Dataset for CDS classical BH3-containing proteins of organism Sus scrofa

[Download (right click)] [Alignment] [Repertoires]

30 sequence(s)

>gnl|bcl2dbcds|A0A287AEF3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Sus scrofa GN=BAD (length=630 residues).
atgggcatcccagaaaatccctcatctgcttccacacacacccaaggaataaggaagtccggagctgaaccagggacccc
ggaggaaggcggtgggcggggccggagccgtagcggccccgcctcccagagcatgttccagatcccagagtttgagcaga
gtgagcaggaagactccagccctgcagacaggggcctgggccccagccccacagggacagacccccagccctggcgcacg
gccccaggccacctgggggaagctggtcaccagcaggggcagccggccagcagcagccaccatggaggcgctggggctgt
ggagacccggagtcgccacagctcttacccagaggggaccgaggaggatgaagggactgaggatgaggagctcagcccct
tccgcggccgatcgctctcggcgccccccatcctctgggctgcacagcgttatggccgcgagctccggaggatgagtgac
gagttccagggttccttcaagaagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagccccag
ctggaagcgcttcctccagtcctggtggtaccggaactcggggagaggaggccccgccccctcccaatga
>gnl|bcl2dbcds|A0A287AIU8_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Sus scrofa GN=BMF (length=507 residues).
atggagccacctcagtgtgtggaggagctggaggatgatgtgttccagccagaggaaggggagccggggacccagcccag
gagggtctctgctgacccgtttgtccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgcact
gctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagactctcagtccagcctccccgagccagggt
gtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcttgccccttggcgaacagccccccgaagg
gcagtggcaacatcgagcagaggtacagattgcccgaaaacttcagtgcattgcagaccagttccatcggcttcatatgc
agcagcaccagcagaaccaaaatcgtgtgtggtggcaaatcctcctgtttctacacaacctcgctttgcatggagatgag
aacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A287AIU8_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Sus scrofa GN=BMF (length=552 residues).
atggagccacctcagtgtgtggaggagctggaggatgatgtgttccagccagaggaaggggagccggggacccagcccag
gagggtctctgctgacccgtttgtccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgcact
gctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagactctcagtccagcctccccgagccagggt
gtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccctgc
cggtttccccgcaggcttgccccttggcgaacagccccccgaagggcagtggcaacatcgagcagaggtacagattgccc
gaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcagcaccagcagaaccaaaatcgtgtgtggtgg
caaatcctcctgtttctacacaacctcgctttgcatggagatgagaacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A480SCP6_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Sus scrofa GN=BBC3 (length=651 residues).
atggcttctggagcgtgtcccatcagtgggccagtgagcaggaacctgtcacaggccccagggagcgccatggcccgagc
acgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgtcccttccccctcagccgcctgg
tgccctccgccgtgtcctgcggcctctgcgaacccggtctgcctgccgcccccgccgcccccaccctgctgcccgctgcc
tacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagccg
gccccgaggcccgcgccccgacggtcctcagccctcactctcgccggcggagcagcacctggaatcgccagtgcccagcg
ctccgggggccctggcgggcggccccacccaagcagccccgggaatccggggggaggaggagcagtgggcccgagagatc
ggggcccagctgcggcggatggctgacgatctcaacgcgctgtacgagcggcggagacaagaggagcagcagcgacaccg
cccctcgccctggagggttctgtacaatctcatcatgggacttctgcccttacccaggggccgtggagcccccgagatgg
agcctaattag
>gnl|bcl2dbcds|A0A480SCP6_BBC3-04 BCL2 binding component 3 gene OS=[Eukaryota] Sus scrofa GN=BBC3 (length=1086 residues).
atgaccgtgtttgtgggaggttgtgctggccagccagtgccttgggtcagcccccccaccatggggggggcgtgtctctt
ggggccttctcacctgcctcccctccatctgggccttgtgtgtgttgtgggtgccagccctgggcttccctgcctgccac
gtgtcctcatgcctgggttcaagagtggggtgccctgtgtaccccagggaggggggtgccctgggggccggcctgatgcc
ccctgcacttctcagctgaccgtgcccctctgtcctgtcctgcaggccccagggagcgccatggcccgagcacgccagga
gggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgtcccttccccctcagccgcctggtgccctccg
ccgtgtcctgcggcctctgcgaacccggtctgcctgccgcccccgccgcccccaccctgctgcccgctgcctacctctgc
gcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagccggccccgagg
cccgcgccccgacggtcctcagccctcactctcgccggcggagcagcacctggaatcgccagtgcccagcgctccggggg
ccctggcgggcggccccacccaagcagccccgggaatccggggggaggaggagcagtgggcccgagagatcggggcccag
ctgcggcggatggctgacgatctcaacgcgctgtacgagcggcgggtgagtgctgggggaggggtagacggcaggtggga
cttcccgcggggagggggttgggggcgacccagccagatgtgcggcagctgctgccctgcgcggcggggtcgcgctgggg
acaggcaggtgggaggggcggcctgtccgcggagccaccgtaaggcccgcgctgcggctggcaccaccgggtcgagggcc
agggccggggcagcctcgagcgttacggtgtgcccgcggccggcggccggcggccggcggccgcgagaactgagggcggc
gctcagccgagcggctcatatatcccaggctatttatagccggtga
>gnl|bcl2dbcds|A0A480SCP6_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Sus scrofa GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgtcccttccccct
cagccgcctggtgccctccgccgtgtcctgcggcctctgcgaacccggtctgcctgccgcccccgccgcccccaccctgc
tgcccgctgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgccccgacggtcctcagccctcactctcgccggcggagcagcacctggaatcgcc
agtgcccagcgctccgggggccctggcgggcggccccacccaagcagccccgggaatccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggctgacgatctcaacgcgctgtacgagcggcggagacaagaggagcag
cagcgacaccgcccctcgccctggagggttctgtacaatctcatcatgggacttctgcccttacccaggggccgtggagc
ccccgagatggagcctaattag
>gnl|bcl2dbcds|A0A480SCP6_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Sus scrofa GN=BBC3 (length=393 residues).
gcgagagtcagtgcaggggctgcccgggcatgtccgtgcccagtgcccagggctttctgctcaccctggccccaccagat
tcatggtcctcagccctcactctcgccggcggagcagcacctggaatcgccagtgcccagcgctccgggggccctggcgg
gcggccccacccaagcagccccgggaatccggggggaggaggagcagtgggcccgagagatcggggcccagctgcggcgg
atggctgacgatctcaacgcgctgtacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctggagggt
tctgtacaatctcatcatgggacttctgcccttacccaggggccgtggagcccccgagatggagcctaattag
>gnl|bcl2dbcds|A0A4X1TMB1_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Sus scrofa GN=HRK (length=276 residues).
atgtgtccgtgccccctgcaccgcggccgcggccccccagccgtgtgcgcttgcagcgcgagccgcctgggtctgcgctc
ctccgccgcgcagctcactgccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgcagcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcagcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A4X1TQ35_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Sus scrofa GN=PMAIP1 (length=342 residues).
acctcagaggcttttgggcgttcagggtgttgcttttctagctctctcccgcttgctcgcttctgcccgaccgccccgcg
cgcagcctgctacctgcagagccaaggtgctcgggtccggggactgagttctcggagttttgcggcaaagttccggctgc
tgtttgcggagatgcctggaaggaggtctcgtaggaacactcagacgaaccctacgcgggtggccctcccgccagatcct
gaagtcgagtgtgccattcagttcagaaggattggagacaaactgaacttccggcagaaacttctgaatctgatagccaa
actcttccgcctaggaacctga
>gnl|bcl2dbcds|A0A4X1UQ42_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Sus scrofa GN=BMF (length=552 residues).
atggagccacctcagtgtgtggaggagctggaggatgatgtgttccagccagaggaaggggagccggggacccagcccag
gagggtctctgctgacccgtttgtccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgcact
gctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagactctcagtccagcctccccgagccagggt
gtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccctgc
cggtttccccgcaggcttgccccttggcgaacagccccctgaagggcagtggcaacatcgagcagaggtacagattgccc
gaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcagcaccagcagaaccaaaatcgtgtgtggtgg
caaatcctcctgtttctacacaacctcgctttgcatggagatgagaacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A4X1UQ42_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Sus scrofa GN=BMF (length=552 residues).
atggagccacctcagtgtgtggaggagctggaggatgatgtgttccagccagaggaaggggagccggggacccagcccag
gagggtctctgctgacccgtttgtccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgcact
gctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagactctcagtccagcctccccgagccagggt
gtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccctgc
cggtttccccgcaggcttgccccttggcgaacagccccctgaagggcagtggcaacatcgagcagaggtacagattgccc
gaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcagcaccagcagaaccaaaatcgtgtgtggtgg
caaatcctcctgtttctacacaacctcgctttgcatggagatgagaacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A4X1VE31_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Sus scrofa GN=BAD (length=639 residues).
atgggcatcccagaaaatccctcatctgcttccacacacacccaaggaataaggaagtccggagctgaaccagggacccc
ggaggaaggcggtgggcggggccggagccgccaggggtacctgtcccagagcatgttccagatcccagagtttgagcaga
gtgagcaggaagactccagccctgcagacaggggcctgggccccagccccacaggggacagacccccaggccccagcaag
ccctggcgcacggccccaggccacctgggggaagctggtcaccagcaggggcagccggccagcagcagccaccatggagg
cgctggggctgtggagacccggagtcgccacagctcttacccagaggggaccgaggaggatgaagggactgaggatgagg
agctcagccccttccgcggccgatcgctctcggcgccccccatcctctgggctgcacagcgttatggccgcgagctccgg
aggatgagtgacgagttccagggttccttcaagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggca
aagccccagctggaagcgcttcctccagtcctggtggtaccggaactcggggagaggaggccccgccccctcccaatga
>gnl|bcl2dbcds|A0A4X1VE31_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Sus scrofa GN=BAD (length=663 residues).
atggggagctcaggcggaaagaagttgtggctggccaggccctccccctcaacagaggaacccttgcctttgccgagcac
aggcaaccggggtccctcactcagagcccagagcatgttccagatcccagagtttgagcagagtgagcaggaagactcca
gccctgcagacaggggcctgggccccagccccacaggggacagacccccaggccccagcaagccctggcgcacggcccca
ggccacctgggggaagctggtcaccagcaggggcagccggccagcagcagccaccatggaggcgctggggctgtggagac
ccggagtcgccacagctcttacccagaggggaccgaggaggatgaagggactgaggatgaggagctcagccccttccgcg
gccgatcgctctcggcgccccccatcctctgggctgcacagcgttatggccgcgagctccggaggatgagtgacgagttc
cagggttccttcaaggtgagcgcgcgcgtgggactgtaccctcgagtctcctcccaatgggctgtcccgttcgagtccca
gggcctttcgggatctgaggtccaggcccccctccagaaggccaagactcctggcttccccaaatccttgaagcgcgagg
caggctggcatctgggctcctga
>gnl|bcl2dbcds|A0A4X1VE31_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Sus scrofa GN=BAD (length=510 residues).
atgttccagatcccagagtttgagcagagtgagcaggaagactccagccctgcagacaggggcctgggccccagccccac
aggggacagacccccaggccccagcaagccctggcgcacggccccaggccacctgggggaagctggtcaccagcaggggc
agccggccagcagcagccaccatggaggcgctggggctgtggagacccggagtcgccacagctcttacccagaggggacc
gaggaggatgaagggactgaggatgaggagctcagccccttccgcggccgatcgctctcggcgccccccatcctctgggc
tgcacagcgttatggccgcgagctccggaggatgagtgacgagttccagggttccttcaagaagggacttcctcgcccga
agagcgcgggcacagcgacgcagatgcggcaaagccccagctggaagcgcttcctccagtcctggtggtaccggaactcg
gggagaggaggccccgccccctcccaatga
>gnl|bcl2dbcds|A0A4X1VRX9_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacaaacagagcggcaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctcaggctgaa
cccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaag
gagggtctttctgaataattaccaagcagccgaagcccaccctcagatggttatcttacgactgttacgctacatcgccc
gtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A4X1VRX9_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacaaacagagcggcaaggtaatccggaaggagaaggggaccgctgcccccaag
gcagcccccagggcccactggccccaccgaccagccctggcccctttgctaccagatccccgcttttcatcttcgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
aggctgaacccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatat
tacccaaggagggtctttctgaataattaccaagcagccgaagcccaccctcagatggttatcttacgactgttacgcta
catcgcccgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A4X1VRX9_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=552 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacaaacagagcggcaaggtaatccggaaggagaaggggaccgctgcccccaag
gcagcccccagggcccactggccccaccgaccagccctggcccctttgctaccagatccccgcttttcatcttcgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
aggctgaacccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatat
tacccaaggagggtaatgctgttttctttaccccccttttcccctcacaccctccctcccccttacatttaa
>gnl|bcl2dbcds|A0A4X1VRX9_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=264 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacaaacagagcggcaagcttccatgaggcagtctcaggctgaacccgcagata
tgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaaggaggctagca
gaatgtctggcatcccacacctga
>gnl|bcl2dbcds|A0A4X1VRX9_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=504 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacaaacagagcggcaaggtaatccggaaggagaaggggaccgctgcccccaag
gcagcccccagggcccactggccccaccgaccagccctggcccctttgctaccagatccccgcttttcatcttcgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
aggctgaacccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatat
tacccaaggaggttagaacaatag
>gnl|bcl2dbcds|A0A4X1VVX9_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Sus scrofa GN=BBC3 (length=576 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgtcccttccccct
cagccgcctggtgccctccgccgtgtcctgcggcctctgcgaacccggtctgcctgccgcccccgccgcccccaccctgc
tgcccgctgcctacctctgcgccaccgcccccgccgtcaccgccgccctggggggcccccgctggcctgggggtccccgc
agccggccccgaggcccgcgccccgacggtcctcagccctcactctcgccggcggagcagcacctggaatcgccagtgcc
cagcgctccgggggccctggcgggcggccccacccaagcagccccgggaatccggggggaggaggagcagtgggcccgag
agatcggggcccagctgcggcggatggctgacgatctcaacgcgctgtacgagcggcggagacaagaggagcagcagcga
caccgcccctcgccctggagggttctgtacaatctcatcatgggacttctgcccttacccaggggccgtggagcccccga
gatggagcctaattag
>gnl|bcl2dbcds|A0A4X1VVX9_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Sus scrofa GN=BBC3 (length=393 residues).
gcgagagtcagtgcaggggctgcccgggcatgtccgtgcccagtgcccagggctttctgctcaccctggccccaccagat
tcatggtcctcagccctcactctcgccggcggagcagcacctggaatcgccagtgcccagcgctccgggggccctggcgg
gcggccccacccaagcagccccgggaatccggggggaggaggagcagtgggcccgagagatcggggcccagctgcggcgg
atggctgacgatctcaacgcgctgtacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctggagggt
tctgtacaatctcatcatgggacttctgcccttacccaggggccgtggagcccccgagatggagcctaattag
>gnl|bcl2dbcds|A0A5G2QUY1_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=1095 residues).
gaaactcccgatatagagccagggctctcggggctcctgaggctttccgcgggcggcagcggcggggtctggtttacact
gtattcggagcgccccctctgttccacgcgcactcctaggccaccgctggttggggaagaggagaggttacactttgagt
tgggggatgggtgcgcactgagccatccgcagccaagtcactccagtaaacacgcccggcgggggcagggcggtaggcgc
gcgcagcggggaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtcagcggctgcagcggcgcgga
ggcggggctttccagcccgcgcgctgggcgggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgcagcctccaggtctcgagcttgcaggagcgt
ttggtcccacgtcgccgccgccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacagtcgccctgcg
cgtcctgttctctgcggccagcatcgcttcagactgctgggttcgccccgctcccgccgccgccactcactcggcgccct
tcccctggccctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaaaaaaagaccaaatggcaaag
caaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
tggggcccccacctctctacaaacagagcggcaagacaggagcccagcacccatgagttgtgacaaatcaacacaaaccc
caagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctcaggctgaacccgcagat
atgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaaggagggtaat
gctgttttctttaccccccttttcccctcacaccctccctcccccttacatttaa
>gnl|bcl2dbcds|A0A5G2QUY1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=1302 residues).
gaaactcccgatatagagccagggctctcggggctcctgaggctttccgcgggcggcagcggcggggtctggtttacact
gtattcggagcgccccctctgttccacgcgcactcctaggccaccgctggttggggaagaggagaggttacactttgagt
tgggggatgggtgcgcactgagccatccgcagccaagtcactccagtaaacacgcccggcgggggcagggcggtaggcgc
gcgcagcggggaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtcagcggctgcagcggcgcgga
ggcggggctttccagcccgcgcgctgggcgggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgcagcctccaggtctcgagcttgcaggagcgt
ttggtcccacgtcgccgccgccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacagtcgccctgcg
cgtcctgttctctgcggccagcatcgcttcagactgctgggttcgccccgctcccgccgccgccactcactcggcgccct
tcccctggccctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaaaaaaagaccaaatggcaaag
caaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
tggggcccccacctctctacaaacagagcggcaaggtaatccggaaggagaaggggaccgctgcccccaaggcagccccc
agggcccactggccccaccgaccagccctggcccctttgctaccagatccccgcttttcatcttcgtgagaagatcctcc
ctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtgacaaatcaac
acaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctcaggctgaac
ccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaagg
agggtctttctgaataattaccaagcagccgaagcccaccctcagatggttatcttacgactgttacgctacatcgcccg
tctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A5G2QUY1_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=1215 residues).
gaaactcccgatatagagccagggctctcggggctcctgaggctttccgcgggcggcagcggcggggtctggtttacact
gtattcggagcgccccctctgttccacgcgcactcctaggccaccgctggttggggaagaggagaggttacactttgagt
tgggggatgggtgcgcactgagccatccgcagccaagtcactccagtaaacacgcccggcgggggcagggcggtaggcgc
gcgcagcggggaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtcagcggctgcagcggcgcgga
ggcggggctttccagcccgcgcgctgggcgggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgcagcctccaggtctcgagcttgcaggagcgt
ttggtcccacgtcgccgccgccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacagtcgccctgcg
cgtcctgttctctgcggccagcatcgcttcagactgctgggttcgccccgctcccgccgccgccactcactcggcgccct
tcccctggccctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaaaaaaagaccaaatggcaaag
caaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
tggggcccccacctctctacaaacagagcggcaaggtaatccggaaggagaaggggaccgctgcccccaaggcagccccc
agggcccactggccccaccgaccagccctggcccctttgctaccagatccccgcttttcatcttcgtgagaagatcctcc
ctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtgacaaatcaac
acaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctcaggctgaac
ccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaagg
aggttagaacaatag
>gnl|bcl2dbcds|A0A5G2QUY1_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=264 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacaaacagagcggcaagcttccatgaggcagtctcaggctgaacccgcagata
tgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaaggaggctagca
gaatgtctggcatcccacacctga
>gnl|bcl2dbcds|C1KGB6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=552 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacagacagagcggcaaggtaatccggaaggagaaggggaccgctgcccccaag
gcagcccccagggcccactggccccaccgaccagccctggcccctttgctaccagatccccgcttttcatcttcgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
aggctgaacccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatat
tacccaaggagggtaatgctgttttctttaccccccttttcccctcacaccctccctcccccttacatttaa
>gnl|bcl2dbcds|C1KGB7_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=384 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacagacagagcggcaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctcaggctgaa
cccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaag
gagggtaatgctgttttctttaccccccttttcccctcacaccctccctcccccttacatttaa
>gnl|bcl2dbcds|C1KGB8_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=294 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacagacagagcggcaagcttccatgaggcagtctcaggctgaacccgcagata
tgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaaggagggtaatg
ctgttttctttaccccccttttcccctcacaccctccctcccccttacatttaa
>gnl|bcl2dbcds|F1SMU1_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Sus scrofa GN=PMAIP1 (length=366 residues).
gcgcgggcagcggcgggagcgccaacctcagaggcttttgggcgttcagggtgttgcttttctagctctctcccgcttgc
tcgcttctgcccgaccgccccgcgcgcagcctgctacctgcagagccaaggtgctcgggtccggggactgagttctcgga
gttttgcggcaaagttccggctgctgtttgcggagatgcctggaaggaggtctcgtaggaacactcagacgaaccctacg
cgggtggccctcccgccagatcctgaagtcgagtgtgccattcagttcagaaggattggagacaaactgaacttccggca
gaaacttctgaatctgatagccaaactcttccgcctaggaacctga
>gnl|bcl2dbcds|Q9GL49_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Sus scrofa GN=PMAIP1 (length=531 residues).
atgcgttcttccggatcgcttggctctaggattcgggggctgttggaatcggcaggatgggaggaattggtaagaagcca
gccccgggcacatcaaggtctcaccagtggccggtgtgggcagacgaggcgggaggagcttcgtggttccttcggtccgc
ctcccgctgccgtccgaggaaaccaaccaacctcagaggcttttgggcgttcagggtgttgcttttctagctctctcccg
cttgctcgcttctgcccgaccgccccgcgcgcagcctgctacctgcagagccaaggtgctcgggtccggggactgagttc
tcggagttttgcggcaaagttccggctgctgtttgcggagatgcctggaaggaggtctcgtaggaacactcagacgaacc
ctacgcgggtggccctcccgccagatcctgaagtcgagtgtgccattcagttcagaaggattggagacaaactgaacttc
cggcagaaacttctgaatctgatagccaaactcttccgtctaggaacctga
© 1998-2020Legal notice