Dataset for CDS BMF of organism Takifugu rubripes

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B5KWG6_BMF-02      atggacgatgaggaggatgatgtatttcagccagacccttacagctggcg
A0A3B5KWG6_BMF-01      atggacgatgaggaggatgatgtatttcagccagacccttacagctggcg
A0A3B5KWG6_BMF-03      atggacgatgaggaggatgatgtatttcagccagacccttacagctggcg
                       **************************************************

A0A3B5KWG6_BMF-02      caccacattccaggagataaagtgcgaggaccggggcacgcagacacctg
A0A3B5KWG6_BMF-01      caccacattccaggagataaagtgcgaggaccggggcacgcagacacctg
A0A3B5KWG6_BMF-03      caccacattccaggagataaagtgcgaggaccggggcacgcagacacctg
                       **************************************************

A0A3B5KWG6_BMF-02      gcccgaccctggcaccgcacagcggcatgcttccctgtggagtcgcagaa
A0A3B5KWG6_BMF-01      gcccgaccctggcaccgcacagcggcatgcttccctgtggagtcgcagaa
A0A3B5KWG6_BMF-03      gcccgaccctggcaccgcacagcggcatgcttccctgtggagtcgcagaa
                       **************************************************

A0A3B5KWG6_BMF-02      gagcccagactactcttctacggcaacgcaggttttcgattgcacttccc
A0A3B5KWG6_BMF-01      gagcccagactactcttctacggcaacgcaggttttcgattgcacttccc
A0A3B5KWG6_BMF-03      gagcccagactactcttctacggcaacgcaggttttcgattgcacttccc
                       **************************************************

A0A3B5KWG6_BMF-02      cgcacgcttcgaggttctcggggatcgaggagtgaggcggcgagacaccg
A0A3B5KWG6_BMF-01      cgcacgcttcgaggttctcggggatcgaggagtgaggcggcgagacaccg
A0A3B5KWG6_BMF-03      cgcacgcttcgaggttctcggggatcgaggagtgaggcggcgagacaccg
                       **************************************************

A0A3B5KWG6_BMF-02      gaggggcgcccaacgggatggagccgctgccccagcatggtcctgtggtg
A0A3B5KWG6_BMF-01      gaggggcgcccaacgggatggagccgctgccccagcagggtcctgtggtg
A0A3B5KWG6_BMF-03      gaggggcgcccaacgggatggagccgctgccccagcagggtcctgtggtg
                       ************************************* ************

A0A3B5KWG6_BMF-02      cgcagcacggaggcttgcattggccagaagctccagctgattggggatca
A0A3B5KWG6_BMF-01      cgcagcacggaggcttgcattggccagaagctccagctgattggggatca
A0A3B5KWG6_BMF-03      cgcagcacggaggcttgcattggccagaagctccagctgattggggatca
                       **************************************************

A0A3B5KWG6_BMF-02      gtttcatcgggaacgcgttcaattgtatcagcgaaaccaaaggaaccagg
A0A3B5KWG6_BMF-01      gtttcatcgggaacgcgttcaattgtatcagcgaaaccaaaggaaccagg
A0A3B5KWG6_BMF-03      gtttcatcgggaacgcgttcaattgtatcagcgaaaccaaaggaaccagg
                       **************************************************

A0A3B5KWG6_BMF-02      gcccgctgtggt-ggcgcctgggcaccgctctgctcagccttctgtttga
A0A3B5KWG6_BMF-01      gcccgctgtggt-ggcgcctgggcaccgctctgctcagccttctgtttga
A0A3B5KWG6_BMF-03      gcccgctgtggtgggcgcctgggcaccgctctgctcagccttctgtttga
                       ************ *************************************

A0A3B5KWG6_BMF-02      caggggcttcgtcgctggaggaggaggagcggggcggaggtga
A0A3B5KWG6_BMF-01      caggggcttcgtcgctggaggaggaggagcggggcggaggtga
A0A3B5KWG6_BMF-03      -------------------------------------------
                                                                  

© 1998-2020Legal notice