4_BBC3-01      agatcggggcccagctgcggcggatggcggacgacctcaacgcgctgtac
A0A7N5KJL4_BBC3-02      agatcggggcccagctgcggcggatggcggacgacctcaacgcgctgtac
A0A2Y9PEE3_BBC3-01      agatcggggcccagctgcggcggatggcggacgatctcaacgcgctgtac
A0A480SCP6_BBC3-01      agatcggggcccagctgcggcggatggctgacgatctcaacgcgctgtac
A0A4X1VVX9_BBC3-01      agatcggggcccagctgcggcggatggctgacgatctcaacgcgctgtac
A0A480SCP6_BBC3-04      agatcggggcccagctgcggcggatggctgacgatctcaacgcgctgtac
A0A4X1VVX9_BBC3-02      agatcggggcccagctgcggcggatggctgacgatctcaacgcgctgtac
A0A480SCP6_BBC3-02      agatcggggcccagctgcggcggatggctgacgatctcaacgcgctgtac
A0A480SCP6_BBC3-03      agatcggggcccagctgcggcggatggctgacgatctcaacgcgctgtac
A0A4W2EKD9_BBC3-01      agatcggggcccagctgcggcggatggcggacgacctcaacgcgctatac
A0A4W2EKD9_BBC3-01      agatcggggcccagctgcggcggatggcggacgacctcaacgcgctatac
A0A4W2EKD9_BBC3-02      agatcggggcccagctgcggcggatggcggacgacctcaacgcgctatac
A0A3Q1LXZ6_BBC3-01      agatcggggcccagctgcggcggatggcggacgacctcaacgcgctatac
A0A4W2EKD9_BBC3-02      agatcggggcccagctgcggcggatggcggacgacctcaacgcgctatac
A0A452E3G1_BBC3-01      agatcggggcccagctgcggcggatggcggacgacctcaacgcgctatac
A0A5F5PGZ4_BBC3-01      agatcggggcccagctgcggcggatggcggacgacctgaacgcgctgtac
A0A5F5PGZ4_BBC3-02      agatcggggcccagctgcggcggatggcggacgacctgaacgcgctgtac
A0A337SJI7_BBC3-01      agatcggggcccagctgcggcggatggcggacgacctcaacgcgctgtac
A0A667IM83_BBC3-01      agatcggggcccagctgcggcggatggcggacgacctcaacgcgctgtac
H0XQ00_BBC3-01          agataggggcccagctgcggcggatggcggacgacctcaacgcgcagtac
A0A2K6KS56_BBC3-01      gaatcggggcccagctgcggcggatggcgagacgactcaacgcgcagtac
A0A2K6KS56_BBC3-02      gaatcggggcccagctgcggcggatggcgagacgactcaacgcgcagtac
A0A2K6FQZ1_BBC3-04      agatcggggcccagctgcggcggatggcagacgacctcaatgcgcagtac
A0A2K6FQZ1_BBC3-01      agatcggggcccagctgcggcggatggcagacgacctcaatgcgcagtac
A0A2K6FQZ1_BBC3-02      agatcggggcccagctgcggcggatggcagacgacctcaatgcgcagtac
A0A2K6FQZ1_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-01      --------------------------------------------------
A0A2I3HWI8_BBC3-02      agatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtac
A0A2I3HWI8_BBC3-03      agatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtac
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          agatcggggcccagctgcggcggatggcggacgacctcaacgcacagtac
Q9BXH1_BBC3-03          agatcggggcccagctgcggcggatggcggacgacctcaacgcacagtac
B4DQK3_BBC3-01          agatcggggcccagctgcggcggatggcggacgacctcaacgcacagtac
Q9BXH1_BBC3-06          agatcggggcccagctgcggcggatggcggacgacctcaacgcacagtac
H2NZD3_BBC3-01          agatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtac
H2NZD3_BBC3-02          agatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtac
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2R9BZA9_BBC3-01      agatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtac
A0A2I3RGH5_BBC3-05      --------------------------------------------------
A0A2I3RGH5_BBC3-03      agatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtac
A0A2I3RGH5_BBC3-04      agatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtac
A0A2I3RGH5_BBC3-01      agatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtac
A0A2I3RGH5_BBC3-02      agatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtac
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      agatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtac
A0A2K5P2T8_BBC3-03      agatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtac
A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K5V8L0_BBC3-01      agatcggggcccagctgcggcggatggcggacgacctcaacgcgcaatac
A0A2K6ASP2_BBC3-01      agatcggggcccagctgcggcggatggcggacgacctcaacgcgcaatac
A0A2K6ASP2_BBC3-03      agatcggggcccagctgcggcggatggcggacgacctcaacgcgcaatac
A0A2K6QZT2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-04      agatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtac
A0A2K6QZT2_BBC3-01      agatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtac
A0A2K6QZT2_BBC3-02      agatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtac
A0A0D9S2H2_BBC3-01      agatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtac
A0A2I3N2Z9_BBC3-01      agatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtac
A0A2I3N2Z9_BBC3-02      agatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtac
A0A2K6STD6_BBC3-02      agatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtac
A0A2K6STD6_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-01      --------------------------------------------------
A0A2K5F6X4_BBC3-03      agatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtac
A0A2K5F6X4_BBC3-02      agatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtac
A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      agatcggggcccagctgcagcggatggcggacgacctcaacgcgcagtac
A0A2K5QNS7_BBC3-02      agatcggggcccagctgcagcggatggcggacgacctcaacgcgcagtac
                                                                          

A0A4X2LVY2_BBC3-01      gagcagcgg--------------------agacg----------------
A0A4X2LVY2_BBC3-02      gagcagcgg--------------------agacg----------------
G3T2N1_BBC3-01          gagcggtcggtg-----------------agaca----------------
F7GL32_BBC3-01          gagcagcgg--------------------agacg----------------
F7GL32_BBC3-02          gagcagcgg--------------------agacg----------------
A0A5F9DGT6_BBC3-01      gagcgc-----------------------agaca----------------
Q80ZG6_BBC3-01          gagcggcgg--------------------agaca----------------
B2RVL4_BBC3-01          gagcggcgg--------------------agaca----------------
Q99ML1_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-02          gagcggcgg--------------------agaca----------------
Q99ML1_BBC3-03          --------------------------------------------------
M3Y0R3_BBC3-01          gagcggcgg--------------------agaca----------------
A0A673UKJ9_BBC3-02      --------g--------------------agaca----------------
A0A671F3X5_BBC3-03      --------g--------------------agaca----------------
A0A671F3X5_BBC3-01      gagcggcgg--------------------agaca----------------
A0A671F3X5_BBC3-02      gagcggcgg--------------------agaca----------------
A0A673UKJ9_BBC3-01      gagcggcgg--------------------agaca----------------
A0A7N5KJL4_BBC3-01      gagcggcgg--------------------agaca----------------
A0A7N5KJL4_BBC3-02      gagcggcgg--------------------agaca----------------
A0A2Y9PEE3_BBC3-01      gaacggcgg--------------------agaca----------------
A0A480SCP6_BBC3-01      gagcggcgg--------------------agaca----------------
A0A4X1VVX9_BBC3-01      gagcggcgg--------------------agaca----------------
A0A480SCP6_BBC3-04      gagcggcgggtgagtgctgggggaggggtagacggcaggtgggacttccc
A0A4X1VVX9_BBC3-02      gagcggcgg--------------------agaca----------------
A0A480SCP6_BBC3-02      gagcggcgg--------------------agaca----------------
A0A480SCP6_BBC3-03      gagcggcgg--------------------agaca----------------
A0A4W2EKD9_BBC3-01      gagcggcgg--------------------agaca----------------
A0A4W2EKD9_BBC3-01      gagcggcgg--------------------agaca----------------
A0A4W2EKD9_BBC3-02      gagcggcgg--------------------agaca----------------
A0A3Q1LXZ6_BBC3-01      gagcggcgg--------------------agaca----------------
A0A4W2EKD9_BBC3-02      gagcggcgg--------------------agaca----------------
A0A452E3G1_BBC3-01      gagcggcgg--------------------agaca----------------
A0A5F5PGZ4_BBC3-01      gagcggcgg--------------------agaca----------------
A0A5F5PGZ4_BBC3-02      gagcggcgg--------------------agaca----------------
A0A337SJI7_BBC3-01      gagcggcgg--------------------agaca----------------
A0A667IM83_BBC3-01      gagcggcgg--------------------agaca----------------
H0XQ00_BBC3-01          gagcggcgg--------------------agaca----------------
A0A2K6KS56_BBC3-01      agacggcgg--------------------agaca----------------
A0A2K6KS56_BBC3-02      agacggcgg--------------------agaca----------------
A0A2K6FQZ1_BBC3-04      gagcggcgg--------------------agaca----------------
A0A2K6FQZ1_BBC3-01      gagcggcgg--------------------agaca----------------
A0A2K6FQZ1_BBC3-02      gagcggcgg--------------------agaca----------------
A0A2K6FQZ1_BBC3-03      --------g--------------------agaca----------------
A0A2I3HWI8_BBC3-01      --------g--------------------agaca----------------
A0A2I3HWI8_BBC3-02      gagcggcgg--------------------agaca----------------
A0A2I3HWI8_BBC3-03      gagcggcgg--------------------agaca----------------
Q9BXH1_BBC3-04          -------tg--------------------agaca----------------
Q9BXH1_BBC3-05          gagcggcgg--------------------agaca----------------
Q9BXH1_BBC3-03          gagcggcgg--------------------agaca----------------
B4DQK3_BBC3-01          gagcggcgg--------------------agaca----------------
Q9BXH1_BBC3-06          gagcggcgg--------------------agaca----------------
H2NZD3_BBC3-01          gagcggcgg--------------------agaca----------------
H2NZD3_BBC3-02          gagcggcgg--------------------agaca----------------
A0A2R9BZA9_BBC3-02      -----------------------------agaca----------------
A0A2R9BZA9_BBC3-01      gagcggcgg--------------------agaca----------------
A0A2I3RGH5_BBC3-05      -----------------------------agaca----------------
A0A2I3RGH5_BBC3-03      gagcggcgg--------------------agaca----------------
A0A2I3RGH5_BBC3-04      gagcggcgg--------------------agaca----------------
A0A2I3RGH5_BBC3-01      gagcggcgg--------------------agaca----------------
A0A2I3RGH5_BBC3-02      gagcggcgg--------------------agaca----------------
A0A2K5P2T8_BBC3-02      --------g--------------------agaca----------------
A0A2K5P2T8_BBC3-01      gagcggcgg--------------------agaca----------------
A0A2K5P2T8_BBC3-03      gagcggcgg--------------------agaca----------------
A0A2K6ASP2_BBC3-02      --------g--------------------agaca----------------
A0A2K5V8L0_BBC3-01      gagcggcgg--------------------agaca----------------
A0A2K6ASP2_BBC3-01      gagcggcgg--------------------agaca----------------
A0A2K6ASP2_BBC3-03      gagcggcgg--------------------agaca----------------
A0A2K6QZT2_BBC3-03      -------tg--------------------agaca----------------
A0A2K6QZT2_BBC3-04      gagcggcgg--------------------agaca----------------
A0A2K6QZT2_BBC3-01      gagcggcgg--------------------agaca----------------
A0A2K6QZT2_BBC3-02      gagcggcgg--------------------agaca----------------
A0A0D9S2H2_BBC3-01      gagcggcgg--------------------agaca----------------
A0A2I3N2Z9_BBC3-01      gagcggcgg--------------------agaca----------------
A0A2I3N2Z9_BBC3-02      gagcggcgg--------------------agaca----------------
A0A2K6STD6_BBC3-02      gagcggcgg--------------------agaca----------------
A0A2K6STD6_BBC3-01      --------g--------------------agaca----------------
A0A2K5F6X4_BBC3-01      --------g--------------------agaca----------------
A0A2K5F6X4_BBC3-03      gagcggcgg--------------------agaca----------------
A0A2K5F6X4_BBC3-02      gagcggcgg--------------------agaca----------------
A0A2K5QNS7_BBC3-03      --------g--------------------agaca----------------
A0A2K5QNS7_BBC3-01      gagcggcgg--------------------agaca----------------
A0A2K5QNS7_BBC3-02      gagcggcgg--------------------agaca----------------
                                                                          

A0A4X2LVY2_BBC3-01      -----------------------------agaggaggagcaaagacggca
A0A4X2LVY2_BBC3-02      -----------------------------agaggaggagcaaagacggca
G3T2N1_BBC3-01          -----------------------------ggaggagcagcaccggcaccg
F7GL32_BBC3-01          -----------------------------ggaggaggagcagaggcgcca
F7GL32_BBC3-02          -----------------------------ggaggaggagcagaggcgcca
A0A5F9DGT6_BBC3-01      -----------------------------agaggagcagcagcgacaccg
Q80ZG6_BBC3-01          -----------------------------agaagagcaacatcgacaccg
B2RVL4_BBC3-01          -----------------------------agaagagcagcatcgacaccg
Q99ML1_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-02          -----------------------------agaagagcagcatcgacaccg
Q99ML1_BBC3-03          --------------------------------------------------
M3Y0R3_BBC3-01          -----------------------------agaagagcagcagcgacaccg
A0A673UKJ9_BBC3-02      -----------------------------agaggagcagcagcgacaccg
A0A671F3X5_BBC3-03      -----------------------------agaggagcagcagcgacaccg
A0A671F3X5_BBC3-01      -----------------------------agaggagcagcagcgacaccg
A0A671F3X5_BBC3-02      -----------------------------agaggagcagcagcgacaccg
A0A673UKJ9_BBC3-01      -----------------------------agaggagcagcagcgacaccg
A0A7N5KJL4_BBC3-01      -----------------------------agaggagcggcagcgacaccg
A0A7N5KJL4_BBC3-02      -----------------------------agaggagcggcagcgacaccg
A0A2Y9PEE3_BBC3-01      -----------------------------agaggagcagcagcgacaccg
A0A480SCP6_BBC3-01      -----------------------------agaggagcagcagcgacaccg
A0A4X1VVX9_BBC3-01      -----------------------------agaggagcagcagcgacaccg
A0A480SCP6_BBC3-04      gcggggagggggttgggggcgacccagccagatgtgcggcagc--tgctg
A0A4X1VVX9_BBC3-02      -----------------------------agaggagcagcagcgacaccg
A0A480SCP6_BBC3-02      -----------------------------agaggagcagcagcgacaccg
A0A480SCP6_BBC3-03      -----------------------------agaggagcagcagcgacaccg
A0A4W2EKD9_BBC3-01      -----------------------------agaggagcggcagcgacaccg
A0A4W2EKD9_BBC3-01      -----------------------------agaggagcggcagcgacaccg
A0A4W2EKD9_BBC3-02      -----------------------------agaggagcggcagcgacaccg
A0A3Q1LXZ6_BBC3-01      -----------------------------agaggagcggcagcgacaccg
A0A4W2EKD9_BBC3-02      -----------------------------agaggagcggcagcgacaccg
A0A452E3G1_BBC3-01      -----------------------------agaggagcggcaacgacaccg
A0A5F5PGZ4_BBC3-01      -----------------------------agaggagcagcagcgacaccg
A0A5F5PGZ4_BBC3-02      -----------------------------agaggagcagcagcgacaccg
A0A337SJI7_BBC3-01      -----------------------------agaggagcagcagcgacaccg
A0A667IM83_BBC3-01      -----------------------------agaggagcagcagcgacaccg
H0XQ00_BBC3-01          -----------------------------agaggagcagcagcgacaccg
A0A2K6KS56_BBC3-01      -----------------------------agaggagcagcagcgacaccg
A0A2K6KS56_BBC3-02      -----------------------------agaggagcagcagcgacaccg
A0A2K6FQZ1_BBC3-04      -----------------------------agaggagcagcagagacaccg
A0A2K6FQZ1_BBC3-01      -----------------------------agaggagcagcagagacaccg
A0A2K6FQZ1_BBC3-02      -----------------------------agaggagcagcagagacaccg
A0A2K6FQZ1_BBC3-03      -----------------------------agaggagcagcagagacaccg
A0A2I3HWI8_BBC3-01      -----------------------------agaggagcaacagcggcaccg
A0A2I3HWI8_BBC3-02      -----------------------------agaggagcaacagcggcaccg
A0A2I3HWI8_BBC3-03      -----------------------------agaggagcaacagcggcaccg
Q9BXH1_BBC3-04          -----------------------------agaggagcagcagcggcaccg
Q9BXH1_BBC3-05          -----------------------------agaggagcagcagcggcaccg
Q9BXH1_BBC3-03          -----------------------------agaggagcagcagcggcaccg
B4DQK3_BBC3-01          -----------------------------agaggagcagcagcggcaccg
Q9BXH1_BBC3-06          -----------------------------agaggagcagcagcggcaccg
H2NZD3_BBC3-01          -----------------------------agaggagcagcagcggcaccg
H2NZD3_BBC3-02          -----------------------------agaggagcagcagcggcaccg
A0A2R9BZA9_BBC3-02      -----------------------------agaggagcagcagcggcaccg
A0A2R9BZA9_BBC3-01      -----------------------------agaggagcagcagcggcaccg
A0A2I3RGH5_BBC3-05      -----------------------------agaggagcagcagcggcaccg
A0A2I3RGH5_BBC3-03      -----------------------------agaggagcagcagcggcaccg
A0A2I3RGH5_BBC3-04      -----------------------------agaggagcagcagcggcaccg
A0A2I3RGH5_BBC3-01      -----------------------------agaggagcagcagcggcaccg
A0A2I3RGH5_BBC3-02      -----------------------------agaggagcagcagcggcaccg
A0A2K5P2T8_BBC3-02      -----------------------------agaggagcagcagcgacaccg
A0A2K5P2T8_BBC3-01      -----------------------------agaggagcagcagcgacaccg
A0A2K5P2T8_BBC3-03      -----------------------------agaggagcagcagcgacaccg
A0A2K6ASP2_BBC3-02      -----------------------------agaggagcagcagcgacaccg
A0A2K5V8L0_BBC3-01      -----------------------------agaggagcagcagcgacaccg
A0A2K6ASP2_BBC3-01      -----------------------------agaggagcagcagcgacaccg
A0A2K6ASP2_BBC3-03      -----------------------------agaggagcagcagcgacaccg
A0A2K6QZT2_BBC3-03      -----------------------------agaggagcagcagcgacaccg
A0A2K6QZT2_BBC3-04      -----------------------------agaggagcagcagcgacaccg
A0A2K6QZT2_BBC3-01      -----------------------------agaggagcagcagcgacaccg
A0A2K6QZT2_BBC3-02      -----------------------------agaggagcagcagcgacaccg
A0A0D9S2H2_BBC3-01      -----------------------------agaggagcagcagcgacaccg
A0A2I3N2Z9_BBC3-01      -----------------------------agaggagcagcagcgacaccg
A0A2I3N2Z9_BBC3-02      -----------------------------agaggagcagcagcgacaccg
A0A2K6STD6_BBC3-02      -----------------------------agaagagcagccgcaacaccg
A0A2K6STD6_BBC3-01      -----------------------------agaagagcagccgcaacaccg
A0A2K5F6X4_BBC3-01      -----------------------------agaggagcagccgcagcaccg
A0A2K5F6X4_BBC3-03      -----------------------------agaggagcagccgcagcaccg
A0A2K5F6X4_BBC3-02      -----------------------------agaggagcagccgcagcaccg
A0A2K5QNS7_BBC3-03      -----------------------------agaggagcagccgcagcaccg
A0A2K5QNS7_BBC3-01      -----------------------------agaggagcagccgcagcaccg
A0A2K5QNS7_BBC3-02      -----------------------------agaggagcagccgcagcaccg
                                                                          

A0A4X2LVY2_BBC3-01      tctc-----------tccccctggagg------------------ctgct
A0A4X2LVY2_BBC3-02      tctc-----------tccccctggagg------------------ctgct
G3T2N1_BBC3-01          tccc-----------tcgccctggagg------------------gtcct
F7GL32_BBC3-01          cctg-----------tcgccctggagg------------------ctgct
F7GL32_BBC3-02          cctg-----------tcgccctggagg------------------ctgct
A0A5F9DGT6_BBC3-01      ccct-----------tcgccctggagg------------------gtcct
Q80ZG6_BBC3-01          accc-----------tcgccctggagg------------------gtcat
B2RVL4_BBC3-01          accc-----------tcaccctggagg------------------gtcat
Q99ML1_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-02          accc-----------tcaccctggagg------------------gtcat
Q99ML1_BBC3-03          --------------------------------------------------
M3Y0R3_BBC3-01          cccc-----------tccccctggagg------------------gtcct
A0A673UKJ9_BBC3-02      cccc-----------tcaccctggagg------------------gtcct
A0A671F3X5_BBC3-03      cccc-----------tcgccctggagg------------------gtcct
A0A671F3X5_BBC3-01      cccc-----------tcgccctggagg------------------gtcct
A0A671F3X5_BBC3-02      cccc-----------tcgccctggagg------------------gtcct
A0A673UKJ9_BBC3-01      cccc-----------tcaccctggagg------------------gtcct
A0A7N5KJL4_BBC3-01      cccc-----------tcaccctggagg------------------gtcct
A0A7N5KJL4_BBC3-02      cccc-----------tcaccctggagg------------------gtcct
A0A2Y9PEE3_BBC3-01      cccc-----------tccccctggagg------------------gtcct
A0A480SCP6_BBC3-01      cccc-----------tcgccctggagg------------------gttct
A0A4X1VVX9_BBC3-01      cccc-----------tcgccctggagg------------------gttct
A0A480SCP6_BBC3-04      ccctgcgcggcggggtcgcgctggggacaggcaggtgggaggggcggcct
A0A4X1VVX9_BBC3-02      cccc-----------tcgccctggagg------------------gttct
A0A480SCP6_BBC3-02      cccc-----------tcgccctggagg------------------gttct
A0A480SCP6_BBC3-03      cccc-----------tcgccctggagg------------------gttct
A0A4W2EKD9_BBC3-01      cccc-----------tcaccctggagg------------------gtcct
A0A4W2EKD9_BBC3-01      cccc-----------tcaccctggagg------------------gtcct
A0A4W2EKD9_BBC3-02      cccc-----------tcaccctggagg------------------gtcct
A0A3Q1LXZ6_BBC3-01      cccc-----------tcaccctggagg------------------gtcct
A0A4W2EKD9_BBC3-02      cccc-----------tcaccctggagg------------------gtcct
A0A452E3G1_BBC3-01      cccc-----------tcgccctggagg------------------gtcct
A0A5F5PGZ4_BBC3-01      cccc-----------tcgccctggagg------------------gtcct
A0A5F5PGZ4_BBC3-02      cccc-----------tcgccctggagg------------------gtcct
A0A337SJI7_BBC3-01      cccc-----------tcaccctggagg------------------gtcct
A0A667IM83_BBC3-01      cccc-----------tcaccctggagg------------------gtcct
H0XQ00_BBC3-01          cccc-----------tcaccctggaga------------------gtcct
A0A2K6KS56_BBC3-01      cccc-----------tcgccctggagg------------------gtcct
A0A2K6KS56_BBC3-02      cccc-----------tcgccctggagg------------------gtcct
A0A2K6FQZ1_BBC3-04      cccc-----------tcaccctggagg------------------gtcct
A0A2K6FQZ1_BBC3-01      cccc-----------tcaccctggagg------------------gtcct
A0A2K6FQZ1_BBC3-02      cccc-----------tcaccctggagg------------------gtcct
A0A2K6FQZ1_BBC3-03      cccc-----------tcaccctggagg------------------gtcct
A0A2I3HWI8_BBC3-01      cccc-----------tcgccctggagg------------------gtcct
A0A2I3HWI8_BBC3-02      cccc-----------tcgccctggagg------------------gtcct
A0A2I3HWI8_BBC3-03      cccc-----------tcgccctggagg------------------gtcct
Q9BXH1_BBC3-04          cccc-----------tcaccctggagg------------------gtcct
Q9BXH1_BBC3-05          cccc-----------tcaccctggagg------------------gtcct
Q9BXH1_BBC3-03          cccc-----------tcaccctggagg------------------gtcct
B4DQK3_BBC3-01          cccc-----------tcaccctggagg------------------gtcct
Q9BXH1_BBC3-06          cccc-----------tcaccctggagg------------------gtcct
H2NZD3_BBC3-01          cccc-----------tcgccctggagg------------------gtcct
H2NZD3_BBC3-02          cccc-----------tcgccctggagg------------------gtcct
A0A2R9BZA9_BBC3-02      cccc-----------tcgccctggagg------------------gtcct
A0A2R9BZA9_BBC3-01      cccc-----------tcgccctggagg------------------gtcct
A0A2I3RGH5_BBC3-05      cccc-----------tcgccctggagg------------------gtcct
A0A2I3RGH5_BBC3-03      cccc-----------tcgccctggagg------------------gtcct
A0A2I3RGH5_BBC3-04      cccc-----------tcgccctggagg------------------gtcct
A0A2I3RGH5_BBC3-01      cccc-----------tcgccctggagg------------------gtcct
A0A2I3RGH5_BBC3-02      cccc-----------tcgccctggagg------------------gtcct
A0A2K5P2T8_BBC3-02      cccc-----------tcgccctggagg------------------gtcct
A0A2K5P2T8_BBC3-01      cccc-----------tcgccctggagg------------------gtcct
A0A2K5P2T8_BBC3-03      cccc-----------tcgccctggagg------------------gtcct
A0A2K6ASP2_BBC3-02      cccc-----------tcgccctggagg------------------gtcct
A0A2K5V8L0_BBC3-01      cccc-----------tcgccctggagg------------------gtcct
A0A2K6ASP2_BBC3-01      cccc-----------tcgccctggagg------------------gtcct
A0A2K6ASP2_BBC3-03      cccc-----------tcgccctggagg------------------gtcct
A0A2K6QZT2_BBC3-03      cccc-----------tcgccctggagg------------------gtcct
A0A2K6QZT2_BBC3-04      cccc-----------tcgccctggagg------------------gtcct
A0A2K6QZT2_BBC3-01      cccc-----------tcgccctggagg------------------gtcct
A0A2K6QZT2_BBC3-02      cccc-----------tcgccctggagg------------------gtcct
A0A0D9S2H2_BBC3-01      cccc-----------tcgccctggagg------------------gtcct
A0A2I3N2Z9_BBC3-01      cccc-----------tcgccctggagg------------------gtcct
A0A2I3N2Z9_BBC3-02      cccc-----------tcgccctggagg------------------gtcct
A0A2K6STD6_BBC3-02      cccc-----------tcaccctggagg------------------gtcct
A0A2K6STD6_BBC3-01      cccc-----------tcaccctggagg------------------gtcct
A0A2K5F6X4_BBC3-01      cccc-----------tcaccctggagg------------------gtcct
A0A2K5F6X4_BBC3-03      cccc-----------tcaccctggagg------------------gtcct
A0A2K5F6X4_BBC3-02      cccc-----------tcaccctggagg------------------gtcct
A0A2K5QNS7_BBC3-03      cccc-----------tcgccctggagg------------------gtcct
A0A2K5QNS7_BBC3-01      cccc-----------tcgccctggagg------------------gtcct
A0A2K5QNS7_BBC3-02      cccc-----------tcgccctggagg------------------gtcct
                                                                          

A0A4X2LVY2_BBC3-01      ct------------------------------------acaatctcgtct
A0A4X2LVY2_BBC3-02      ct------------------------------------acaatctcgtct
G3T2N1_BBC3-01          gt------------------------------------acaatctcatca
F7GL32_BBC3-01          gt------------------------------------acaatctcatct
F7GL32_BBC3-02          gt------------------------------------acaatctcatct
A0A5F9DGT6_BBC3-01      gt------------------------------------acaatcttctca
Q80ZG6_BBC3-01          gt------------------------------------ataatctcttca
B2RVL4_BBC3-01          gt------------------------------------acaatctcttca
Q99ML1_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-02          gt------------------------------------acaatctcttca
Q99ML1_BBC3-03          --------------------------------------------------
M3Y0R3_BBC3-01          gt------------------------------------acaatctcatca
A0A673UKJ9_BBC3-02      gt------------------------------------acaatctcatca
A0A671F3X5_BBC3-03      gt------------------------------------acaacctgatca
A0A671F3X5_BBC3-01      gt------------------------------------acaacctgatca
A0A671F3X5_BBC3-02      gt------------------------------------acaacctgatca
A0A673UKJ9_BBC3-01      gt------------------------------------acaatctcatca
A0A7N5KJL4_BBC3-01      gt------------------------------------acaatctcatca
A0A7N5KJL4_BBC3-02      gt------------------------------------acaatctcatca
A0A2Y9PEE3_BBC3-01      gt------------------------------------acaatctcatca
A0A480SCP6_BBC3-01      gt------------------------------------acaatctcatca
A0A4X1VVX9_BBC3-01      gt------------------------------------acaatctcatca
A0A480SCP6_BBC3-04      gtccgcggagccaccgtaaggcccgcgctgcggctggcaccaccgggtcg
A0A4X1VVX9_BBC3-02      gt------------------------------------acaatctcatca
A0A480SCP6_BBC3-02      gt------------------------------------acaatctcatca
A0A480SCP6_BBC3-03      gt------------------------------------acaatctcatca
A0A4W2EKD9_BBC3-01      gt------------------------------------acaatctcatca
A0A4W2EKD9_BBC3-01      gt------------------------------------acaatctcatca
A0A4W2EKD9_BBC3-02      gt------------------------------------acaatctcatca
A0A3Q1LXZ6_BBC3-01      gt------------------------------------acaatctcatca
A0A4W2EKD9_BBC3-02      gt------------------------------------acaatctcatca
A0A452E3G1_BBC3-01      gt------------------------------------acaatctcatct
A0A5F5PGZ4_BBC3-01      gt------------------------------------acaatctcatca
A0A5F5PGZ4_BBC3-02      gt------------------------------------acaatctcatca
A0A337SJI7_BBC3-01      gt------------------------------------acaatctcatca
A0A667IM83_BBC3-01      gt------------------------------------acaatctcatca
H0XQ00_BBC3-01          gt------------------------------------acaatctcatca
A0A2K6KS56_BBC3-01      gt------------------------------------acaatctcatta
A0A2K6KS56_BBC3-02      gt------------------------------------acaatctcatta
A0A2K6FQZ1_BBC3-04      gt------------------------------------acaatctcatca
A0A2K6FQZ1_BBC3-01      gt------------------------------------acaatctcatca
A0A2K6FQZ1_BBC3-02      gt------------------------------------acaatctcatca
A0A2K6FQZ1_BBC3-03      gt------------------------------------acaatctcatca
A0A2I3HWI8_BBC3-01      gt------------------------------------acaatctcatca
A0A2I3HWI8_BBC3-02      gt------------------------------------acaatctcatca
A0A2I3HWI8_BBC3-03      gt------------------------------------acaatctcatca
Q9BXH1_BBC3-04          gt------------------------------------acaatctcatca
Q9BXH1_BBC3-05          gt------------------------------------acaatctcatca
Q9BXH1_BBC3-03          gt------------------------------------acaatctcatca
B4DQK3_BBC3-01          gt------------------------------------acaatctcatca
Q9BXH1_BBC3-06          gt------------------------------------acaatctcatca
H2NZD3_BBC3-01          gt------------------------------------acaatctcatca
H2NZD3_BBC3-02          gt------------------------------------acaatctcatca
A0A2R9BZA9_BBC3-02      gt------------------------------------acaatctcatca
A0A2R9BZA9_BBC3-01      gt------------------------------------acaatctcatca
A0A2I3RGH5_BBC3-05      gt------------------------------------acaatctcatca
A0A2I3RGH5_BBC3-03      gt------------------------------------acaatctcatca
A0A2I3RGH5_BBC3-04      gt------------------------------------acaatctcatca
A0A2I3RGH5_BBC3-01      gt------------------------------------acaatctcatca
A0A2I3RGH5_BBC3-02      gt------------------------------------acaatctcatca
A0A2K5P2T8_BBC3-02      gt------------------------------------acaatctcatca
A0A2K5P2T8_BBC3-01      gt------------------------------------acaatctcatca
A0A2K5P2T8_BBC3-03      gt------------------------------------acaatctcatca
A0A2K6ASP2_BBC3-02      gt------------------------------------acaatctcatca
A0A2K5V8L0_BBC3-01      gt------------------------------------acaatctcatca
A0A2K6ASP2_BBC3-01      gt------------------------------------acaatctcatca
A0A2K6ASP2_BBC3-03      gt------------------------------------acaatctcatca
A0A2K6QZT2_BBC3-03      gt------------------------------------acaatctcatta
A0A2K6QZT2_BBC3-04      gt------------------------------------acaatctcatta
A0A2K6QZT2_BBC3-01      gt------------------------------------acaatctcatta
A0A2K6QZT2_BBC3-02      gt------------------------------------acaatctcatta
A0A0D9S2H2_BBC3-01      gt------------------------------------acaatctcatca
A0A2I3N2Z9_BBC3-01      gt------------------------------------acaatctcatca
A0A2I3N2Z9_BBC3-02      gt------------------------------------acaatctcatca
A0A2K6STD6_BBC3-02      gt------------------------------------acaatctcatca
A0A2K6STD6_BBC3-01      gt------------------------------------acaatctcatca
A0A2K5F6X4_BBC3-01      gt------------------------------------acaatctcatca
A0A2K5F6X4_BBC3-03      gt------------------------------------acaatctcatca
A0A2K5F6X4_BBC3-02      gt------------------------------------acaatctcatca
A0A2K5QNS7_BBC3-03      gt------------------------------------acaatctcatca
A0A2K5QNS7_BBC3-01      gt------------------------------------acaatctcatca
A0A2K5QNS7_BBC3-02      gt------------------------------------acaatctcatca
                                                                          

A0A4X2LVY2_BBC3-01      caggac---------------------------tcctggccccacaccga
A0A4X2LVY2_BBC3-02      caggac---------------------------tcctggccccacaccga
G3T2N1_BBC3-01          tgggac---------------------------tactgcccttaccaagg
F7GL32_BBC3-01          cggggc---------------------------tcctggccc--cccagc
F7GL32_BBC3-02          cggggc---------------------------tcctggccc--cccagc
A0A5F9DGT6_BBC3-01      tgggac---------------------------ttctgcccttacccagg
Q80ZG6_BBC3-01          tgggac---------------------------tcctccccttacccagg
B2RVL4_BBC3-01          tgggac---------------------------tcctccccttacccagg
Q99ML1_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-02          tgggac---------------------------tcctccccttacccagg
Q99ML1_BBC3-03          --------------------------------------------------
M3Y0R3_BBC3-01          tgggac---------------------------tcctgcccttacccagg
A0A673UKJ9_BBC3-02      tgggac---------------------------tcctgcccttacccagg
A0A671F3X5_BBC3-03      tgggac---------------------------tgctgcccttacccagg
A0A671F3X5_BBC3-01      tgggac---------------------------tgctgcccttacccagg
A0A671F3X5_BBC3-02      tgggac---------------------------tgctgcccttacccagg
A0A673UKJ9_BBC3-01      tgggac---------------------------tcctgcccttacccagg
A0A7N5KJL4_BBC3-01      tgggac---------------------------tcctgccattacccagg
A0A7N5KJL4_BBC3-02      tgggac---------------------------tcctgccattacccagg
A0A2Y9PEE3_BBC3-01      tgggac---------------------------tcctgcccttacccagg
A0A480SCP6_BBC3-01      tgggac---------------------------ttctgcccttacccagg
A0A4X1VVX9_BBC3-01      tgggac---------------------------ttctgcccttacccagg
A0A480SCP6_BBC3-04      agggccagggccggggcagcctcgagcgttacggtgtgcccgcggccggc
A0A4X1VVX9_BBC3-02      tgggac---------------------------ttctgcccttacccagg
A0A480SCP6_BBC3-02      tgggac---------------------------ttctgcccttacccagg
A0A480SCP6_BBC3-03      tgggac---------------------------ttctgcccttacccagg
A0A4W2EKD9_BBC3-01      tgggac---------------------------tcctgccctttcccggg
A0A4W2EKD9_BBC3-01      tgggac---------------------------tcctgccctttcccggg
A0A4W2EKD9_BBC3-02      tgggac---------------------------tcctgccctttcccggg
A0A3Q1LXZ6_BBC3-01      tgggac---------------------------tcctgccctttcccggg
A0A4W2EKD9_BBC3-02      tgggac---------------------------tcctgccctttcccggg
A0A452E3G1_BBC3-01      tgggac---------------------------tcctgcccttccccggg
A0A5F5PGZ4_BBC3-01      tgggac---------------------------tcctgcccctacccagg
A0A5F5PGZ4_BBC3-02      tgggac---------------------------tcctgcccctacccagg
A0A337SJI7_BBC3-01      tgggac---------------------------tcctgcccttacccagg
A0A667IM83_BBC3-01      cgggac---------------------------tcctgcccttacccagg
H0XQ00_BBC3-01          tgggac---------------------------tcctgcccttacccagg
A0A2K6KS56_BBC3-01      tgggac---------------------------tcctgcccttacccagg
A0A2K6KS56_BBC3-02      tgggac---------------------------tcctgcccttacccagg
A0A2K6FQZ1_BBC3-04      tgggac---------------------------tcctgcccttacccagg
A0A2K6FQZ1_BBC3-01      tgggac---------------------------tcctgcccttacccagg
A0A2K6FQZ1_BBC3-02      tgggac---------------------------tcctgcccttacccagg
A0A2K6FQZ1_BBC3-03      tgggac---------------------------tcctgcccttacccagg
A0A2I3HWI8_BBC3-01      tgggac---------------------------tcctgcccttacccagg
A0A2I3HWI8_BBC3-02      tgggac---------------------------tcctgcccttacccagg
A0A2I3HWI8_BBC3-03      tgggac---------------------------tcctgcccttacccagg
Q9BXH1_BBC3-04          tgggac---------------------------tcctgcccttacccagg
Q9BXH1_BBC3-05          tgggac---------------------------tcctgcccttacccagg
Q9BXH1_BBC3-03          tgggac---------------------------tcctgcccttacccagg
B4DQK3_BBC3-01          tgggac---------------------------tcctgcccttacccagg
Q9BXH1_BBC3-06          tgggac---------------------------tcctgcccttacccagg
H2NZD3_BBC3-01          tgggac---------------------------tcctgcccttacccagg
H2NZD3_BBC3-02          tgggac---------------------------tcctgcccttacccagg
A0A2R9BZA9_BBC3-02      tgggac---------------------------tcctgcccttacccagg
A0A2R9BZA9_BBC3-01      tgggac---------------------------tcctgcccttacccagg
A0A2I3RGH5_BBC3-05      tgggac---------------------------tcctgcccttacccagg
A0A2I3RGH5_BBC3-03      tgggac---------------------------tcctgcccttacccagg
A0A2I3RGH5_BBC3-04      tgggac---------------------------tcctgcccttacccagg
A0A2I3RGH5_BBC3-01      tgggac---------------------------tcctgcccttacccagg
A0A2I3RGH5_BBC3-02      tgggac---------------------------tcctgcccttacccagg
A0A2K5P2T8_BBC3-02      tgggac---------------------------tcctgcccttacccagg
A0A2K5P2T8_BBC3-01      tgggac---------------------------tcctgcccttacccagg
A0A2K5P2T8_BBC3-03      tgggac---------------------------tcctgcccttacccagg
A0A2K6ASP2_BBC3-02      tgggac---------------------------tcctgcccttacccagg
A0A2K5V8L0_BBC3-01      tgggac---------------------------tcctgcccttacccagg
A0A2K6ASP2_BBC3-01      tgggac---------------------------tcctgcccttacccagg
A0A2K6ASP2_BBC3-03      tgggac---------------------------tcctgcccttacccagg
A0A2K6QZT2_BBC3-03      tgggac---------------------------tcctgcccttacccagg
A0A2K6QZT2_BBC3-04      tgggac---------------------------tcctgcccttacccagg
A0A2K6QZT2_BBC3-01      tgggac---------------------------tcctgcccttacccagg
A0A2K6QZT2_BBC3-02      tgggac---------------------------tcctgcccttacccagg
A0A0D9S2H2_BBC3-01      tgggac---------------------------tcctgcccttacccagg
A0A2I3N2Z9_BBC3-01      tgggac---------------------------tcctgcccttacccagg
A0A2I3N2Z9_BBC3-02      tgggac---------------------------tcctgcccttacccagg
A0A2K6STD6_BBC3-02      tgggac---------------------------tcctgccctttcccagg
A0A2K6STD6_BBC3-01      tgggac---------------------------tcctgccctttcccagg
A0A2K5F6X4_BBC3-01      tgggac---------------------------tcctgccctttcccagg
A0A2K5F6X4_BBC3-03      tgggac---------------------------tcctgccctttcccagg
A0A2K5F6X4_BBC3-02      tgggac---------------------------tcctgccctttcccagg
A0A2K5QNS7_BBC3-03      tgggac---------------------------tcctgccctttcccagg
A0A2K5QNS7_BBC3-01      tgggac---------------------------tcctgccctttcccagg
A0A2K5QNS7_BBC3-02      tgggac---------------------------tcctgccctttcccagg
                                                                          

A0A4X2LVY2_BBC3-01      gggaa-----ccggatc-----cccgaga--------tcgaac-------
A0A4X2LVY2_BBC3-02      gggaa-----ccggatc-----cccgaga--------tcgaac-------
G3T2N1_BBC3-01          gacca-----tggcgcc-----cccgaga--------tggagc-------
F7GL32_BBC3-01          ga--------aggaaccggatgccggacg--------tggagc-------
F7GL32_BBC3-02          ga--------aggaaccggatgccggacg--------tggagc-------
A0A5F9DGT6_BBC3-01      ggccc-----cggagcc-----ccggaga--------tggagc-------
Q80ZG6_BBC3-01          gatcc-----tggagcc-----ccagaaa--------tggagc-------
B2RVL4_BBC3-01          gatcc-----tggagcc-----ccagaaa--------tggagc-------
Q99ML1_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-02          gatcc-----tggagcc-----ccagaaa--------tggagc-------
Q99ML1_BBC3-03          --------------------------------------------------
M3Y0R3_BBC3-01          ggccg-----tggagcc-----ccagaga--------tggagc-------
A0A673UKJ9_BBC3-02      gcccg-----cggagcc-----ccggaga--------tggagc-------
A0A671F3X5_BBC3-03      ggccg-----tggagcc-----cccgaga--------tggagc-------
A0A671F3X5_BBC3-01      ggccg-----tggagcc-----cccgaga--------tggagc-------
A0A671F3X5_BBC3-02      ggccg-----tggagcc-----cccgaga--------tggagc-------
A0A673UKJ9_BBC3-01      gcccg-----cggagcc-----ccggaga--------tggagc-------
A0A7N5KJL4_BBC3-01      ggccg-----cggagcc-----ccggaga--------tggagc-------
A0A7N5KJL4_BBC3-02      ggccg-----cggagcc-----ccggaga--------tggagc-------
A0A2Y9PEE3_BBC3-01      ggccg-----cggagcc-----cccgaga--------tggagc-------
A0A480SCP6_BBC3-01      ggccg-----tggagcc-----cccgaga--------tggagc-------
A0A4X1VVX9_BBC3-01      ggccg-----tggagcc-----cccgaga--------tggagc-------
A0A480SCP6_BBC3-04      ggccggcggccggcggc-----cgcgagaactgagggcggcgctcagccg
A0A4X1VVX9_BBC3-02      ggccg-----tggagcc-----cccgaga--------tggagc-------
A0A480SCP6_BBC3-02      ggccg-----tggagcc-----cccgaga--------tggagc-------
A0A480SCP6_BBC3-03      ggccg-----tggagcc-----cccgaga--------tggagc-------
A0A4W2EKD9_BBC3-01      ggccg-----cggagcc-----cccgagg--------tggagc-------
A0A4W2EKD9_BBC3-01      ggccg-----cggagcc-----cccgagg--------tggagc-------
A0A4W2EKD9_BBC3-02      ggccg-----cggagcc-----cccgagg--------tggagc-------
A0A3Q1LXZ6_BBC3-01      ggccg-----cggagcc-----cccgagg--------tggagc-------
A0A4W2EKD9_BBC3-02      ggccg-----cggagcc-----cccgagg--------tggagc-------
A0A452E3G1_BBC3-01      ggccg-----cggagcc-----cccgagg--------tggagc-------
A0A5F5PGZ4_BBC3-01      ggccg-----agcggcc-----ccggaga--------tggagc-------
A0A5F5PGZ4_BBC3-02      ggccg-----agcggcc-----ccggaga--------tggagc-------
A0A337SJI7_BBC3-01      gcccg-----cggggcc-----ccggaga--------tggagc-------
A0A667IM83_BBC3-01      gcccg-----cggggcc-----ccggagg--------tggagc-------
H0XQ00_BBC3-01          ggcca-----cagagcc-----cctgaga--------tggagc-------
A0A2K6KS56_BBC3-01      ggcca-----cagagcc-----cccgaaa--------tggagc-------
A0A2K6KS56_BBC3-02      ggcca-----cagagcc-----cccgaaa--------tggagc-------
A0A2K6FQZ1_BBC3-04      ggcca-----cagagcc-----cctgaga--------tggagc-------
A0A2K6FQZ1_BBC3-01      ggcca-----cagagcc-----cctgaga--------tggagc-------
A0A2K6FQZ1_BBC3-02      ggcca-----cagagcc-----cc---ga--------tggagc-------
A0A2K6FQZ1_BBC3-03      ggcca-----cagagcc-----cc---ga--------tggagc-------
A0A2I3HWI8_BBC3-01      ggcca-----cagagcc-----cccgaga--------tggagc-------
A0A2I3HWI8_BBC3-02      ggcca-----cagagcc-----cccgaga--------tggagc-------
A0A2I3HWI8_BBC3-03      ggcca-----cagagcc-----cccgaga--------tggagc-------
Q9BXH1_BBC3-04          ggcca-----cagagcc-----cccgaga--------tggagc-------
Q9BXH1_BBC3-05          ggcca-----cagagcc-----cccgaga--------tggagc-------
Q9BXH1_BBC3-03          ggcca-----cagagcc-----cccgaga--------tggagc-------
B4DQK3_BBC3-01          ggcca-----cagagcc-----cccgaga--------tggagc-------
Q9BXH1_BBC3-06          ggcca-----cagagcc-----cccgaga--------tggagc-------
H2NZD3_BBC3-01          ggcca-----cagagcc-----cccgaga--------tggagc-------
H2NZD3_BBC3-02          ggcca-----cagagcc-----cccgaga--------tggagc-------
A0A2R9BZA9_BBC3-02      ggcca-----cagagcc-----cccgaga--------tggagc-------
A0A2R9BZA9_BBC3-01      ggcca-----cagagcc-----cccgaga--------tggagc-------
A0A2I3RGH5_BBC3-05      ggcca-----cagagcc-----cccgaga--------tggagc-------
A0A2I3RGH5_BBC3-03      ggcca-----cagagcc-----cccgaga--------tggagc-------
A0A2I3RGH5_BBC3-04      ggcca-----cagagcc-----cccgaga--------tggagc-------
A0A2I3RGH5_BBC3-01      ggcca-----cagagcc-----cccgaga--------tggagc-------
A0A2I3RGH5_BBC3-02      ggcca-----cagagcc-----cccgaga--------tggagc-------
A0A2K5P2T8_BBC3-02      ggcca-----cagagcc-----cccgaaa--------tggagc-------
A0A2K5P2T8_BBC3-01      ggcca-----cagagcc-----cccgaaa--------tggagc-------
A0A2K5P2T8_BBC3-03      ggcca-----cagagcc-----cccgaaa--------tggagc-------
A0A2K6ASP2_BBC3-02      ggcca-----cagagcc-----cccgaaa--------tggagc-------
A0A2K5V8L0_BBC3-01      ggcca-----cagagcc-----cccgaaa--------tggagc-------
A0A2K6ASP2_BBC3-01      ggcca-----cagagcc-----cccgaaa--------tggagc-------
A0A2K6ASP2_BBC3-03      ggcca-----cagagcc-----cccgaaa--------tggagc-------
A0A2K6QZT2_BBC3-03      ggcca-----cagagcc-----cccgaaa--------tggagc-------
A0A2K6QZT2_BBC3-04      ggcca-----cagagcc-----cccgaaa--------tggagc-------
A0A2K6QZT2_BBC3-01      ggcca-----cagagcc-----cccgaaa--------tggagc-------
A0A2K6QZT2_BBC3-02      ggcca-----cagagcc-----cccgaaa--------tggagc-------
A0A0D9S2H2_BBC3-01      ggcca-----cagagcc-----cccgaaa--------tggagc-------
A0A2I3N2Z9_BBC3-01      ggcca-----cagagcc-----cccgaaa--------tggagc-------
A0A2I3N2Z9_BBC3-02      ggcca-----cagagcc-----cccgaaa--------tggagc-------
A0A2K6STD6_BBC3-02      ggcca-----cagagcc-----ccagaga--------tggagc-------
A0A2K6STD6_BBC3-01      ggcca-----cagagcc-----ccagaga--------tggagc-------
A0A2K5F6X4_BBC3-01      ggcca-----cagagcc-----cccgaga--------tggagc-------
A0A2K5F6X4_BBC3-03      ggcca-----cagagcc-----cccgaga--------tggagc-------
A0A2K5F6X4_BBC3-02      ggcca-----cagagcc-----cccgaga--------tggagc-------
A0A2K5QNS7_BBC3-03      ggcca-----cagagcc-----cccgaga--------tggagc-------
A0A2K5QNS7_BBC3-01      ggcca-----cagagcc-----cccgaga--------tggagc-------
A0A2K5QNS7_BBC3-02      ggcca-----cagagcc-----cccgaga--------tggagc-------
                                                                          

A0A4X2LVY2_BBC3-01      --------------------ccaactag----------------------
A0A4X2LVY2_BBC3-02      --------------------ccaactag----------------------
G3T2N1_BBC3-01          --------------------ccaattag----------------------
F7GL32_BBC3-01          --------------------ccaactag----------------------
F7GL32_BBC3-02          --------------------ccaactag----------------------
A0A5F9DGT6_BBC3-01      --------------------ccaactag----------------------
Q80ZG6_BBC3-01          --------------------ccaactag----------------------
B2RVL4_BBC3-01          --------------------ccaactag----------------------
Q99ML1_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-02          --------------------ccaactag----------------------
Q99ML1_BBC3-03          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------ccaattag----------------------
A0A673UKJ9_BBC3-02      --------------------ccaattaggtgcctgcacccgcccggtgga
A0A671F3X5_BBC3-03      --------------------ccaattaggtgcctgcacccgcacggtgga
A0A671F3X5_BBC3-01      --------------------ccaattaggtgcctgcacccgcacggtgga
A0A671F3X5_BBC3-02      --------------------ccaattag----------------------
A0A673UKJ9_BBC3-01      --------------------ccaattag----------------------
A0A7N5KJL4_BBC3-01      --------------------ccaattag----------------------
A0A7N5KJL4_BBC3-02      --------------------ccaattag----------------------
A0A2Y9PEE3_BBC3-01      --------------------ccaattag----------------------
A0A480SCP6_BBC3-01      --------------------ctaattag----------------------
A0A4X1VVX9_BBC3-01      --------------------ctaattag----------------------
A0A480SCP6_BBC3-04      agcggctcatatatcccaggctatttatagccggtga-------------
A0A4X1VVX9_BBC3-02      --------------------ctaattag----------------------
A0A480SCP6_BBC3-02      --------------------ctaattag----------------------
A0A480SCP6_BBC3-03      --------------------ctaattag----------------------
A0A4W2EKD9_BBC3-01      --------------------ccaattag----------------------
A0A4W2EKD9_BBC3-01      --------------------ccaattag----------------------
A0A4W2EKD9_BBC3-02      --------------------ccaattag----------------------
A0A3Q1LXZ6_BBC3-01      --------------------ccaattag----------------------
A0A4W2EKD9_BBC3-02      --------------------ccaattag----------------------
A0A452E3G1_BBC3-01      --------------------ccaattag----------------------
A0A5F5PGZ4_BBC3-01      --------------------ccaactaggtgcctgcacccgcccggggga
A0A5F5PGZ4_BBC3-02      --------------------ccaactag----------------------
A0A337SJI7_BBC3-01      --------------------ccaattag----------------------
A0A667IM83_BBC3-01      --------------------ccaattag----------------------
H0XQ00_BBC3-01          --------------------ccaattag----------------------
A0A2K6KS56_BBC3-01      --------------------ccaattaggtgcctgcacccgcccggtgga
A0A2K6KS56_BBC3-02      --------------------ccaattag----------------------
A0A2K6FQZ1_BBC3-04      --------------------ccaattag----------------------
A0A2K6FQZ1_BBC3-01      --------------------ccaattag----------------------
A0A2K6FQZ1_BBC3-02      --------------------ccaattaggtgcctgcacccgcctggtgga
A0A2K6FQZ1_BBC3-03      --------------------ccaattaggtgcctgcacccgcctggtgga
A0A2I3HWI8_BBC3-01      --------------------ccaattaggtgcctgcacccgcccggtgga
A0A2I3HWI8_BBC3-02      --------------------ccaattaggtgcctgcacccgcccggtgga
A0A2I3HWI8_BBC3-03      --------------------ccaattag----------------------
Q9BXH1_BBC3-04          --------------------ccaattaggtgcctgcacccgcccggtgga
Q9BXH1_BBC3-05          --------------------ccaattag----------------------
Q9BXH1_BBC3-03          --------------------ccaattaggtgcctgcacccgcccggtgga
B4DQK3_BBC3-01          --------------------ccaattag----------------------
Q9BXH1_BBC3-06          --------------------ccaattag----------------------
H2NZD3_BBC3-01          --------------------ccaattaggtgcctgcacccgcccggtgga
H2NZD3_BBC3-02          --------------------ccaattag----------------------
A0A2R9BZA9_BBC3-02      --------------------ccaattaggtgcctgcacccgcccggtgga
A0A2R9BZA9_BBC3-01      --------------------ccaattag----------------------
A0A2I3RGH5_BBC3-05      --------------------ccaattaggtgcctgcacccgcccggtgga
A0A2I3RGH5_BBC3-03      --------------------ccaattag----------------------
A0A2I3RGH5_BBC3-04      --------------------ccaattaggtgcctgcacccgcccggtgga
A0A2I3RGH5_BBC3-01      --------------------ccaattag----------------------
A0A2I3RGH5_BBC3-02      --------------------ccaattaggtgcctgcacccgcccggtgga
A0A2K5P2T8_BBC3-02      --------------------ccaattaggtgcctgcacccgcccggtgga
A0A2K5P2T8_BBC3-01      --------------------ccaattaggtgcctgcacccgcccggtgga
A0A2K5P2T8_BBC3-03      --------------------ccaattag----------------------
A0A2K6ASP2_BBC3-02      --------------------ccaattaggtgcctgcacccgcccggtgga
A0A2K5V8L0_BBC3-01      --------------------ccaattag----------------------
A0A2K6ASP2_BBC3-01      --------------------ccaattaggtgcctgcacccgcccggtgga
A0A2K6ASP2_BBC3-03      --------------------ccaattag----------------------
A0A2K6QZT2_BBC3-03      --------------------ccaattaggtgcctgcacccgcccggtgga
A0A2K6QZT2_BBC3-04      --------------------ccaattag----------------------
A0A2K6QZT2_BBC3-01      --------------------ccaattag----------------------
A0A2K6QZT2_BBC3-02      --------------------ccaattaggtgcctgcacccgcccggtgga
A0A0D9S2H2_BBC3-01      --------------------ccaattag----------------------
A0A2I3N2Z9_BBC3-01      --------------------ccaattaggtgcctgcacccgcccggtgga
A0A2I3N2Z9_BBC3-02      --------------------ccaattag----------------------
A0A2K6STD6_BBC3-02      --------------------ccaattag----------------------
A0A2K6STD6_BBC3-01      --------------------ccaattaggtgcctgcacccgcccggtgga
A0A2K5F6X4_BBC3-01      --------------------ccaattaggtgcctgcacccgcccggtgga
A0A2K5F6X4_BBC3-03      --------------------ccaattaggtgcctgcacccgcccggtgga
A0A2K5F6X4_BBC3-02      --------------------ccaattag----------------------
A0A2K5QNS7_BBC3-03      --------------------ccaattaggtgcctgcacctgcccggtgga
A0A2K5QNS7_BBC3-01      --------------------ccaattaggtgcctgcacctgcccggtgga
A0A2K5QNS7_BBC3-02      --------------------ccaattag----------------------
                                                                          

A0A4X2LVY2_BBC3-01      --------------------------------------------------
A0A4X2LVY2_BBC3-02      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
F7GL32_BBC3-01          --------------------------------------------------
F7GL32_BBC3-02          --------------------------------------------------
A0A5F9DGT6_BBC3-01      --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
B2RVL4_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-01          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-03          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A673UKJ9_BBC3-02      cgtcggggacttggggggcaggaccctcccgcctcctgacgccctggcca
A0A671F3X5_BBC3-03      cgtcagggacttggggggcaggaccctcccacctcctgacgccctggcca
A0A671F3X5_BBC3-01      cgtcagggacttggggggcaggaccctcccacctcctgacgccctggcca
A0A671F3X5_BBC3-02      --------------------------------------------------
A0A673UKJ9_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-01      --------------------------------------------------
A0A7N5KJL4_BBC3-02      --------------------------------------------------
A0A2Y9PEE3_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      --------------------------------------------------
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A4W2EKD9_BBC3-02      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A5F5PGZ4_BBC3-01      cgtcggggacttggggggcaggaccctcccacctcctgacgccctggcca
A0A5F5PGZ4_BBC3-02      --------------------------------------------------
A0A337SJI7_BBC3-01      --------------------------------------------------
A0A667IM83_BBC3-01      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6KS56_BBC3-01      cgtcagggactcggggggcaggcccctcccacctcctgacaccctggcca
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ1_BBC3-04      --------------------------------------------------
A0A2K6FQZ1_BBC3-01      --------------------------------------------------
A0A2K6FQZ1_BBC3-02      cgtcggagacttggggggcaggaccctcccacctcctgacaccctggcca
A0A2K6FQZ1_BBC3-03      cgtcggagacttggggggcaggaccctcccacctcctgacaccctggcca
A0A2I3HWI8_BBC3-01      cgtcagggactcggggggcaggcccctcccacctcctgacaccctggcca
A0A2I3HWI8_BBC3-02      cgtcagggactcggggggcaggcccctcccacctcctgacaccctggcca
A0A2I3HWI8_BBC3-03      --------------------------------------------------
Q9BXH1_BBC3-04          cgtcagggactcggggggcaggcccctcccacctcctgacaccctggcca
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          cgtcagggactcggggggcaggcccctcccacctcctgacaccctggcca
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
H2NZD3_BBC3-01          cgtcagggactcggggggcaggcccctcccacctcctgacaccctggcca
H2NZD3_BBC3-02          --------------------------------------------------
A0A2R9BZA9_BBC3-02      cgtcagggactcggggggcaggcccctcccacctcctgacaccctggcca
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-05      cgtcagggactcggggggcaggcccctcccacctcctgacaccctggcca
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2I3RGH5_BBC3-04      cgtcagggactcggggggcaggcccctcccacctcctgacaccctggcca
A0A2I3RGH5_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-02      cgtcagggactcggggggcaggcccctcccacctcctgacaccctggcca
A0A2K5P2T8_BBC3-02      cgtcagggactcggggggcaggcccctcccacctcctgacaccctggcca
A0A2K5P2T8_BBC3-01      cgtcagggactcggggggcaggcccctcccacctcctgacaccctggcca
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K6ASP2_BBC3-02      cgtcagggactcggggggcaggcccctcccacctcctgacaccctggcca
A0A2K5V8L0_BBC3-01      --------------------------------------------------
A0A2K6ASP2_BBC3-01      cgtcagggactcggggggcaggcccctcccacctcctgacaccctggcca
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2K6QZT2_BBC3-03      cgtcagggactcggggggcaggcccctcccacctcctgacaccctggcca
A0A2K6QZT2_BBC3-04      --------------------------------------------------
A0A2K6QZT2_BBC3-01      --------------------------------------------------
A0A2K6QZT2_BBC3-02      cgtcagggactcggggggcaggcccctcccacctcctgacaccctggcca
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2I3N2Z9_BBC3-01      cgtcagggacttggggggcaggcccctcccacctcctgacaccctggcca
A0A2I3N2Z9_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K6STD6_BBC3-01      cgtcagggactcggggggcaggcccctcccacctcctgacaccctggcca
A0A2K5F6X4_BBC3-01      cgtcagggactcggggggcaggcccctcccacctcctgacaccctggcca
A0A2K5F6X4_BBC3-03      cgtcagggactcggggggcaggcccctcccacctcctgacaccctggcca
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2K5QNS7_BBC3-03      cgtcagggactcggggggcaggcccctcccacctcctgacaccctggcca
A0A2K5QNS7_BBC3-01      cgtcagggactcggggggcaggcccctcccacctcctgacaccctggcca
A0A2K5QNS7_BBC3-02      --------------------------------------------------
                                                                          

A0A4X2LVY2_BBC3-01      -----------------------------
A0A4X2LVY2_BBC3-02      -----------------------------
G3T2N1_BBC3-01          -----------------------------
F7GL32_BBC3-01          -----------------------------
F7GL32_BBC3-02          -----------------------------
A0A5F9DGT6_BBC3-01      -----------------------------
Q80ZG6_BBC3-01          -----------------------------
B2RVL4_BBC3-01          -----------------------------
Q99ML1_BBC3-01          -----------------------------
Q99ML1_BBC3-02          -----------------------------
Q99ML1_BBC3-03          -----------------------------
M3Y0R3_BBC3-01          -----------------------------
A0A673UKJ9_BBC3-02      gcgcgggggacttcttctgcaccatgtag
A0A671F3X5_BBC3-03      gcgcgggggacattttctgcaccatgtag
A0A671F3X5_BBC3-01      gcgcgggggacattttctgcaccatgtag
A0A671F3X5_BBC3-02      -----------------------------
A0A673UKJ9_BBC3-01      -----------------------------
A0A7N5KJL4_BBC3-01      -----------------------------
A0A7N5KJL4_BBC3-02      -----------------------------
A0A2Y9PEE3_BBC3-01      -----------------------------
A0A480SCP6_BBC3-01      -----------------------------
A0A4X1VVX9_BBC3-01      -----------------------------
A0A480SCP6_BBC3-04      -----------------------------
A0A4X1VVX9_BBC3-02      -----------------------------
A0A480SCP6_BBC3-02      -----------------------------
A0A480SCP6_BBC3-03      -----------------------------
A0A4W2EKD9_BBC3-01      -----------------------------
A0A4W2EKD9_BBC3-01      -----------------------------
A0A4W2EKD9_BBC3-02      -----------------------------
A0A3Q1LXZ6_BBC3-01      -----------------------------
A0A4W2EKD9_BBC3-02      -----------------------------
A0A452E3G1_BBC3-01      -----------------------------
A0A5F5PGZ4_BBC3-01      gcgcggggggctctttctgcaccatgtag
A0A5F5PGZ4_BBC3-02      -----------------------------
A0A337SJI7_BBC3-01      -----------------------------
A0A667IM83_BBC3-01      -----------------------------
H0XQ00_BBC3-01          -----------------------------
A0A2K6KS56_BBC3-01      gcgcgggggactttctctgcaccatgtag
A0A2K6KS56_BBC3-02      -----------------------------
A0A2K6FQZ1_BBC3-04      -----------------------------
A0A2K6FQZ1_BBC3-01      -----------------------------
A0A2K6FQZ1_BBC3-02      gcacgggggactttttctgcaccatgtag
A0A2K6FQZ1_BBC3-03      gcacgggggactttttctgcaccatgtag
A0A2I3HWI8_BBC3-01      gcgtggggaactttctctgcaccatgtag
A0A2I3HWI8_BBC3-02      gcgtggggaactttctctgcaccatgtag
A0A2I3HWI8_BBC3-03      -----------------------------
Q9BXH1_BBC3-04          gcgcgggggactttctctgcaccatgtag
Q9BXH1_BBC3-05          -----------------------------
Q9BXH1_BBC3-03          gcgcgggggactttctctgcaccatgtag
B4DQK3_BBC3-01          -----------------------------
Q9BXH1_BBC3-06          -----------------------------
H2NZD3_BBC3-01          gcgcgggggactttctctgcaccatgtag
H2NZD3_BBC3-02          -----------------------------
A0A2R9BZA9_BBC3-02      gcgcgggggactttctctgcaccatgtag
A0A2R9BZA9_BBC3-01      -----------------------------
A0A2I3RGH5_BBC3-05      gcgcgggggactttctctgcaccatgtag
A0A2I3RGH5_BBC3-03      -----------------------------
A0A2I3RGH5_BBC3-04      gcgcgggggactttctctgcaccatgtag
A0A2I3RGH5_BBC3-01      -----------------------------
A0A2I3RGH5_BBC3-02      gcgcgggggactttctctgcaccatgtag
A0A2K5P2T8_BBC3-02      gcgcgggggactttctctgcaccatgtag
A0A2K5P2T8_BBC3-01      gcgcgggggactttctctgcaccatgtag
A0A2K5P2T8_BBC3-03      -----------------------------
A0A2K6ASP2_BBC3-02      gcgcgggggactttctctgcaccatgtag
A0A2K5V8L0_BBC3-01      -----------------------------
A0A2K6ASP2_BBC3-01      gcgcgggggactttctctgcaccatgtag
A0A2K6ASP2_BBC3-03      -----------------------------
A0A2K6QZT2_BBC3-03      gcgcgggggactttctctgcaccatgtag
A0A2K6QZT2_BBC3-04      -----------------------------
A0A2K6QZT2_BBC3-01      -----------------------------
A0A2K6QZT2_BBC3-02      gcgcgggggactttctctgcaccatgtag
A0A0D9S2H2_BBC3-01      -----------------------------
A0A2I3N2Z9_BBC3-01      gcgcgggggactttctctgcaccatgtag
A0A2I3N2Z9_BBC3-02      -----------------------------
A0A2K6STD6_BBC3-02      -----------------------------
A0A2K6STD6_BBC3-01      gcgcgggggactttctctgcaccatgtag
A0A2K5F6X4_BBC3-01      gcgcgggggactttctctgcaccatgtag
A0A2K5F6X4_BBC3-03      gcgcgggggactttctctgcaccatgtag
A0A2K5F6X4_BBC3-02      -----------------------------
A0A2K5QNS7_BBC3-03      gcgcgggggactttctctgcaccatgtag
A0A2K5QNS7_BBC3-01      gcgcgggggactttctctgcaccatgtag
A0A2K5QNS7_BBC3-02      -----------------------------
                                                     

© 1998-2022Legal notice