Dataset for CDS classical BH3-containing proteins of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A287AIU8_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
F1RM01_BBC3-04         atgaccgtgtttgtgggaggttgtgctggccagccagtgccttgggtcag
F1RM01_BBC3-02         --------------------------------------------------
F1RM01_BBC3-03         --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
C1KGB6_BCL2L11-03      --------------------------------------------------
C1KGB6_BCL2L11-01      --------------------------------------------------
C1KGB6_BCL2L11-02      --------------------------------------------------
C1KGB8_BCL2L11-01      --------------------------------------------------
F1SMU1_PMAIP1-01       --------------------------------------------------
Q9GL49_PMAIP1-01       --------------------------------------------------
                                                                         

A0A287AIU8_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
F1RM01_BBC3-04         cccccccaccatggggggggcgtgtctcttggggccttctcacctgcctc
F1RM01_BBC3-02         ---------------------atggcttctggagc---------------
F1RM01_BBC3-03         --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
C1KGB6_BCL2L11-03      ---------------------gaaactcccgatatagagccagggctctc
C1KGB6_BCL2L11-01      ---------------------gaaactcccgatatagagccagggctctc
C1KGB6_BCL2L11-02      ---------------------gaaactcccgatatagagccagggctctc
C1KGB8_BCL2L11-01      --------------------------------------------------
F1SMU1_PMAIP1-01       --------------------------------------------------
Q9GL49_PMAIP1-01       --------------------------------------------------
                                                                         

A0A287AIU8_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
F1RM01_BBC3-04         ccctccatctgggccttgtgtgtgttgtgggtgccagccctgggcttccc
F1RM01_BBC3-02         --------------------------------------------------
F1RM01_BBC3-03         --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
C1KGB6_BCL2L11-03      ggggctcctgaggctttccgcgggcggcagcggcggggtctggtttacac
C1KGB6_BCL2L11-01      ggggctcctgaggctttccgcgggcggcagcggcggggtctggtttacac
C1KGB6_BCL2L11-02      ggggctcctgaggctttccgcgggcggcagcggcggggtctggtttacac
C1KGB8_BCL2L11-01      --------------------------------------------------
F1SMU1_PMAIP1-01       --------------------------------------------------
Q9GL49_PMAIP1-01       --------------------------------------------------
                                                                         

A0A287AIU8_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
F1RM01_BBC3-04         tgcctgccacgtgtcctcatgcctgggttcaagagtggggtgccctgtgt
F1RM01_BBC3-02         ----------------------------------------------gtgt
F1RM01_BBC3-03         --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------at------------------gggc
C1KGB6_BCL2L11-03      tgtattcggagcgccccctctgttccac------------------gcgc
C1KGB6_BCL2L11-01      tgtattcggagcgccccctctgttccac------------------gcgc
C1KGB6_BCL2L11-02      tgtattcggagcgccccctctgttccac------------------gcgc
C1KGB8_BCL2L11-01      --------------------------------------------------
F1SMU1_PMAIP1-01       --------------------------------------------------
Q9GL49_PMAIP1-01       --------------------------at------------------gcgt
                                                                         

A0A287AIU8_BMF-02      ---atggagccacctcagtgtgtgga------------------ggagct
A0A287AIU8_BMF-01      ---atggagccacctcagtgtgtgga------------------ggagct
F1RM01_BBC3-04         accccagggaggggggtgccctgggggccggcctgatgccccctgcactt
F1RM01_BBC3-02         cccatcagtgggccagtgagcaggaacctgtc------------------
F1RM01_BBC3-03         --------------------------------------------------
A0A287AEF3_BAD-01      atcccagaaaatccctcatctg-------------cttccacacacaccc
C1KGB6_BCL2L11-03      actcctaggccaccgctggttggggaagaggagaggttacactttgagtt
C1KGB6_BCL2L11-01      actcctaggccaccgctggttggggaagaggagaggttacactttgagtt
C1KGB6_BCL2L11-02      actcctaggccaccgctggttggggaagaggagaggttacactttgagtt
C1KGB8_BCL2L11-01      --------------------------------------------------
F1SMU1_PMAIP1-01       --------------------------------------------------
Q9GL49_PMAIP1-01       tcttccggatcgcttggctctaggattcgggggctgttggaatcggcagg
                                                                         

A0A287AIU8_BMF-02      ggaggatgatgtgttcc---------------------------------
A0A287AIU8_BMF-01      ggaggatgatgtgttcc---------------------------------
F1RM01_BBC3-04         ctcagctgaccgtgcccctctgtcctgtcctgcaggccccagggagcgcc
F1RM01_BBC3-02         -------------------------------acaggccccagggagcgcc
F1RM01_BBC3-03         --------------------------------------------------
A0A287AEF3_BAD-01      aaggaataaggaagtccggagctg----------------------aacc
C1KGB6_BCL2L11-03      gggggatgggtgcgcactgagccatccgcagccaagtcactccagtaaac
C1KGB6_BCL2L11-01      gggggatgggtgcgcactgagccatccgcagccaagtcactccagtaaac
C1KGB6_BCL2L11-02      gggggatgggtgcgcactgagccatccgcagccaagtcactccagtaaac
C1KGB8_BCL2L11-01      --------------------------------------------------
F1SMU1_PMAIP1-01       --------------------------------------------------
Q9GL49_PMAIP1-01       atgggaggaattggtaagaagccagccccgggcacatcaaggtctcacca
                                                                         

A0A287AIU8_BMF-02      --agccagaggaagg-----------------ggagc------cggggac
A0A287AIU8_BMF-01      --agccagaggaagg-----------------ggagc------cggggac
F1RM01_BBC3-04         atggcccgagcacgccaggagggcagctccccggagc---ccgtagaggg
F1RM01_BBC3-02         atggcccgagcacgccaggagggcagctccccggagc---ccgtagaggg
F1RM01_BBC3-03         atggcccgagcacgccaggagggcagctccccggagc---ccgtagaggg
A0A287AEF3_BAD-01      agggaccccggaggaa-----ggcggtg----ggcgg-------------
C1KGB6_BCL2L11-03      acgcccggcgggggca----gggcggta----ggcgcgcgcagcggggaa
C1KGB6_BCL2L11-01      acgcccggcgggggca----gggcggta----ggcgcgcgcagcggggaa
C1KGB6_BCL2L11-02      acgcccggcgggggca----gggcggta----ggcgcgcgcagcggggaa
C1KGB8_BCL2L11-01      --------------------------------------------------
F1SMU1_PMAIP1-01       -------gcgcgggca------gcggcg----ggagc-------------
Q9GL49_PMAIP1-01       gtggccggtgtgggcagacgaggcggga----ggagc-----ttcgtggt
                                                                         

A0A287AIU8_BMF-02      ccagcccaggagggtctctgctgacccgtttgtccagagccag-------
A0A287AIU8_BMF-01      ccagcccaggagggtctctgctgacccgtttgtccagagccag-------
F1RM01_BBC3-04         cctggcccgcgacggcccgcgtcccttccccctcagccgcctggtgccct
F1RM01_BBC3-02         cctggcccgcgacggcccgcgtcccttccccctcagccgcctggtgccct
F1RM01_BBC3-03         cctggcccgcgacggcccgcgtcccttccccctcagccgcctggtgccct
A0A287AEF3_BAD-01      ---ggccggagccgtagcg----gccccgcctcccagagcatgttccaga
C1KGB6_BCL2L11-03      cccggcggggacgcccccg----cctttacctgtcagagcctg---cacg
C1KGB6_BCL2L11-01      cccggcggggacgcccccg----cctttacctgtcagagcctg---cacg
C1KGB6_BCL2L11-02      cccggcggggacgcccccg----cctttacctgtcagagcctg---cacg
C1KGB8_BCL2L11-01      --------------------------------------------------
F1SMU1_PMAIP1-01       ------------------------------------------g---ccaa
Q9GL49_PMAIP1-01       tccttcggtccgcctcccg----ctgccgtccgaggaaaccaa---ccaa
                                                                         

A0A287AIU8_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
F1RM01_BBC3-04         ccgccgtgtcc---------------------------------------
F1RM01_BBC3-02         ccgccgtgtcc---------------------------------------
F1RM01_BBC3-03         ccgccgtgtcc---------------------------------------
A0A287AEF3_BAD-01      tcccagagtttga-------------------------------------
C1KGB6_BCL2L11-03      cgtcagcggctgcagcggcgcggaggcggggctttccagcccgcgcgctg
C1KGB6_BCL2L11-01      cgtcagcggctgcagcggcgcggaggcggggctttccagcccgcgcgctg
C1KGB6_BCL2L11-02      cgtcagcggctgcagcggcgcggaggcggggctttccagcccgcgcgctg
C1KGB8_BCL2L11-01      --------------------------------------------------
F1SMU1_PMAIP1-01       cctcagaggct---------------------------------------
Q9GL49_PMAIP1-01       cctcagaggct---------------------------------------
                                                                         

A0A287AIU8_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
F1RM01_BBC3-04         --------------------------------------tgcggcctctgc
F1RM01_BBC3-02         --------------------------------------tgcggcctctgc
F1RM01_BBC3-03         --------------------------------------tgcggcctctgc
A0A287AEF3_BAD-01      ---------------------------------------------gcaga
C1KGB6_BCL2L11-03      ggcgggatttagcgggggcggggcacgcggtgattgggcgcggcctcggg
C1KGB6_BCL2L11-01      ggcgggatttagcgggggcggggcacgcggtgattgggcgcggcctcggg
C1KGB6_BCL2L11-02      ggcgggatttagcgggggcggggcacgcggtgattgggcgcggcctcggg
C1KGB8_BCL2L11-01      --------------------------------------------------
F1SMU1_PMAIP1-01       ---------------------------------------------tttgg
Q9GL49_PMAIP1-01       ---------------------------------------------tttgg
                                                                         

A0A287AIU8_BMF-02      ------------------------------------ctggactgccccct
A0A287AIU8_BMF-01      ------------------------------------ctggactgccccct
F1RM01_BBC3-04         gaacccgg----------------------------tctgcctgccgccc
F1RM01_BBC3-02         gaacccgg----------------------------tctgcctgccgccc
F1RM01_BBC3-03         gaacccgg----------------------------tctgcctgccgccc
A0A287AEF3_BAD-01      gtgagcag------------------------------------------
C1KGB6_BCL2L11-03      gccgccagcctgagctgggctgcagggctgcgcaggtttcacttcgctcc
C1KGB6_BCL2L11-01      gccgccagcctgagctgggctgcagggctgcgcaggtttcacttcgctcc
C1KGB6_BCL2L11-02      gccgccagcctgagctgggctgcagggctgcgcaggtttcacttcgctcc
C1KGB8_BCL2L11-01      --------------------------------------------------
F1SMU1_PMAIP1-01       gcgttcag--------------------------ggtgttgctt------
Q9GL49_PMAIP1-01       gcgttcag--------------------------ggtgttgctt------
                                                                         

A0A287AIU8_BMF-02      cagccgtctgcagctct---------------------tccctctcacgc
A0A287AIU8_BMF-01      cagccgtctgcagctct---------------------tccctctcacgc
F1RM01_BBC3-04         ccgccgcccccaccctgctgcccgctgcctacctctgcgcccccaccgcc
F1RM01_BBC3-02         ccgccgcccccaccctgctgcccgctgcctacctctgcgcccccaccgcc
F1RM01_BBC3-03         ccgccgcccccaccctgctgcccgctgcctacctctgcgcccccaccgcc
A0A287AEF3_BAD-01      --gaagactccagccct---gcagacaggggcctgggccccagccccaca
C1KGB6_BCL2L11-03      gcgcagcctccaggtctcgagcttgcaggagcgtttggtcccacgtcgcc
C1KGB6_BCL2L11-01      gcgcagcctccaggtctcgagcttgcaggagcgtttggtcccacgtcgcc
C1KGB6_BCL2L11-02      gcgcagcctccaggtctcgagcttgcaggagcgtttggtcccacgtcgcc
C1KGB8_BCL2L11-01      --------------------------------------------------
F1SMU1_PMAIP1-01       -------ttctagctctc--------------------tcccgcttgctc
Q9GL49_PMAIP1-01       -------ttctagctctc--------------------tcccgcttgctc
                                                                         

A0A287AIU8_BMF-02      actgctgtg-----------------------------------------
A0A287AIU8_BMF-01      actgctgtg-----------------------------------------
F1RM01_BBC3-04         ccgcccgcc--------------------------------------gtc
F1RM01_BBC3-02         ccgcccgcc--------------------------------------gtc
F1RM01_BBC3-03         ccgcccgcc--------------------------------------gtc
A0A287AEF3_BAD-01      gggacagac--------------------ccccagccctggcgcacggcc
C1KGB6_BCL2L11-03      gccgccgccgccgccgacaccaccgctatcgccaccaccaccggcttctc
C1KGB6_BCL2L11-01      gccgccgccgccgccgacaccaccgctatcgccaccaccaccggcttctc
C1KGB6_BCL2L11-02      gccgccgccgccgccgacaccaccgctatcgccaccaccaccggcttctc
C1KGB8_BCL2L11-01      --------------------------------------------------
F1SMU1_PMAIP1-01       gcttctgcc-----------------------------------------
Q9GL49_PMAIP1-01       gcttctgcc-----------------------------------------
                                                                         

A0A287AIU8_BMF-02      ------gccctgggcttcgacccaccagccagga----------------
A0A287AIU8_BMF-01      ------gccctgggcttcgacccaccagccagga----------------
F1RM01_BBC3-04         accgccgccctggggggcc-cccgctggcctggg----------------
F1RM01_BBC3-02         accgccgccctggggggcc-cccgctggcctggg----------------
F1RM01_BBC3-03         accgccgccctggggggcc-cccgctggcctggg----------------
A0A287AEF3_BAD-01      ccaggccacctgggggaag-ctggtcaccagcag----------------
C1KGB6_BCL2L11-03      acagtcgccctgcgcgt---cctgttctctgcggccagcatcgcttcaga
C1KGB6_BCL2L11-01      acagtcgccctgcgcgt---cctgttctctgcggccagcatcgcttcaga
C1KGB6_BCL2L11-02      acagtcgccctgcgcgt---cctgttctctgcggccagcatcgcttcaga
C1KGB8_BCL2L11-01      --------------------------------------------------
F1SMU1_PMAIP1-01       -cgaccgccccgcgcgcag-cctgctacctgcag----------------
Q9GL49_PMAIP1-01       -cgaccgccccgcgcgcag-cctgctacctgcag----------------
                                                                         

A0A287AIU8_BMF-02      ---------------------agacaaggccacccagac------tctca
A0A287AIU8_BMF-01      ---------------------agacaaggccacccagac------tctca
F1RM01_BBC3-04         ---------------ggtccccgcagccggccccgaggc-----------
F1RM01_BBC3-02         ---------------ggtccccgcagccggccccgaggc-----------
F1RM01_BBC3-03         ---------------ggtccccgcagccggccccgaggc-----------
A0A287AEF3_BAD-01      ------gggcagccggccagcagcagccaccatggaggcgctggggctgt
C1KGB6_BCL2L11-03      ctgctgggttcgccccgctcccgccgccgccactcactcggcgcccttcc
C1KGB6_BCL2L11-01      ctgctgggttcgccccgctcccgccgccgccactcactcggcgcccttcc
C1KGB6_BCL2L11-02      ctgctgggttcgccccgctcccgccgccgccactcactcggcgcccttcc
C1KGB8_BCL2L11-01      --------------------------------------------------
F1SMU1_PMAIP1-01       --------------------------------------------------
Q9GL49_PMAIP1-01       --------------------------------------------------
                                                                         

A0A287AIU8_BMF-02      gtccagcctccccgagccagggtgtcatgctgccttgtggggtgac----
A0A287AIU8_BMF-01      gtccagcctccccgagccagggtgtcatgctgccttgtggggtgac----
F1RM01_BBC3-04         ccgcgccccgacggtcctcagccctcactctcgccggcggagcagc----
F1RM01_BBC3-02         ccgcgccccgacggtcctcagccctcactctcgccggcggagcagc----
F1RM01_BBC3-03         ccgcgccccgacggtcctcagccctcactctcgccggcggagcagc----
A0A287AEF3_BAD-01      ggagacccggagtcgccacagctcttacccaga---ggggaccgaggag-
C1KGB6_BCL2L11-03      cctggccctcgtccccccaatgtctgactctgactctcggactgagaaac
C1KGB6_BCL2L11-01      cctggccctcgtccccccaatgtctgactctgactctcggactgagaaac
C1KGB6_BCL2L11-02      cctggccctcgtccccccaatgtctgactctgactctcggactgagaaac
C1KGB8_BCL2L11-01      --------------------------------------------------
F1SMU1_PMAIP1-01       --------------agccaaggt---gctcgggtccggggactgag----
Q9GL49_PMAIP1-01       --------------agccaaggt---gctcgggtccggggactgag----
                                                                         

A0A287AIU8_BMF-02      ----------------------------------------------tgag
A0A287AIU8_BMF-01      ----------------------------------------------tgag
F1RM01_BBC3-04         -----------------------------acctggaatcgccagtgccca
F1RM01_BBC3-02         -----------------------------acctggaatcgccagtgccca
F1RM01_BBC3-03         -----------------------------acctggaatcgccagtgccca
A0A287AEF3_BAD-01      ------------------------------------gatgaagggactga
C1KGB6_BCL2L11-03      gcaagaaaaaaagaccaaatggcaaagcaaccttccgatgtaagttctga
C1KGB6_BCL2L11-01      gcaagaaaaaaagaccaaatggcaaagcaaccttccgatgtaagttctga
C1KGB6_BCL2L11-02      gcaagaaaaaaagaccaaatggcaaagcaaccttccgatgtaagttctga
C1KGB8_BCL2L11-01      ------------------atggcaaagcaaccttccgatgtaagttctga
F1SMU1_PMAIP1-01       --------------------------------ttc----------tcgga
Q9GL49_PMAIP1-01       --------------------------------ttc----------tcgga
                                                                         

A0A287AIU8_BMF-02      gaaccccagcgactcttttat-----------------------------
A0A287AIU8_BMF-01      gaaccccagcgactcttttatggcaatgctggctaccggctccctctccc
F1RM01_BBC3-04         gcgctccgggggccct--------------ggc-----------------
F1RM01_BBC3-02         gcgctccgggggccct--------------ggc-----------------
F1RM01_BBC3-03         gcgctccgggggccct--------------ggc-----------------
A0A287AEF3_BAD-01      ggat----gaggagctcagccccttccgcggcc-----------------
C1KGB6_BCL2L11-03      gtgtgacagagaaggt-------------ggac-----------------
C1KGB6_BCL2L11-01      gtgtgacagagaaggt-------------ggac-----------------
C1KGB6_BCL2L11-02      gtgtgacagagaaggt-------------ggac-----------------
C1KGB8_BCL2L11-01      gtgtgacagagaaggt-------------ggac-----------------
F1SMU1_PMAIP1-01       gttttgcggcaaagtt---------------cc-----------------
Q9GL49_PMAIP1-01       gttttgcggcaaagtt---------------cc-----------------
                       *       *      *                                  

A0A287AIU8_BMF-02      ----------------ggcttgccccttggcgaacagccccccgaa----
A0A287AIU8_BMF-01      tgccggtttccccgcaggcttgccccttggcgaacagccccccgaa----
F1RM01_BBC3-04         -----------------gggcggccccacccaagcagccccgggaatccg
F1RM01_BBC3-02         -----------------gggcggccccacccaagcagccccgggaatccg
F1RM01_BBC3-03         -----------------gggcggccccacccaagcagccccgggaatccg
A0A287AEF3_BAD-01      -----------------gatcgctctcggc------gccccccatcctct
C1KGB6_BCL2L11-03      -----------------agttgcagcctgcggaaaggcctcctcagctca
C1KGB6_BCL2L11-01      -----------------agttgcagcctgcggaaaggcctcctcagctca
C1KGB6_BCL2L11-02      -----------------agttgcagcctgcggaaaggcctcctcagctca
C1KGB8_BCL2L11-01      -----------------agttgcagcctgcggaaaggcctcctcagctca
F1SMU1_PMAIP1-01       -----------------ggctgctgtttgcggagatgcct----------
Q9GL49_PMAIP1-01       -----------------ggctgctgtttgcggagatgcct----------
                                            *              ***           

A0A287AIU8_BMF-02      gggcag----------tggcaacatcgagcagaggtacagattgcccgaa
A0A287AIU8_BMF-01      gggcag----------tggcaacatcgagcagaggtacagattgcccgaa
F1RM01_BBC3-04         ggggga------------------------ggaggagcagtgggcccgag
F1RM01_BBC3-02         ggggga------------------------ggaggagcagtgggcccgag
F1RM01_BBC3-03         ggggga------------------------ggaggagcagtgggcccgag
A0A287AEF3_BAD-01      gggctgcacagcgttatggccgcgagctccggaggatgagtg--------
C1KGB6_BCL2L11-03      ggcctg----------gggcccccacctctctacaaacagagcggcaagg
C1KGB6_BCL2L11-01      ggcctg----------gggcccccacctctctacaaacagagcggcaagg
C1KGB6_BCL2L11-02      ggcctg----------gggcccccacctctctacaaacagagcggca---
C1KGB8_BCL2L11-01      ggcctg----------gggcccccacctctctacagacagagcggca---
F1SMU1_PMAIP1-01       ggaagg----------aggtctc-------gtaggaaca-----------
Q9GL49_PMAIP1-01       ggaagg----------aggtctc-------gtaggaaca-----------
                       **                              *     *           

A0A287AIU8_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
F1RM01_BBC3-04         --------------------------------------------------
F1RM01_BBC3-02         --------------------------------------------------
F1RM01_BBC3-03         --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
C1KGB6_BCL2L11-03      taatccggaaggagaaggggaccgctgcccccaaggcagcccccagggcc
C1KGB6_BCL2L11-01      taatccggaaggagaaggggaccgctgcccccaaggcagcccccagggcc
C1KGB6_BCL2L11-02      --------------------------------------------------
C1KGB8_BCL2L11-01      --------------------------------------------------
F1SMU1_PMAIP1-01       --------------------------------------------------
Q9GL49_PMAIP1-01       --------------------------------------------------
                                                                         

A0A287AIU8_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
F1RM01_BBC3-04         --------------------------------------------------
F1RM01_BBC3-02         --------------------------------------------------
F1RM01_BBC3-03         --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
C1KGB6_BCL2L11-03      cactggccccaccgaccagccctggcccctttgctaccagatccccgctt
C1KGB6_BCL2L11-01      cactggccccaccgaccagccctggcccctttgctaccagatccccgctt
C1KGB6_BCL2L11-02      --------------------------------------------------
C1KGB8_BCL2L11-01      --------------------------------------------------
F1SMU1_PMAIP1-01       --------------------------------------------------
Q9GL49_PMAIP1-01       --------------------------------------------------
                                                                         

A0A287AIU8_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
F1RM01_BBC3-04         --------------------------------------------------
F1RM01_BBC3-02         --------------------------------------------------
F1RM01_BBC3-03         --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
C1KGB6_BCL2L11-03      ttcatcttcgtgagaagatcctccctgctgtctcgatcctccagtgggta
C1KGB6_BCL2L11-01      ttcatcttcgtgagaagatcctccctgctgtctcgatcctccagtgggta
C1KGB6_BCL2L11-02      --------------------------------------------------
C1KGB8_BCL2L11-01      --------------------------------------------------
F1SMU1_PMAIP1-01       --------------------------------------------------
Q9GL49_PMAIP1-01       --------------------------------------------------
                                                                         

A0A287AIU8_BMF-02      ---------------------------aacttcagtgcattgcag-----
A0A287AIU8_BMF-01      ---------------------------aacttcagtgcattgcag-----
F1RM01_BBC3-04         ---------------agatcggggcccagctgcggcggatggctg-----
F1RM01_BBC3-02         ---------------agatcggggcccagctgcggcggatggctg-----
F1RM01_BBC3-03         ---------------agatcggggcccagctgcggcggatggctg-----
A0A287AEF3_BAD-01      --------------------------------------------------
C1KGB6_BCL2L11-03      tttctcttttgacacagacaggagcccagcacccatgagttgtgacaaat
C1KGB6_BCL2L11-01      tttctcttttgacacagacaggagcccagcacccatgagttgtgacaaat
C1KGB6_BCL2L11-02      ---------------agacaggagcccagcacccatgagttgtgacaaat
C1KGB8_BCL2L11-01      ---------------a----------------------------------
F1SMU1_PMAIP1-01       ------------------------ctcag---------------------
Q9GL49_PMAIP1-01       ------------------------ctcag---------------------
                                                                         

A0A287AIU8_BMF-02      ----accagttccat-----------------------------------
A0A287AIU8_BMF-01      ----accagttccat-----------------------------------
F1RM01_BBC3-04         ----acgatctcaacgc------------------------gctgtacga
F1RM01_BBC3-02         ----acgatctcaacgc------------------------gctgtacga
F1RM01_BBC3-03         ----acgatctcaacgc------------------------gctgtacga
A0A287AEF3_BAD-01      ----acgagttccaggg------------------------ttccttcaa
C1KGB6_BCL2L11-03      caacacaaaccccaagtcctccttgccaagccttcaaccattatctcagt
C1KGB6_BCL2L11-01      caacacaaaccccaagtcctccttgccaagccttcaaccattatctcagt
C1KGB6_BCL2L11-02      caacacaaaccccaagtcctccttgccaagccttcaaccattatctcagt
C1KGB8_BCL2L11-01      --------------------------------------------------
F1SMU1_PMAIP1-01       ----acgaaccctacgc---------------------------------
Q9GL49_PMAIP1-01       ----acgaaccctacgc---------------------------------
                                                                         

A0A287AIU8_BMF-02      ----cggcttcat--------------atgca------------------
A0A287AIU8_BMF-01      ----cggcttcat--------------atgca------------------
F1RM01_BBC3-04         gcggcgggtgagtgctgggggaggggtagacggcaggtgggacttcccgc
F1RM01_BBC3-02         gcggcgg--------------------agaca------------------
F1RM01_BBC3-03         gcggcgg--------------------agaca------------------
A0A287AEF3_BAD-01      gaagggacttcctcgcccgaagagcgcgggca------------------
C1KGB6_BCL2L11-03      gcgatggcttccatg------------aggca------------------
C1KGB6_BCL2L11-01      gcgatggcttccatg------------aggca------------------
C1KGB6_BCL2L11-02      gcgatggcttccatg------------aggca------------------
C1KGB8_BCL2L11-01      ------gcttccatg------------aggca------------------
F1SMU1_PMAIP1-01       -gggtggccctc--------------------------------------
Q9GL49_PMAIP1-01       -gggtggccctc--------------------------------------
                                                                         

A0A287AIU8_BMF-02      ----------------gcagcaccagcagaaccaaaatcgtgtgtggtgg
A0A287AIU8_BMF-01      ----------------gcagcaccagcagaaccaaaatcgtgtgtggtgg
F1RM01_BBC3-04         ggggagggggttgggggcgacccagccaga----------tgtgcggcag
F1RM01_BBC3-02         ---------------------------aga----------ggagcagcag
F1RM01_BBC3-03         ---------------------------aga----------ggagcagcag
A0A287AEF3_BAD-01      ---------cagcgacgcagatgcggcaaa----------gccccagctg
C1KGB6_BCL2L11-03      ---------gtctcaggctgaacccgcaga----------tatgcgcccg
C1KGB6_BCL2L11-01      ---------gtctcaggctgaacccgcaga----------tatgcgcccg
C1KGB6_BCL2L11-02      ---------gtctcaggctgaacccgcaga----------tatgcgcccg
C1KGB8_BCL2L11-01      ---------gtctcaggctgaacccgcaga----------tatgcgcccg
F1SMU1_PMAIP1-01       ----------------------ccgccaga----------t-----cctg
Q9GL49_PMAIP1-01       ----------------------ccgccaga----------t-----cctg
                                                  * *                   *

A0A287AIU8_BMF-02      caaatcctcctgtttctacacaacctcgctttgcatggagatgaga----
A0A287AIU8_BMF-01      caaatcctcctgtttctacacaacctcgctttgcatggagatgaga----
F1RM01_BBC3-04         c--t-----gctgccctgcgcggcggggtc-gcgctggggacaggcagg-
F1RM01_BBC3-02         cgac-----accgcccc-----------tc-gccctggagg---------
F1RM01_BBC3-03         cgac-----accgcccc-----------tc-gccctggagg---------
A0A287AEF3_BAD-01      ga-------agcgcttcctccagtcctggtggtaccgga-----------
C1KGB6_BCL2L11-03      gagatatggattgcgcagg--agttacggc-gtattggagacgaatttaa
C1KGB6_BCL2L11-01      gagatatggattgcgcagg--agttacggc-gtattggagacgaatttaa
C1KGB6_BCL2L11-02      gagatatggattgcgcagg--agttacggc-gtattggagacgaatttaa
C1KGB8_BCL2L11-01      gagatatggattgcgcagg--agttacggc-gtattggagacgaatttaa
F1SMU1_PMAIP1-01       aag---tcgagtgtgccattcagttcagaa-ggattggagacaaactga-
Q9GL49_PMAIP1-01       aag---tcgagtgtgccattcagttcagaa-ggattggagacaaactga-
                                                           **            

A0A287AIU8_BMF-02      --------acaggaatggggcaggtc------------------------
A0A287AIU8_BMF-01      --------acaggaatggggcaggtc------------------------
F1RM01_BBC3-04         ------------tgggaggggcggcctgtccgcggagccaccgtaaggcc
F1RM01_BBC3-02         ----------------------gttctgt---------------------
F1RM01_BBC3-03         ----------------------gttctgt---------------------
A0A287AEF3_BAD-01      --------actcggggagaggaggcc------------------------
C1KGB6_BCL2L11-03      tgcatattacccaaggagg-----ttaga---------------------
C1KGB6_BCL2L11-01      tgcatattacccaaggagggtctttctga---------------------
C1KGB6_BCL2L11-02      tgcatattacccaaggagggtaatgctgt---------------------
C1KGB8_BCL2L11-01      tgcatattacccaaggagggtaatgctgt---------------------
F1SMU1_PMAIP1-01       --------acttccggcagaaacttctga---------------------
Q9GL49_PMAIP1-01       --------acttccggcagaaacttctga---------------------
                                                                         

A0A287AIU8_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
F1RM01_BBC3-04         cgcgctgcggctggcaccaccgggtcgagggccagggccggggcagcctc
F1RM01_BBC3-02         ---------------acaatctcatcatgggac-----------------
F1RM01_BBC3-03         ---------------acaatctcatcatgggac-----------------
A0A287AEF3_BAD-01      --------------------------------------------------
C1KGB6_BCL2L11-03      ------------------acaatag-------------------------
C1KGB6_BCL2L11-01      ------------------ataattaccaagcagccgaagcccaccctcag
C1KGB6_BCL2L11-02      ------------------tttcttt-----------------accccc--
C1KGB8_BCL2L11-01      ------------------tttcttt-----------------accccc--
F1SMU1_PMAIP1-01       ------------------at------------------------------
Q9GL49_PMAIP1-01       ------------------at------------------------------
                                                                         

A0A287AIU8_BMF-02      ------------------------------------ccagg---------
A0A287AIU8_BMF-01      ------------------------------------ccagg---------
F1RM01_BBC3-04         gagcgttacggtgtgcccgcggccggcggccggcggccggcggccgcgag
F1RM01_BBC3-02         ----------ttctgcccttacccaggggccg-----tggagcccccgag
F1RM01_BBC3-03         ----------ttctgcccttacccaggggccg-----tggagcccccgag
A0A287AEF3_BAD-01      --------------------------ccgccccctcccaa----------
C1KGB6_BCL2L11-03      --------------------------------------------------
C1KGB6_BCL2L11-01      atggttatcttacgactgttacgctacatcgcccgtctggtgtggaggat
C1KGB6_BCL2L11-02      -------cttttcccctcacaccctccctcccccttacatt---------
C1KGB8_BCL2L11-01      -------cttttcccctcacaccctccctcccccttacatt---------
F1SMU1_PMAIP1-01       ---------------ctgatagccaaactcttccgcctagg---------
Q9GL49_PMAIP1-01       ---------------ctgatagccaaactcttccgtctagg---------
                                                                         

A0A287AIU8_BMF-02      -----------------------------------------------tga
A0A287AIU8_BMF-01      -----------------------------------------------tga
F1RM01_BBC3-04         aactgagggcggcgctcagccgagcggctcatatatcccaggctatttat
F1RM01_BBC3-02         a--------tggagc---------------------------ctaattag
F1RM01_BBC3-03         a--------tggagc---------------------------ctaattag
A0A287AEF3_BAD-01      -----------------------------------------------tga
C1KGB6_BCL2L11-03      --------------------------------------------------
C1KGB6_BCL2L11-01      g-------------------------------------------cagtga
C1KGB6_BCL2L11-02      -----------------------------------------------taa
C1KGB8_BCL2L11-01      -----------------------------------------------taa
F1SMU1_PMAIP1-01       a-------------------------------------------acctga
Q9GL49_PMAIP1-01       a-------------------------------------------acctga
                                                                         

A0A287AIU8_BMF-02      ---------
A0A287AIU8_BMF-01      ---------
F1RM01_BBC3-04         agccggtga
F1RM01_BBC3-02         ---------
F1RM01_BBC3-03         ---------
A0A287AEF3_BAD-01      ---------
C1KGB6_BCL2L11-03      ---------
C1KGB6_BCL2L11-01      ---------
C1KGB6_BCL2L11-02      ---------
C1KGB8_BCL2L11-01      ---------
F1SMU1_PMAIP1-01       ---------
Q9GL49_PMAIP1-01       ---------
                                

© 1998-2020Legal notice