Dataset for CDS classical BH3-containing proteins of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

30 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4X1UQ42_BMF-02       --------------------------------------------------
A0A4X1UQ42_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A4X1VE31_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A4X1VE31_BAD-03       --------------------------------------------------
A0A4X1VE31_BAD-02       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      gaaactcccgatatagagccagggctctcggggctcctgaggctttccgc
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      gaaactcccgatatagagccagggctctcggggctcctgaggctttccgc
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      gaaactcccgatatagagccagggctctcggggctcctgaggctttccgc
A0A4X1TMB1_HRK-01       --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      --------------------------------------------------
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
                                                                          

A0A4X1UQ42_BMF-02       --------------------------------------------------
A0A4X1UQ42_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A4X1VE31_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A4X1VE31_BAD-03       --------------------------------------------------
A0A4X1VE31_BAD-02       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      gggcggcagcggcggggtctggtttacactgtattcggagcgccccctct
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      gggcggcagcggcggggtctggtttacactgtattcggagcgccccctct
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      gggcggcagcggcggggtctggtttacactgtattcggagcgccccctct
A0A4X1TMB1_HRK-01       --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      --------------------------------------------------
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
                                                                          

A0A4X1UQ42_BMF-02       --------------------------------------------------
A0A4X1UQ42_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A4X1VE31_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A4X1VE31_BAD-03       --------------------------------------------------
A0A4X1VE31_BAD-02       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      gttccacgcgcactcctaggccaccgctggttggggaagaggagaggtta
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      gttccacgcgcactcctaggccaccgctggttggggaagaggagaggtta
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      gttccacgcgcactcctaggccaccgctggttggggaagaggagaggtta
A0A4X1TMB1_HRK-01       --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      --------------------------------------------------
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
                                                                          

A0A4X1UQ42_BMF-02       --------------------------------------------------
A0A4X1UQ42_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A4X1VE31_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A4X1VE31_BAD-03       --------------------------------------------------
A0A4X1VE31_BAD-02       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      cactttgagttgggggatgggtgcgcactgagccatccgcagccaagtca
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      cactttgagttgggggatgggtgcgcactgagccatccgcagccaagtca
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      cactttgagttgggggatgggtgcgcactgagccatccgcagccaagtca
A0A4X1TMB1_HRK-01       --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      --------------------------------------------------
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
                                                                          

A0A4X1UQ42_BMF-02       --------------------------------------------------
A0A4X1UQ42_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A4X1VE31_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A4X1VE31_BAD-03       --------------------------------------------------
A0A4X1VE31_BAD-02       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      ctccagtaaacacgcccggcgggggcagggcggtaggcgcgcgcagcggg
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      ctccagtaaacacgcccggcgggggcagggcggtaggcgcgcgcagcggg
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      ctccagtaaacacgcccggcgggggcagggcggtaggcgcgcgcagcggg
A0A4X1TMB1_HRK-01       --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      --------------------------------------------------
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
                                                                          

A0A4X1UQ42_BMF-02       --------------------------------------------------
A0A4X1UQ42_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A4X1VE31_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A4X1VE31_BAD-03       --------------------------------------------------
A0A4X1VE31_BAD-02       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      gaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtc
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      gaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtc
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      gaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtc
A0A4X1TMB1_HRK-01       --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      --------------------------------------------------
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
                                                                          

A0A4X1UQ42_BMF-02       --------------------------------------------------
A0A4X1UQ42_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A4X1VE31_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A4X1VE31_BAD-03       --------------------------------------------------
A0A4X1VE31_BAD-02       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      agcggctgcagcggcgcggaggcggggctttccagcccgcgcgctgggcg
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      agcggctgcagcggcgcggaggcggggctttccagcccgcgcgctgggcg
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      agcggctgcagcggcgcggaggcggggctttccagcccgcgcgctgggcg
A0A4X1TMB1_HRK-01       --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      --------------------------------------------------
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
                                                                          

A0A4X1UQ42_BMF-02       --------------------------------------------------
A0A4X1UQ42_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A4X1VE31_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A4X1VE31_BAD-03       --------------------------------------------------
A0A4X1VE31_BAD-02       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      ggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      ggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      ggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
A0A4X1TMB1_HRK-01       --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      -----------------------------------------------atg
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
                                                                          

A0A4X1UQ42_BMF-02       --------------------------------------------------
A0A4X1UQ42_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A4X1VE31_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A4X1VE31_BAD-03       --------------------------------------------------
A0A4X1VE31_BAD-02       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgc
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgc
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgc
A0A4X1TMB1_HRK-01       --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      accgtgtttgtgggaggttgtgctggccagccagtgccttgggtcagccc
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      atggcttctggagcgtgtcccatcagtgggccagtgagcaggaacc----
A0A480SCP6_BBC3-03      --------------------------------------------------
                                                                          

A0A4X1UQ42_BMF-02       --------------------------------------------------
A0A4X1UQ42_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A4X1VE31_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A4X1VE31_BAD-03       --------------------------------------------------
A0A4X1VE31_BAD-02       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      agcctccaggtctcgagcttgcaggagcgtttggtcccacgtcgccgccg
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      agcctccaggtctcgagcttgcaggagcgtttggtcccacgtcgccgccg
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      agcctccaggtctcgagcttgcaggagcgtttggtcccacgtcgccgccg
A0A4X1TMB1_HRK-01       --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      ccccaccatggggggggcgtgtctcttggggccttctcacctgcctcccc
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
                                                                          

A0A4X1UQ42_BMF-02       --------------------------------------------------
A0A4X1UQ42_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A4X1VE31_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A4X1VE31_BAD-03       --------------------------------------------------
A0A4X1VE31_BAD-02       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      ccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacag
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      ccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacag
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      ccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacag
A0A4X1TMB1_HRK-01       --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      tccatctgggccttgtgtgtgttgtgggtgccagccctgggcttccctgc
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
                                                                          

A0A4X1UQ42_BMF-02       --------------------------------------------------
A0A4X1UQ42_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A4X1VE31_BAD-01       -------------------------------------------------a
A0A287AEF3_BAD-01       -------------------------------------------------a
A0A4X1VE31_BAD-03       -------------------------------------------------a
A0A4X1VE31_BAD-02       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      tcgccctgcgcgtcctgttctctgcggccagcatcgcttcagactgctgg
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      tcgccctgcgcgtcctgttctctgcggccagcatcgcttcagactgctgg
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      tcgccctgcgcgtcctgttctctgcggccagcatcgcttcagactgctgg
A0A4X1TMB1_HRK-01       --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      ctgccacgtgtcctcatgcctgggttcaagagtggggtgccctgtgtacc
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
                                                                          

A0A4X1UQ42_BMF-02       --------------------------------------------------
A0A4X1UQ42_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
Q9GL49_PMAIP1-01        ------------------------atgcgttcttccggatcgcttggctc
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A4X1VE31_BAD-01       tggggagctcaggcggaaagaagttgtggctggccaggccctccccctca
A0A287AEF3_BAD-01       tgggcatccca---gaaaatccctcatctgcttccacacacacccaagga
A0A4X1VE31_BAD-03       tgggcatccca---gaaaatccctcatctgcttccacacacacccaagga
A0A4X1VE31_BAD-02       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      gttcgccccgctcccgccgccgccactcactcggcgcccttcccctggcc
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      gttcgccccgctcccgccgccgccactcactcggcgcccttcccctggcc
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      gttcgccccgctcccgccgccgccactcactcggcgcccttcccctggcc
A0A4X1TMB1_HRK-01       --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      ccagggaggggggtgccctgggggccggcctgatgccccctgcacttctc
A0A4X1VVX9_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-02      --------------------------------------------------
A0A480SCP6_BBC3-03      --------------------------------------------------
                                                                          

A0A4X1UQ42_BMF-02       --------------------------------------------------
A0A4X1UQ42_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
Q9GL49_PMAIP1-01        taggattcgggggctgttggaatcggcaggatgggaggaattggtaagaa
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A4X1VE31_BAD-01       acagaggaacccttgcctttgccgagcac------------aggcaaccg
A0A287AEF3_BAD-01       ataaggaagtccggagctgaaccagggaccccggaggaaggcggtgggcg
A0A4X1VE31_BAD-03       ataaggaagtccggagctgaaccagggaccccggaggaaggcggtgggcg
A0A4X1VE31_BAD-02       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      ctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaa
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      ctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaa
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      ctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaa
A0A4X1TMB1_HRK-01       --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      agctgaccgtgcccctctgtcctgtcctgcaggccccagggagcgccatg
A0A4X1VVX9_BBC3-02      -----------------------------------------------atg
A0A480SCP6_BBC3-02      ------------------------tgtcacaggccccagggagcgccatg
A0A480SCP6_BBC3-03      -----------------------------------------------atg
                                                                          

A0A4X1UQ42_BMF-02       ----------------atggagccacctcagtgtgtgg-------aggag
A0A4X1UQ42_BMF-01       ----------------atggagccacctcagtgtgtgg-------aggag
A0A287AIU8_BMF-02       ----------------atggagccacctcagtgtgtgg-------aggag
A0A287AIU8_BMF-01       ----------------atggagccacctcagtgtgtgg-------aggag
Q9GL49_PMAIP1-01        gccagccccgggcacatcaaggtctcaccagtggccggtgtgggcagacg
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        -------------------------------------------gcgcggg
A0A4X1VE31_BAD-01       gggtccctcactcagag---------cccagagcatgttccagat----c
A0A287AEF3_BAD-01       gggccggagccgtagcggccccgcctcccagagcatgttccagat----c
A0A4X1VE31_BAD-03       gggccggagccgccaggggtacctgtcccagagcatgttccagat----c
A0A4X1VE31_BAD-02       ----------------------------------atgttccagat----c
A0A4X1VRX9_BCL2L11      -----------atggcaaagcaaccttccgatgtaagttctgagtgtgac
A0A5G2QUY1_BCL2L11      -----------atggcaaagcaaccttccgatgtaagttctgagtgtgac
A0A5G2QUY1_BCL2L11      aaaaagaccaaatggcaaagcaaccttccgatgtaagttctgagtgtgac
C1KGB8_BCL2L11-01       -----------atggcaaagcaaccttccgatgtaagttctgagtgtgac
A0A4X1VRX9_BCL2L11      -----------atggcaaagcaaccttccgatgtaagttctgagtgtgac
C1KGB6_BCL2L11-01       -----------atggcaaagcaaccttccgatgtaagttctgagtgtgac
C1KGB7_BCL2L11-01       -----------atggcaaagcaaccttccgatgtaagttctgagtgtgac
A0A4X1VRX9_BCL2L11      -----------atggcaaagcaaccttccgatgtaagttctgagtgtgac
A0A5G2QUY1_BCL2L11      aaaaagaccaaatggcaaagcaaccttccgatgtaagttctgagtgtgac
A0A4X1VRX9_BCL2L11      -----------atggcaaagcaaccttccgatgtaagttctgagtgtgac
A0A4X1VRX9_BCL2L11      -----------atggcaaagcaaccttccgatgtaagttctgagtgtgac
A0A5G2QUY1_BCL2L11      aaaaagaccaaatggcaaagcaaccttccgatgtaagttctgagtgtgac
A0A4X1TMB1_HRK-01       --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------gcgagagtcagt------------
A0A4X1VVX9_BBC3-01      --------------------------gcgagagtcagt------------
A0A480SCP6_BBC3-04      gcccgagcacgccaggagggcagctccccggagcccgt------------
A0A4X1VVX9_BBC3-02      gcccgagcacgccaggagggcagctccccggagcccgt------------
A0A480SCP6_BBC3-02      gcccgagcacgccaggagggcagctccccggagcccgt------------
A0A480SCP6_BBC3-03      gcccgagcacgccaggagggcagctccccggagcccgt------------
                                                                          

A0A4X1UQ42_BMF-02       ctggaggatgatgtgttccagccag-aggaaggggagccggggacccagc
A0A4X1UQ42_BMF-01       ctggaggatgatgtgttccagccag-aggaaggggagccggggacccagc
A0A287AIU8_BMF-02       ctggaggatgatgtgttccagccag-aggaaggggagccggggacccagc
A0A287AIU8_BMF-01       ctggaggatgatgtgttccagccag-aggaaggggagccggggacccagc
Q9GL49_PMAIP1-01        aggcgggaggagcttcgtggttccttcggtccgcctcccgctgccgtccg
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        cagcggcgggagc-------------------------------------
A0A4X1VE31_BAD-01       ccagagtttgagcagagtgagcaggaagactccagccctgcagacagggg
A0A287AEF3_BAD-01       ccagagtttgagcagagtgagcaggaagactccagccctgcagacagggg
A0A4X1VE31_BAD-03       ccagagtttgagcagagtgagcaggaagactccagccctgcagacagggg
A0A4X1VE31_BAD-02       ccagagtttgagcagagtgagcaggaagactccagccctgcagacagggg
A0A4X1VRX9_BCL2L11      agagaaggtggacagttgcagcctg-cggaaaggcctcctcagctcaggc
A0A5G2QUY1_BCL2L11      agagaaggtggacagttgcagcctg-cggaaaggcctcctcagctcaggc
A0A5G2QUY1_BCL2L11      agagaaggtggacagttgcagcctg-cggaaaggcctcctcagctcaggc
C1KGB8_BCL2L11-01       agagaaggtggacagttgcagcctg-cggaaaggcctcctcagctcaggc
A0A4X1VRX9_BCL2L11      agagaaggtggacagttgcagcctg-cggaaaggcctcctcagctcaggc
C1KGB6_BCL2L11-01       agagaaggtggacagttgcagcctg-cggaaaggcctcctcagctcaggc
C1KGB7_BCL2L11-01       agagaaggtggacagttgcagcctg-cggaaaggcctcctcagctcaggc
A0A4X1VRX9_BCL2L11      agagaaggtggacagttgcagcctg-cggaaaggcctcctcagctcaggc
A0A5G2QUY1_BCL2L11      agagaaggtggacagttgcagcctg-cggaaaggcctcctcagctcaggc
A0A4X1VRX9_BCL2L11      agagaaggtggacagttgcagcctg-cggaaaggcctcctcagctcaggc
A0A4X1VRX9_BCL2L11      agagaaggtggacagttgcagcctg-cggaaaggcctcctcagctcaggc
A0A5G2QUY1_BCL2L11      agagaaggtggacagttgcagcctg-cggaaaggcctcctcagctcaggc
A0A4X1TMB1_HRK-01       ----------------atgtgtccg-tgccccctgcaccgcggcc---gc
A0A480SCP6_BBC3-01      gcaggggct-gcccgggcatgtccg-tgcc--------------------
A0A4X1VVX9_BBC3-01      gcaggggct-gcccgggcatgtccg-tgcc--------------------
A0A480SCP6_BBC3-04      agagggcctggcccgcgacggcccg-cgtcccttccccctcagcc---gc
A0A4X1VVX9_BBC3-02      agagggcctggcccgcgacggcccg-cgtcccttccccctcagcc---gc
A0A480SCP6_BBC3-02      agagggcctggcccgcgacggcccg-cgtcccttccccctcagcc---gc
A0A480SCP6_BBC3-03      agagggcctggcccgcgacggcccg-cgtcccttccccctcagcc---gc
                                                                          

A0A4X1UQ42_BMF-02       ccaggagggtctctgctgacccgtttgtccagagccagctgg--------
A0A4X1UQ42_BMF-01       ccaggagggtctctgctgacccgtttgtccagagccagctgg--------
A0A287AIU8_BMF-02       ccaggagggtctctgctgacccgtttgtccagagccagctgg--------
A0A287AIU8_BMF-01       ccaggagggtctctgctgacccgtttgtccagagccagctgg--------
Q9GL49_PMAIP1-01        aggaaa-----ccaaccaacctcagaggcttttgggcgttca--------
A0A4X1TQ35_PMAIP1-      ------------------acctcagaggcttttgggcgttca--------
F1SMU1_PMAIP1-01        --------------gccaacctcagaggcttttgggcgttca--------
A0A4X1VE31_BAD-01       cctggg-----cc--ccagccccacaggggacagacccccag--------
A0A287AEF3_BAD-01       cctggg-----cc--ccagccccaca-gggacagaccccc----------
A0A4X1VE31_BAD-03       cctggg-----cc--ccagccccacaggggacagacccccag--------
A0A4X1VE31_BAD-02       cctggg-----cc--ccagccccacaggggacagacccccag--------
A0A4X1VRX9_BCL2L11      ctgggg-----cc--cccacctctctacaaacagagcggcaa--------
A0A5G2QUY1_BCL2L11      ctgggg-----cc--cccacctctctacaaacagagcggcaa--------
A0A5G2QUY1_BCL2L11      ctgggg-----cc--cccacctctctacaaacagagcggca---------
C1KGB8_BCL2L11-01       ctgggg-----cc--cccacctctctacagacagagcggcaa--------
A0A4X1VRX9_BCL2L11      ctgggg-----cc--cccacctctctacaaacagagcggcaaggtaatcc
C1KGB6_BCL2L11-01       ctgggg-----cc--cccacctctctacagacagagcggcaaggtaatcc
C1KGB7_BCL2L11-01       ctgggg-----cc--cccacctctctacagacagagcggca---------
A0A4X1VRX9_BCL2L11      ctgggg-----cc--cccacctctctacaaacagagcggcaaggtaatcc
A0A5G2QUY1_BCL2L11      ctgggg-----cc--cccacctctctacaaacagagcggcaaggtaatcc
A0A4X1VRX9_BCL2L11      ctgggg-----cc--cccacctctctacaaacagagcggca---------
A0A4X1VRX9_BCL2L11      ctgggg-----cc--cccacctctctacaaacagagcggcaaggtaatcc
A0A5G2QUY1_BCL2L11      ctgggg-----cc--cccacctctctacaaacagagcggcaaggtaatcc
A0A4X1TMB1_HRK-01       ---ggc-----cc--cccagccgtgtgcgcttgcagcgcgag--------
A0A480SCP6_BBC3-01      --------------------cagtgc---ccagggctttctg--------
A0A4X1VVX9_BBC3-01      --------------------cagtgc---ccagggctttctg--------
A0A480SCP6_BBC3-04      ctggtg-----cc--ctccgccgtgt---cctgcggcctctg--------
A0A4X1VVX9_BBC3-02      ctggtg-----cc--ctccgccgtgt---cctgcggcctctg--------
A0A480SCP6_BBC3-02      ctggtg-----cc--ctccgccgtgt---cctgcggcctctg--------
A0A480SCP6_BBC3-03      ctggtg-----cc--ctccgccgtgt---cctgcggcctctg--------
                                            *                             

A0A4X1UQ42_BMF-02       ---------------------------------actgccccctcagccgt
A0A4X1UQ42_BMF-01       ---------------------------------actgccccctcagccgt
A0A287AIU8_BMF-02       ---------------------------------actgccccctcagccgt
A0A287AIU8_BMF-01       ---------------------------------actgccccctcagccgt
Q9GL49_PMAIP1-01        -----------------------------gggtgttgcttttctagctct
A0A4X1TQ35_PMAIP1-      -----------------------------gggtgttgcttttctagctct
F1SMU1_PMAIP1-01        -----------------------------gggtgttgcttttctagctct
A0A4X1VE31_BAD-01       ---------------------------------------gccccagcaag
A0A287AEF3_BAD-01       ------------------------------------------------ag
A0A4X1VE31_BAD-03       ---------------------------------------gccccagcaag
A0A4X1VE31_BAD-02       ---------------------------------------gccccagcaag
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      ggaaggagaaggggaccgctgcccccaaggcagcccccagggcccactgg
C1KGB6_BCL2L11-01       ggaaggagaaggggaccgctgcccccaaggcagcccccagggcccactgg
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      ggaaggagaaggggaccgctgcccccaaggcagcccccagggcccactgg
A0A5G2QUY1_BCL2L11      ggaaggagaaggggaccgctgcccccaaggcagcccccagggcccactgg
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A4X1VRX9_BCL2L11      ggaaggagaaggggaccgctgcccccaaggcagcccccagggcccactgg
A0A5G2QUY1_BCL2L11      ggaaggagaaggggaccgctgcccccaaggcagcccccagggcccactgg
A0A4X1TMB1_HRK-01       --------------------ccgcctgggtctgc------------gctc
A0A480SCP6_BBC3-01      --------------------ctcacc--------------------ctgg
A0A4X1VVX9_BBC3-01      --------------------ctcacc--------------------ctgg
A0A480SCP6_BBC3-04      --------------------cgaacccggtctgcctgccgcccccgccgc
A0A4X1VVX9_BBC3-02      --------------------cgaacccggtctgcctgccgcccccgccgc
A0A480SCP6_BBC3-02      --------------------cgaacccggtctgcctgccgcccccgccgc
A0A480SCP6_BBC3-03      --------------------cgaacccggtctgcctgccgcccccgccgc
                                                                          

A0A4X1UQ42_BMF-02       ctgcagctcttccctctcacgc----------------------------
A0A4X1UQ42_BMF-01       ctgcagctcttccctctcacgc----------------------------
A0A287AIU8_BMF-02       ctgcagctcttccctctcacgc----------------------------
A0A287AIU8_BMF-01       ctgcagctcttccctctcacgc----------------------------
Q9GL49_PMAIP1-01        ctcccgcttgctcgcttctgcc----------------------------
A0A4X1TQ35_PMAIP1-      ctcccgcttgctcgcttctgcc----------------------------
F1SMU1_PMAIP1-01        ctcccgcttgctcgcttctgcc----------------------------
A0A4X1VE31_BAD-01       ccctggcgcacggccccaggcc----------------------------
A0A287AEF3_BAD-01       ccctggcgcacggccccaggcc----------------------------
A0A4X1VE31_BAD-03       ccctggcgcacggccccaggcc----------------------------
A0A4X1VE31_BAD-02       ccctggcgcacggccccaggcc----------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      ccccaccgaccagccctggcccctttgctaccagatccccgcttttcatc
C1KGB6_BCL2L11-01       ccccaccgaccagccctggcccctttgctaccagatccccgcttttcatc
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      ccccaccgaccagccctggcccctttgctaccagatccccgcttttcatc
A0A5G2QUY1_BCL2L11      ccccaccgaccagccctggcccctttgctaccagatccccgcttttcatc
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A4X1VRX9_BCL2L11      ccccaccgaccagccctggcccctttgctaccagatccccgcttttcatc
A0A5G2QUY1_BCL2L11      ccccaccgaccagccctggcccctttgctaccagatccccgcttttcatc
A0A4X1TMB1_HRK-01       ctccgccgcgcagctcactgcc----------------------------
A0A480SCP6_BBC3-01      ccccacc-------------------------------------------
A0A4X1VVX9_BBC3-01      ccccacc-------------------------------------------
A0A480SCP6_BBC3-04      ccccaccctgctgcccgctgcctacctctgcgcccccaccgc--------
A0A4X1VVX9_BBC3-02      ccccaccctgctgcccgctgcctacctctgcgccaccgcc----------
A0A480SCP6_BBC3-02      ccccaccctgctgcccgctgcctacctctgcgcccccaccgc--------
A0A480SCP6_BBC3-03      ccccaccctgctgcccgctgcctacctctgcgcccccaccgc--------
                                                                          

A0A4X1UQ42_BMF-02       --------------------------------------------------
A0A4X1UQ42_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
Q9GL49_PMAIP1-01        ---------------------------cgaccgccccgcgcgcagcctgc
A0A4X1TQ35_PMAIP1-      ---------------------------cgaccgccccgcgcgcagcctgc
F1SMU1_PMAIP1-01        ---------------------------cgaccgccccgcgcgcagcctgc
A0A4X1VE31_BAD-01       ---------------------------------acctgggggaagctggt
A0A287AEF3_BAD-01       ---------------------------------acctgggggaagctggt
A0A4X1VE31_BAD-03       ---------------------------------acctgggggaagctggt
A0A4X1VE31_BAD-02       ---------------------------------acctgggggaagctggt
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      ttcgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctc
C1KGB6_BCL2L11-01       ttcgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctc
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      ttcgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctc
A0A5G2QUY1_BCL2L11      ttcgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctc
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A4X1VRX9_BCL2L11      ttcgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctc
A0A5G2QUY1_BCL2L11      ttcgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctc
A0A4X1TMB1_HRK-01       --------------------------------------------------
A0A480SCP6_BBC3-01      --------------------------------------------------
A0A4X1VVX9_BBC3-01      --------------------------------------------------
A0A480SCP6_BBC3-04      -------------cccgcccgccgtcaccgccgccctggggggcccccgc
A0A4X1VVX9_BBC3-02      -----------------cccgccgtcaccgccgccctggggggcccccgc
A0A480SCP6_BBC3-02      -------------cccgcccgccgtcaccgccgccctggggggcccccgc
A0A480SCP6_BBC3-03      -------------cccgcccgccgtcaccgccgccctggggggcccccgc
                                                                          

A0A4X1UQ42_BMF-02       -actgctgtggccctgggcttcgacccaccagccaggaa---gacaaggc
A0A4X1UQ42_BMF-01       -actgctgtggccctgggcttcgacccaccagccaggaa---gacaaggc
A0A287AIU8_BMF-02       -actgctgtggccctgggcttcgacccaccagccaggaa---gacaaggc
A0A287AIU8_BMF-01       -actgctgtggccctgggcttcgacccaccagccaggaa---gacaaggc
Q9GL49_PMAIP1-01        tacctgcagagccaaggtgctcgggtccggggactga-----gttctcgg
A0A4X1TQ35_PMAIP1-      tacctgcagagccaaggtgctcgggtccggggactga-----gttctcgg
F1SMU1_PMAIP1-01        tacctgcagagccaaggtgctcgggtccggggactga-----gttctcgg
A0A4X1VE31_BAD-01       caccagcaggggcagccggccagcagcagccaccatggaggcgctggggc
A0A287AEF3_BAD-01       caccagcaggggcagccggccagcagcagccaccatggaggcgctggggc
A0A4X1VE31_BAD-03       caccagcaggggcagccggccagcagcagccaccatggaggcgctggggc
A0A4X1VE31_BAD-02       caccagcaggggcagccggccagcagcagccaccatggaggcgctggggc
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      ---------agacagg------agcccagcacccatg-----agttgtga
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      ttttgacacagacagg------agcccagcacccatg-----agttgtga
C1KGB6_BCL2L11-01       ttttgacacagacagg------agcccagcacccatg-----agttgtga
C1KGB7_BCL2L11-01       ---------agacagg------agcccagcacccatg-----agttgtga
A0A4X1VRX9_BCL2L11      ttttgacacagacagg------agcccagcacccatg-----agttgtga
A0A5G2QUY1_BCL2L11      ttttgacacagacagg------agcccagcacccatg-----agttgtga
A0A4X1VRX9_BCL2L11      ---------agacagg------agcccagcacccatg-----agttgtga
A0A4X1VRX9_BCL2L11      ttttgacacagacagg------agcccagcacccatg-----agttgtga
A0A5G2QUY1_BCL2L11      ttttgacacagacagg------agcccagcacccatg-----agttgtga
A0A4X1TMB1_HRK-01       -------------------------gcccggctcaag-----g--cgctc
A0A480SCP6_BBC3-01      -----------------------------------ag-----attc----
A0A4X1VVX9_BBC3-01      -----------------------------------ag-----attc----
A0A480SCP6_BBC3-04      tggcctgggggtcccc------gcagccggccccgag-----gcccgcgc
A0A4X1VVX9_BBC3-02      tggcctgggggtcccc------gcagccggccccgag-----gcccgcgc
A0A480SCP6_BBC3-02      tggcctgggggtcccc------gcagccggccccgag-----gcccgcgc
A0A480SCP6_BBC3-03      tggcctgggggtcccc------gcagccggccccgag-----gcccgcgc
                                                                          

A0A4X1UQ42_BMF-02       cacccagactctcagtccagcctccccgagccagggtgtcatgctgcctt
A0A4X1UQ42_BMF-01       cacccagactctcagtccagcctccccgagccagggtgtcatgctgcctt
A0A287AIU8_BMF-02       cacccagactctcagtccagcctccccgagccagggtgtcatgctgcctt
A0A287AIU8_BMF-01       cacccagactctcagtccagcctccccgagccagggtgtcatgctgcctt
Q9GL49_PMAIP1-01        agttttgcggcaaagttccggctgctgtttgcggagatg--cctggaagg
A0A4X1TQ35_PMAIP1-      agttttgcggcaaagttccggctgctgtttgcggagatg--cctggaagg
F1SMU1_PMAIP1-01        agttttgcggcaaagttccggctgctgtttgcggagatg--cctggaagg
A0A4X1VE31_BAD-01       tgtggagacccggagtcgccacagctcttacccagaggggaccgaggagg
A0A287AEF3_BAD-01       tgtggagacccggagtcgccacagctcttacccagaggggaccgaggagg
A0A4X1VE31_BAD-03       tgtggagacccggagtcgccacagctcttacccagaggggaccgaggagg
A0A4X1VE31_BAD-02       tgtggagacccggagtcgccacagctcttacccagaggggaccgaggagg
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      caaatcaacacaaaccccaagtcctccttgccaagccttcaaccattatc
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VRX9_BCL2L11      caaatcaacacaaaccccaagtcctccttgccaagccttcaaccattatc
C1KGB6_BCL2L11-01       caaatcaacacaaaccccaagtcctccttgccaagccttcaaccattatc
C1KGB7_BCL2L11-01       caaatcaacacaaaccccaagtcctccttgccaagccttcaaccattatc
A0A4X1VRX9_BCL2L11      caaatcaacacaaaccccaagtcctccttgccaagccttcaaccattatc
A0A5G2QUY1_BCL2L11      caaatcaacacaaaccccaagtcctccttgccaagccttcaaccattatc
A0A4X1VRX9_BCL2L11      caaatcaacacaaaccccaagtcctccttgccaagccttcaaccattatc
A0A4X1VRX9_BCL2L11      caaatcaacacaaaccccaagtcctccttgccaagccttcaaccattatc
A0A5G2QUY1_BCL2L11      caaatcaacacaaaccccaagtcctccttgccaagccttcaaccattatc
A0A4X1TMB1_HRK-01       ggcgacgagctgca-ccagcgcaccatgtggcggcgcagcgcgcggagcc
A0A480SCP6_BBC3-01      ----atggtcctcagccctcactctcgccggcggagcagcacctggaat-
A0A4X1VVX9_BBC3-01      ----atggtcctcagccctcactctcgccggcggagcagcacctggaat-
A0A480SCP6_BBC3-04      cccgacggtcctcagccctcactctcgccggcggagcagcacctggaat-
A0A4X1VVX9_BBC3-02      cccgacggtcctcagccctcactctcgccggcggagcagcacctggaat-
A0A480SCP6_BBC3-02      cccgacggtcctcagccctcactctcgccggcggagcagcacctggaat-
A0A480SCP6_BBC3-03      cccgacggtcctcagccctcactctcgccggcggagcagcacctggaat-
                                                                          

A0A4X1UQ42_BMF-02       gtggggtgactgaggaaccccagcgactcttttatggcaatgctggctac
A0A4X1UQ42_BMF-01       gtggggtgactgaggaaccccagcgactcttttatggcaatgctggctac
A0A287AIU8_BMF-02       gtggggtgactgaggaaccccagcgactcttttat---------------
A0A287AIU8_BMF-01       gtggggtgactgaggaaccccagcgactcttttatggcaatgctggctac
Q9GL49_PMAIP1-01        aggtctcgtaggaa----cactcaga------------------------
A0A4X1TQ35_PMAIP1-      aggtctcgtaggaa----cactcaga------------------------
F1SMU1_PMAIP1-01        aggtctcgtaggaa----cactcaga------------------------
A0A4X1VE31_BAD-01       atgaagggactgag----gatgagga------------------------
A0A287AEF3_BAD-01       atgaagggactgag----gatgagga------------------------
A0A4X1VE31_BAD-03       atgaagggactgag----gatgagga------------------------
A0A4X1VE31_BAD-02       atgaagggactgag----gatgagga------------------------
A0A4X1VRX9_BCL2L11      -----------gct----tcca----------------------------
A0A5G2QUY1_BCL2L11      -----------gct----tcca----------------------------
A0A5G2QUY1_BCL2L11      tcagtgcgatggct----tcca----------------------------
C1KGB8_BCL2L11-01       -----------gct----tcca----------------------------
A0A4X1VRX9_BCL2L11      tcagtgcgatggct----tcca----------------------------
C1KGB6_BCL2L11-01       tcagtgcgatggct----tcca----------------------------
C1KGB7_BCL2L11-01       tcagtgcgatggct----tcca----------------------------
A0A4X1VRX9_BCL2L11      tcagtgcgatggct----tcca----------------------------
A0A5G2QUY1_BCL2L11      tcagtgcgatggct----tcca----------------------------
A0A4X1VRX9_BCL2L11      tcagtgcgatggct----tcca----------------------------
A0A4X1VRX9_BCL2L11      tcagtgcgatggct----tcca----------------------------
A0A5G2QUY1_BCL2L11      tcagtgcgatggct----tcca----------------------------
A0A4X1TMB1_HRK-01       ggagggcgccggcg----cccggcgc------------------------
A0A480SCP6_BBC3-01      ------cgccagtg----cccagcgc------------------------
A0A4X1VVX9_BBC3-01      ------cgccagtg----cccagcgc------------------------
A0A480SCP6_BBC3-04      ------cgccagtg----cccagcgc------------------------
A0A4X1VVX9_BBC3-02      ------cgccagtg----cccagcgc------------------------
A0A480SCP6_BBC3-02      ------cgccagtg----cccagcgc------------------------
A0A480SCP6_BBC3-03      ------cgccagtg----cccagcgc------------------------
                                   *                                      

A0A4X1UQ42_BMF-02       cggctccctctccctgccggtttccccgcaggcttgccccttggcgaaca
A0A4X1UQ42_BMF-01       cggctccctctccctgccggtttccccgcaggcttgccccttggcgaaca
A0A287AIU8_BMF-02       ------------------------------ggcttgccccttggcgaaca
A0A287AIU8_BMF-01       cggctccctctccctgccggtttccccgcaggcttgccccttggcgaaca
Q9GL49_PMAIP1-01        ------------------cgaaccctacgcgggtggccctcc--cgc--c
A0A4X1TQ35_PMAIP1-      ------------------cgaaccctacgcgggtggccctcc--cgc--c
F1SMU1_PMAIP1-01        ------------------cgaaccctacgcgggtggccctcc--cgc--c
A0A4X1VE31_BAD-01       ---------------gctcagccccttccgcggccgatcgct--ctcggc
A0A287AEF3_BAD-01       ---------------gctcagccccttccgcggccgatcgct--ctcggc
A0A4X1VE31_BAD-03       ---------------gctcagccccttccgcggccgatcgct--ctcggc
A0A4X1VE31_BAD-02       ---------------gctcagccccttccgcggccgatcgct--ctcggc
A0A4X1VRX9_BCL2L11      -----------------tgaggcagtctcaggctgaacccgc--agatat
A0A5G2QUY1_BCL2L11      -----------------tgaggcagtctcaggctgaacccgc--agatat
A0A5G2QUY1_BCL2L11      -----------------tgaggcagtctcaggctgaacccgc--agatat
C1KGB8_BCL2L11-01       -----------------tgaggcagtctcaggctgaacccgc--agatat
A0A4X1VRX9_BCL2L11      -----------------tgaggcagtctcaggctgaacccgc--agatat
C1KGB6_BCL2L11-01       -----------------tgaggcagtctcaggctgaacccgc--agatat
C1KGB7_BCL2L11-01       -----------------tgaggcagtctcaggctgaacccgc--agatat
A0A4X1VRX9_BCL2L11      -----------------tgaggcagtctcaggctgaacccgc--agatat
A0A5G2QUY1_BCL2L11      -----------------tgaggcagtctcaggctgaacccgc--agatat
A0A4X1VRX9_BCL2L11      -----------------tgaggcagtctcaggctgaacccgc--agatat
A0A4X1VRX9_BCL2L11      -----------------tgaggcagtctcaggctgaacccgc--agatat
A0A5G2QUY1_BCL2L11      -----------------tgaggcagtctcaggctgaacccgc--agatat
A0A4X1TMB1_HRK-01       ---------------gct------------------ccccac--cta---
A0A480SCP6_BBC3-01      ---------------tccgggggccctggcgggcggccccac--ccaagc
A0A4X1VVX9_BBC3-01      ---------------tccgggggccctggcgggcggccccac--ccaagc
A0A480SCP6_BBC3-04      ---------------tccgggggccctggcgggcggccccac--ccaagc
A0A4X1VVX9_BBC3-02      ---------------tccgggggccctggcgggcggccccac--ccaagc
A0A480SCP6_BBC3-02      ---------------tccgggggccctggcgggcggccccac--ccaagc
A0A480SCP6_BBC3-03      ---------------tccgggggccctggcgggcggccccac--ccaagc
                                                              *           

A0A4X1UQ42_BMF-02       gccccctgaagggcagtg---gcaacatcgagcagaggtacagattgccc
A0A4X1UQ42_BMF-01       gccccctgaagggcagtg---gcaacatcgagcagaggtacagattgccc
A0A287AIU8_BMF-02       gccccccgaagggcagtg---gcaacatcgagcagaggtacagattgccc
A0A287AIU8_BMF-01       gccccccgaagggcagtg---gcaacatcgagcagaggtacagattgccc
Q9GL49_PMAIP1-01        agatcctgaagtcgagtgtgc---------------------------ca
A0A4X1TQ35_PMAIP1-      agatcctgaagtcgagtgtgc---------------------------ca
F1SMU1_PMAIP1-01        agatcctgaagtcgagtgtgc---------------------------ca
A0A4X1VE31_BAD-01       gccccccatcctctgggctgcacagcgtta---------------tggcc
A0A287AEF3_BAD-01       gccccccatcctctgggctgcacagcgtta---------------tggcc
A0A4X1VE31_BAD-03       gccccccatcctctgggctgcacagcgtta---------------tggcc
A0A4X1VE31_BAD-02       gccccccatcctctgggctgcacagcgtta---------------tggcc
A0A4X1VRX9_BCL2L11      gcgcccggagatatggattgcgcagg------------------------
A0A5G2QUY1_BCL2L11      gcgcccggagatatggattgcgcagg------------------------
A0A5G2QUY1_BCL2L11      gcgcccggagatatggattgcgcagg------------------------
C1KGB8_BCL2L11-01       gcgcccggagatatggattgcgcagg------------------------
A0A4X1VRX9_BCL2L11      gcgcccggagatatggattgcgcagg------------------------
C1KGB6_BCL2L11-01       gcgcccggagatatggattgcgcagg------------------------
C1KGB7_BCL2L11-01       gcgcccggagatatggattgcgcagg------------------------
A0A4X1VRX9_BCL2L11      gcgcccggagatatggattgcgcagg------------------------
A0A5G2QUY1_BCL2L11      gcgcccggagatatggattgcgcagg------------------------
A0A4X1VRX9_BCL2L11      gcgcccggagatatggattgcgcagg------------------------
A0A4X1VRX9_BCL2L11      gcgcccggagatatggattgcgcagg------------------------
A0A5G2QUY1_BCL2L11      gcgcccggagatatggattgcgcagg------------------------
A0A4X1TMB1_HRK-01       ---------------------------------------------ctggc
A0A480SCP6_BBC3-01      agccccgggaatccggggggaggaggagcagtgggcccgagagatcgggg
A0A4X1VVX9_BBC3-01      agccccgggaatccggggggaggaggagcagtgggcccgagagatcgggg
A0A480SCP6_BBC3-04      agccccgggaatccggggggaggaggagcagtgggcccgagagatcgggg
A0A4X1VVX9_BBC3-02      agccccgggaatccggggggaggaggagcagtgggcccgagagatcgggg
A0A480SCP6_BBC3-02      agccccgggaatccggggggaggaggagcagtgggcccgagagatcgggg
A0A480SCP6_BBC3-03      agccccgggaatccggggggaggaggagcagtgggcccgagagatcgggg
                                                                          

A0A4X1UQ42_BMF-02       gaaaacttcagtgcattgcagaccagttccat------------------
A0A4X1UQ42_BMF-01       gaaaacttcagtgcattgcagaccagttccat------------------
A0A287AIU8_BMF-02       gaaaacttcagtgcattgcagaccagttccat------------------
A0A287AIU8_BMF-01       gaaaacttcagtgcattgcagaccagttccat------------------
Q9GL49_PMAIP1-01        ttcagttcagaaggattggagacaaactgaa-------------------
A0A4X1TQ35_PMAIP1-      ttcagttcagaaggattggagacaaactgaa-------------------
F1SMU1_PMAIP1-01        ttcagttcagaaggattggagacaaactgaa-------------------
A0A4X1VE31_BAD-01       gcgagctccggaggatgagtgacgagttccagggttccttcaaggtgagc
A0A287AEF3_BAD-01       gcgagctccggaggatgagtgacgagttccagggttccttcaag------
A0A4X1VE31_BAD-03       gcgagctccggaggatgagtgacgagttccagggttccttc---------
A0A4X1VE31_BAD-02       gcgagctccggaggatgagtgacgagttccagggttccttcaag------
A0A4X1VRX9_BCL2L11      ---agttacggcgtattggagacgaatttaatg-----------------
A0A5G2QUY1_BCL2L11      ---agttacggcgtattggagacgaatttaatg-----------------
A0A5G2QUY1_BCL2L11      ---agttacggcgtattggagacgaatttaatg-----------------
C1KGB8_BCL2L11-01       ---agttacggcgtattggagacgaatttaatg-----------------
A0A4X1VRX9_BCL2L11      ---agttacggcgtattggagacgaatttaatg-----------------
C1KGB6_BCL2L11-01       ---agttacggcgtattggagacgaatttaatg-----------------
C1KGB7_BCL2L11-01       ---agttacggcgtattggagacgaatttaatg-----------------
A0A4X1VRX9_BCL2L11      ---agttacggcgtattggagacgaatttaatg-----------------
A0A5G2QUY1_BCL2L11      ---agttacggcgtattggagacgaatttaatg-----------------
A0A4X1VRX9_BCL2L11      ---agttacggcgtattggagacgaatttaatg-----------------
A0A4X1VRX9_BCL2L11      ---agttacggcgtattggagacgaatttaatg-----------------
A0A5G2QUY1_BCL2L11      ---agttacggcgtattggagacgaatttaatg-----------------
A0A4X1TMB1_HRK-01       cctggctgtg---------------------cg-----------------
A0A480SCP6_BBC3-01      cccagctgcggcggatggctgacgatctcaacg-----------------
A0A4X1VVX9_BBC3-01      cccagctgcggcggatggctgacgatctcaacg-----------------
A0A480SCP6_BBC3-04      cccagctgcggcggatggctgacgatctcaacg-----------------
A0A4X1VVX9_BBC3-02      cccagctgcggcggatggctgacgatctcaacg-----------------
A0A480SCP6_BBC3-02      cccagctgcggcggatggctgacgatctcaacg-----------------
A0A480SCP6_BBC3-03      cccagctgcggcggatggctgacgatctcaacg-----------------
                              *                                           

A0A4X1UQ42_BMF-02       ----------------------------------------cggcttcata
A0A4X1UQ42_BMF-01       ----------------------------------------cggcttcata
A0A287AIU8_BMF-02       ----------------------------------------cggcttcata
A0A287AIU8_BMF-01       ----------------------------------------cggcttcata
Q9GL49_PMAIP1-01        ----------------------------------------cttccg----
A0A4X1TQ35_PMAIP1-      ----------------------------------------cttccg----
F1SMU1_PMAIP1-01        ----------------------------------------cttccg----
A0A4X1VE31_BAD-01       gcgcgcgtgggactgtaccctcgagtctcctcccaatgggctgtcccgtt
A0A287AEF3_BAD-01       ----------------------------------aagggacttcctcgcc
A0A4X1VE31_BAD-03       ----------------------------------aagggacttcctcgcc
A0A4X1VE31_BAD-02       ----------------------------------aagggacttcctcgcc
A0A4X1VRX9_BCL2L11      ----------------------------------------c-atattacc
A0A5G2QUY1_BCL2L11      ----------------------------------------c-atattacc
A0A5G2QUY1_BCL2L11      ----------------------------------------c-atattacc
C1KGB8_BCL2L11-01       ----------------------------------------c-atattacc
A0A4X1VRX9_BCL2L11      ----------------------------------------c-atattacc
C1KGB6_BCL2L11-01       ----------------------------------------c-atattacc
C1KGB7_BCL2L11-01       ----------------------------------------c-atattacc
A0A4X1VRX9_BCL2L11      ----------------------------------------c-atattacc
A0A5G2QUY1_BCL2L11      ----------------------------------------c-atattacc
A0A4X1VRX9_BCL2L11      ----------------------------------------c-atattacc
A0A4X1VRX9_BCL2L11      ----------------------------------------c-atattacc
A0A5G2QUY1_BCL2L11      ----------------------------------------c-atattacc
A0A4X1TMB1_HRK-01       ----------------------------------------cggccgcgca
A0A480SCP6_BBC3-01      ----------------------------------------c-gctgtacg
A0A4X1VVX9_BBC3-01      ----------------------------------------c-gctgtacg
A0A480SCP6_BBC3-04      ----------------------------------------c-gctgtacg
A0A4X1VVX9_BBC3-02      ----------------------------------------c-gctgtacg
A0A480SCP6_BBC3-02      ----------------------------------------c-gctgtacg
A0A480SCP6_BBC3-03      ----------------------------------------c-gctgtacg
                                                                *         

A0A4X1UQ42_BMF-02       tgca------------gcag------------------------------
A0A4X1UQ42_BMF-01       tgca------------gcag------------------------------
A0A287AIU8_BMF-02       tgca------------gcag------------------------------
A0A287AIU8_BMF-01       tgca------------gcag------------------------------
Q9GL49_PMAIP1-01        ----------------gcag------------------------------
A0A4X1TQ35_PMAIP1-      ----------------gcag------------------------------
F1SMU1_PMAIP1-01        ----------------gcag------------------------------
A0A4X1VE31_BAD-01       cgagtcccagggcctttcgg------------------------------
A0A287AEF3_BAD-01       cga-----agagc---gcgg------------------------------
A0A4X1VE31_BAD-03       cga-----agagc---gcgg------------------------------
A0A4X1VE31_BAD-02       cga-----agagc---gcgg------------------------------
A0A4X1VRX9_BCL2L11      caag------------gagg------------------------------
A0A5G2QUY1_BCL2L11      caag------------gagg------------------------------
A0A5G2QUY1_BCL2L11      caag------------gagg------------------------------
C1KGB8_BCL2L11-01       caag------------gagg------------------------------
A0A4X1VRX9_BCL2L11      caag------------gagg------------------------------
C1KGB6_BCL2L11-01       caag------------gagg------------------------------
C1KGB7_BCL2L11-01       caag------------gagg------------------------------
A0A4X1VRX9_BCL2L11      caag------------gagg------------------------------
A0A5G2QUY1_BCL2L11      caag------------gagg------------------------------
A0A4X1VRX9_BCL2L11      caag------------gagg------------------------------
A0A4X1VRX9_BCL2L11      caag------------gagg------------------------------
A0A5G2QUY1_BCL2L11      caag------------gagg------------------------------
A0A4X1TMB1_HRK-01       ggtg------------gcgg------------------------------
A0A480SCP6_BBC3-01      agcg------------gcgg--------------------agaca-----
A0A4X1VVX9_BBC3-01      agcg------------gcgg--------------------agaca-----
A0A480SCP6_BBC3-04      agcg------------gcgggtgagtgctgggggaggggtagacggcagg
A0A4X1VVX9_BBC3-02      agcg------------gcgg--------------------agaca-----
A0A480SCP6_BBC3-02      agcg------------gcgg--------------------agaca-----
A0A480SCP6_BBC3-03      agcg------------gcgg--------------------agaca-----
                                           *                              

A0A4X1UQ42_BMF-02       --------------------------------------------caccag
A0A4X1UQ42_BMF-01       --------------------------------------------caccag
A0A287AIU8_BMF-02       --------------------------------------------caccag
A0A287AIU8_BMF-01       --------------------------------------------caccag
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A4X1VE31_BAD-01       --------------------------------------------gatctg
A0A287AEF3_BAD-01       --------------------------------------------gcacag
A0A4X1VE31_BAD-03       --------------------------------------------gcacag
A0A4X1VE31_BAD-02       --------------------------------------------gcacag
A0A4X1VRX9_BCL2L11      --------------------------------------------cta--g
A0A5G2QUY1_BCL2L11      --------------------------------------------cta--g
A0A5G2QUY1_BCL2L11      --------------------------------------------gtaatg
C1KGB8_BCL2L11-01       --------------------------------------------gtaatg
A0A4X1VRX9_BCL2L11      --------------------------------------------gtaatg
C1KGB6_BCL2L11-01       --------------------------------------------gtaatg
C1KGB7_BCL2L11-01       --------------------------------------------gtaatg
A0A4X1VRX9_BCL2L11      -------------------------------------------------t
A0A5G2QUY1_BCL2L11      -------------------------------------------------t
A0A4X1VRX9_BCL2L11      --------------------------------------------gtcttt
A0A4X1VRX9_BCL2L11      --------------------------------------------gtcttt
A0A5G2QUY1_BCL2L11      --------------------------------------------gtcttt
A0A4X1TMB1_HRK-01       --------------------------------------------------
A0A480SCP6_BBC3-01      ----------------------------------------agaggagcag
A0A4X1VVX9_BBC3-01      ----------------------------------------agaggagcag
A0A480SCP6_BBC3-04      tgggacttcccgcggggagggggttgggggcgacccagccagatgtgcgg
A0A4X1VVX9_BBC3-02      ----------------------------------------agaggagcag
A0A480SCP6_BBC3-02      ----------------------------------------agaggagcag
A0A480SCP6_BBC3-03      ----------------------------------------agaggagcag
                                                                          

A0A4X1UQ42_BMF-02       cagaaccaaaatcgtgtgtggtggcaaatcctc-----------------
A0A4X1UQ42_BMF-01       cagaaccaaaatcgtgtgtggtggcaaatcctc-----------------
A0A287AIU8_BMF-02       cagaaccaaaatcgtgtgtggtggcaaatcctc-----------------
A0A287AIU8_BMF-01       cagaaccaaaatcgtgtgtggtggcaaatcctc-----------------
Q9GL49_PMAIP1-01        --------------------------aaacttctgaat------------
A0A4X1TQ35_PMAIP1-      --------------------------aaacttctgaat------------
F1SMU1_PMAIP1-01        --------------------------aaacttctgaat------------
A0A4X1VE31_BAD-01       aggtccaggcccccctccagaaggccaagactc--ctg------------
A0A287AEF3_BAD-01       cgacgcagatgc----------ggcaaagccccagctg-----------g
A0A4X1VE31_BAD-03       cgacgcagatgc----------ggcaaagccccagctg-----------g
A0A4X1VE31_BAD-02       cgacgcagatgc----------ggcaaagccccagctg-----------g
A0A4X1VRX9_BCL2L11      cagaatg-------------------------------------------
A0A5G2QUY1_BCL2L11      cagaatg-------------------------------------------
A0A5G2QUY1_BCL2L11      ctgttttcttt-----------------accccc----------------
C1KGB8_BCL2L11-01       ctgttttcttt-----------------accccc----------------
A0A4X1VRX9_BCL2L11      ctgttttcttt-----------------accccc----------------
C1KGB6_BCL2L11-01       ctgttttcttt-----------------accccc----------------
C1KGB7_BCL2L11-01       ctgttttcttt-----------------accccc----------------
A0A4X1VRX9_BCL2L11      tagaacaatag---------------------------------------
A0A5G2QUY1_BCL2L11      tagaacaatag---------------------------------------
A0A4X1VRX9_BCL2L11      ctgaataattaccaagcagccgaagcccaccctcagat------------
A0A4X1VRX9_BCL2L11      ctgaataattaccaagcagccgaagcccaccctcagat------------
A0A5G2QUY1_BCL2L11      ctgaataattaccaagcagccgaagcccaccctcagat------------
A0A4X1TMB1_HRK-01       -----------------------------cgctggcag------------
A0A480SCP6_BBC3-01      cagcgacaccgcccc-----------tcgccctggagg------------
A0A4X1VVX9_BBC3-01      cagcgacaccgcccc-----------tcgccctggagg------------
A0A480SCP6_BBC3-04      cagc--tgctgccctgcgcggcggggtcgcgctggggacaggcaggtggg
A0A4X1VVX9_BBC3-02      cagcgacaccgcccc-----------tcgccctggagg------------
A0A480SCP6_BBC3-02      cagcgacaccgcccc-----------tcgccctggagg------------
A0A480SCP6_BBC3-03      cagcgacaccgcccc-----------tcgccctggagg------------
                                                                          

A0A4X1UQ42_BMF-02       --------------------------------------------------
A0A4X1UQ42_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
A0A4X1TQ35_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
A0A4X1VE31_BAD-01       ----gcttcccca-------------------------------------
A0A287AEF3_BAD-01       aagcgcttcctcc-------------------------------------
A0A4X1VE31_BAD-03       aagcgcttcctcc-------------------------------------
A0A4X1VE31_BAD-02       aagcgcttcctcc-------------------------------------
A0A4X1VRX9_BCL2L11      --------tctgg-------------------------------------
A0A5G2QUY1_BCL2L11      --------tctgg-------------------------------------
A0A5G2QUY1_BCL2L11      --------ctttt-------------------------------------
C1KGB8_BCL2L11-01       --------ctttt-------------------------------------
A0A4X1VRX9_BCL2L11      --------ctttt-------------------------------------
C1KGB6_BCL2L11-01       --------ctttt-------------------------------------
C1KGB7_BCL2L11-01       --------ctttt-------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
A0A4X1VRX9_BCL2L11      ---ggttatctta-------------------------------------
A0A4X1VRX9_BCL2L11      ---ggttatctta-------------------------------------
A0A5G2QUY1_BCL2L11      ---ggttatctta-------------------------------------
A0A4X1TMB1_HRK-01       --------cctgg-------------------------------------
A0A480SCP6_BBC3-01      ------gttctgt------------------------------------a
A0A4X1VVX9_BBC3-01      ------gttctgt------------------------------------a
A0A480SCP6_BBC3-04      aggggcggcctgtccgcggagccaccgtaaggcccgcgctgcggctggca
A0A4X1VVX9_BBC3-02      ------gttctgt------------------------------------a
A0A480SCP6_BBC3-02      ------gttctgt------------------------------------a
A0A480SCP6_BBC3-03      ------gttctgt------------------------------------a
                                                                          

A0A4X1UQ42_BMF-02       ----------------------------------------------ctgt
A0A4X1UQ42_BMF-01       ----------------------------------------------ctgt
A0A287AIU8_BMF-02       ----------------------------------------------ctgt
A0A287AIU8_BMF-01       ----------------------------------------------ctgt
Q9GL49_PMAIP1-01        -------------------------------------------------c
A0A4X1TQ35_PMAIP1-      -------------------------------------------------c
F1SMU1_PMAIP1-01        -------------------------------------------------c
A0A4X1VE31_BAD-01       ------------------------------------------aatcct--
A0A287AEF3_BAD-01       ------------------------------------------agtcctgg
A0A4X1VE31_BAD-03       ------------------------------------------agtcctgg
A0A4X1VE31_BAD-02       ------------------------------------------agtcctgg
A0A4X1VRX9_BCL2L11      ----------------------------------------------catc
A0A5G2QUY1_BCL2L11      ----------------------------------------------catc
A0A5G2QUY1_BCL2L11      ----------------------------------------------cccc
C1KGB8_BCL2L11-01       ----------------------------------------------cccc
A0A4X1VRX9_BCL2L11      ----------------------------------------------cccc
C1KGB6_BCL2L11-01       ----------------------------------------------cccc
C1KGB7_BCL2L11-01       ----------------------------------------------cccc
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
A0A4X1VRX9_BCL2L11      ----------------------------------------------cgac
A0A4X1VRX9_BCL2L11      ----------------------------------------------cgac
A0A5G2QUY1_BCL2L11      ----------------------------------------------cgac
A0A4X1TMB1_HRK-01       ----------------------------------------------ctgc
A0A480SCP6_BBC3-01      caatctcatcatgggac---------------------------ttctgc
A0A4X1VVX9_BBC3-01      caatctcatcatgggac---------------------------ttctgc
A0A480SCP6_BBC3-04      ccaccgggtcgagggccagggccggggcagcctcgagcgttacggtgtgc
A0A4X1VVX9_BBC3-02      caatctcatcatgggac---------------------------ttctgc
A0A480SCP6_BBC3-02      caatctcatcatgggac---------------------------ttctgc
A0A480SCP6_BBC3-03      caatctcatcatgggac---------------------------ttctgc
                                                                          

A0A4X1UQ42_BMF-02       ttctacacaacctcgctttgcatggagatgagaacaggaatggggcaggt
A0A4X1UQ42_BMF-01       ttctacacaacctcgctttgcatggagatgagaacaggaatggggcaggt
A0A287AIU8_BMF-02       ttctacacaacctcgctttgcatggagatgagaacaggaatggggcaggt
A0A287AIU8_BMF-01       ttctacacaacctcgctttgcatggagatgagaacaggaatggggcaggt
Q9GL49_PMAIP1-01        tgatagccaaactcttccgtctaggaacc---------------------
A0A4X1TQ35_PMAIP1-      tgatagccaaactcttccgcctaggaacc---------------------
F1SMU1_PMAIP1-01        tgatagccaaactcttccgcctaggaacc---------------------
A0A4X1VE31_BAD-01       ------tgaagcgcgaggcaggctggcatctgggctcc------------
A0A287AEF3_BAD-01       tggtaccggaactcggggagaggaggcccc---gccccct----------
A0A4X1VE31_BAD-03       tggtaccggaactcggggagaggaggcccc---gccccct----------
A0A4X1VE31_BAD-02       tggtaccggaactcggggagaggaggcccc---gccccct----------
A0A4X1VRX9_BCL2L11      ccacacc-------------------------------------------
A0A5G2QUY1_BCL2L11      ccacacc-------------------------------------------
A0A5G2QUY1_BCL2L11      tcacaccctccctcccccttacatt-------------------------
C1KGB8_BCL2L11-01       tcacaccctccctcccccttacatt-------------------------
A0A4X1VRX9_BCL2L11      tcacaccctccctcccccttacatt-------------------------
C1KGB6_BCL2L11-01       tcacaccctccctcccccttacatt-------------------------
C1KGB7_BCL2L11-01       tcacaccctccctcccccttacatt-------------------------
A0A4X1VRX9_BCL2L11      --------------------------------------------------
A0A5G2QUY1_BCL2L11      --------------------------------------------------
A0A4X1VRX9_BCL2L11      tgttacgctacatcgcccgtctggtgtggagga-----------------
A0A4X1VRX9_BCL2L11      tgttacgctacatcgcccgtctggtgtggagga-----------------
A0A5G2QUY1_BCL2L11      tgttacgctacatcgcccgtctggtgtggagga-----------------
A0A4X1TMB1_HRK-01       tc---------ggcag--------------------------gcggaac-
A0A480SCP6_BBC3-01      ccttacccaggggccg-----tggagcccccgaga--------tggagc-
A0A4X1VVX9_BBC3-01      ccttacccaggggccg-----tggagcccccgaga--------tggagc-
A0A480SCP6_BBC3-04      ccgcggccggcggccggcggccggcggccgcgagaactgagggcggcgct
A0A4X1VVX9_BBC3-02      ccttacccaggggccg-----tggagcccccgaga--------tggagc-
A0A480SCP6_BBC3-02      ccttacccaggggccg-----tggagcccccgaga--------tggagc-
A0A480SCP6_BBC3-03      ccttacccaggggccg-----tggagcccccgaga--------tggagc-
                                                                          

A0A4X1UQ42_BMF-02       c-------------------------ccaggtga---------
A0A4X1UQ42_BMF-01       c-------------------------ccaggtga---------
A0A287AIU8_BMF-02       c-------------------------ccaggtga---------
A0A287AIU8_BMF-01       c-------------------------ccaggtga---------
Q9GL49_PMAIP1-01        -------------------------------tga---------
A0A4X1TQ35_PMAIP1-      -------------------------------tga---------
F1SMU1_PMAIP1-01        -------------------------------tga---------
A0A4X1VE31_BAD-01       -------------------------------tga---------
A0A287AEF3_BAD-01       --------------------------cccaatga---------
A0A4X1VE31_BAD-03       --------------------------cccaatga---------
A0A4X1VE31_BAD-02       --------------------------cccaatga---------
A0A4X1VRX9_BCL2L11      -------------------------------tga---------
A0A5G2QUY1_BCL2L11      -------------------------------tga---------
A0A5G2QUY1_BCL2L11      -------------------------------taa---------
C1KGB8_BCL2L11-01       -------------------------------taa---------
A0A4X1VRX9_BCL2L11      -------------------------------taa---------
C1KGB6_BCL2L11-01       -------------------------------taa---------
C1KGB7_BCL2L11-01       -------------------------------taa---------
A0A4X1VRX9_BCL2L11      -------------------------------------------
A0A5G2QUY1_BCL2L11      -------------------------------------------
A0A4X1VRX9_BCL2L11      --------------------------tgcagtga---------
A0A4X1VRX9_BCL2L11      --------------------------tgcagtga---------
A0A5G2QUY1_BCL2L11      --------------------------tgcagtga---------
A0A4X1TMB1_HRK-01       --------------------------ttg--tag---------
A0A480SCP6_BBC3-01      --------------------------ctaattag---------
A0A4X1VVX9_BBC3-01      --------------------------ctaattag---------
A0A480SCP6_BBC3-04      cagccgagcggctcatatatcccaggctatttatagccggtga
A0A4X1VVX9_BBC3-02      --------------------------ctaattag---------
A0A480SCP6_BBC3-02      --------------------------ctaattag---------
A0A480SCP6_BBC3-03      --------------------------ctaattag---------
                                                                   

© 1998-2020Legal notice