Dataset for CDS BMF of organism Takifugu rubripes

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A3B5KWG6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Takifugu rubripes GN=BMF (length=492 residues).
atggacgatgaggaggatgatgtatttcagccagacccttacagctggcgcaccacattccaggagataaagtgcgagga
ccggggcacgcagacacctggcccgaccctggcaccgcacagcggcatgcttccctgtggagtcgcagaagagcccagac
tactcttctacggcaacgcaggttttcgattgcacttccccgcacgcttcgaggttctcggggatcgaggagtgaggcgg
cgagacaccggaggggcgcccaacgggatggagccgctgccccagcagggtcctgtggtgcgcagcacggaggcttgcat
tggccagaagctccagctgattggggatcagtttcatcgggaacgcgttcaattgtatcagcgaaaccaaaggaaccagg
gcccgctgtggtggcgcctgggcaccgctctgctcagccttctgtttgacaggggcttcgtcgctggaggaggaggagcg
gggcggaggtga
>gnl|bcl2dbcds|A0A3B5KWG6_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Takifugu rubripes GN=BMF (length=492 residues).
atggacgatgaggaggatgatgtatttcagccagacccttacagctggcgcaccacattccaggagataaagtgcgagga
ccggggcacgcagacacctggcccgaccctggcaccgcacagcggcatgcttccctgtggagtcgcagaagagcccagac
tactcttctacggcaacgcaggttttcgattgcacttccccgcacgcttcgaggttctcggggatcgaggagtgaggcgg
cgagacaccggaggggcgcccaacgggatggagccgctgccccagcatggtcctgtggtgcgcagcacggaggcttgcat
tggccagaagctccagctgattggggatcagtttcatcgggaacgcgttcaattgtatcagcgaaaccaaaggaaccagg
gcccgctgtggtggcgcctgggcaccgctctgctcagccttctgtttgacaggggcttcgtcgctggaggaggaggagcg
gggcggaggtga
>gnl|bcl2dbcds|A0A3B5KWG6_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Takifugu rubripes GN=BMF (length=450 residues).
atggacgatgaggaggatgatgtatttcagccagacccttacagctggcgcaccacattccaggagataaagtgcgagga
ccggggcacgcagacacctggcccgaccctggcaccgcacagcggcatgcttccctgtggagtcgcagaagagcccagac
tactcttctacggcaacgcaggttttcgattgcacttccccgcacgcttcgaggttctcggggatcgaggagtgaggcgg
cgagacaccggaggggcgcccaacgggatggagccgctgccccagcagggtcctgtggtgcgcagcacggaggcttgcat
tggccagaagctccagctgattggggatcagtttcatcgggaacgcgttcaattgtatcagcgaaaccaaaggaaccagg
gcccgctgtggtgggcgcctgggcaccgctctgctcagccttctgtttga
© 1998-2021Legal notice