Dataset for CDS BCL2L11 of organism Sus scrofa

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|C1KGB6_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=1215 residues).
gaaactcccgatatagagccagggctctcggggctcctgaggctttccgcgggcggcagcggcggggtctggtttacact
gtattcggagcgccccctctgttccacgcgcactcctaggccaccgctggttggggaagaggagaggttacactttgagt
tgggggatgggtgcgcactgagccatccgcagccaagtcactccagtaaacacgcccggcgggggcagggcggtaggcgc
gcgcagcggggaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtcagcggctgcagcggcgcgga
ggcggggctttccagcccgcgcgctgggcgggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgcagcctccaggtctcgagcttgcaggagcgt
ttggtcccacgtcgccgccgccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacagtcgccctgcg
cgtcctgttctctgcggccagcatcgcttcagactgctgggttcgccccgctcccgccgccgccactcactcggcgccct
tcccctggccctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaaaaaaagaccaaatggcaaag
caaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
tggggcccccacctctctacaaacagagcggcaaggtaatccggaaggagaaggggaccgctgcccccaaggcagccccc
agggcccactggccccaccgaccagccctggcccctttgctaccagatccccgcttttcatcttcgtgagaagatcctcc
ctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtgacaaatcaac
acaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctcaggctgaac
ccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaagg
aggttagaacaatag
>gnl|bcl2dbcds|C1KGB6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=1302 residues).
gaaactcccgatatagagccagggctctcggggctcctgaggctttccgcgggcggcagcggcggggtctggtttacact
gtattcggagcgccccctctgttccacgcgcactcctaggccaccgctggttggggaagaggagaggttacactttgagt
tgggggatgggtgcgcactgagccatccgcagccaagtcactccagtaaacacgcccggcgggggcagggcggtaggcgc
gcgcagcggggaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtcagcggctgcagcggcgcgga
ggcggggctttccagcccgcgcgctgggcgggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgcagcctccaggtctcgagcttgcaggagcgt
ttggtcccacgtcgccgccgccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacagtcgccctgcg
cgtcctgttctctgcggccagcatcgcttcagactgctgggttcgccccgctcccgccgccgccactcactcggcgccct
tcccctggccctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaaaaaaagaccaaatggcaaag
caaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
tggggcccccacctctctacaaacagagcggcaaggtaatccggaaggagaaggggaccgctgcccccaaggcagccccc
agggcccactggccccaccgaccagccctggcccctttgctaccagatccccgcttttcatcttcgtgagaagatcctcc
ctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtgacaaatcaac
acaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctcaggctgaac
ccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaagg
agggtctttctgaataattaccaagcagccgaagcccaccctcagatggttatcttacgactgttacgctacatcgcccg
tctggtgtggaggatgcagtga
>gnl|bcl2dbcds|C1KGB6_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=1095 residues).
gaaactcccgatatagagccagggctctcggggctcctgaggctttccgcgggcggcagcggcggggtctggtttacact
gtattcggagcgccccctctgttccacgcgcactcctaggccaccgctggttggggaagaggagaggttacactttgagt
tgggggatgggtgcgcactgagccatccgcagccaagtcactccagtaaacacgcccggcgggggcagggcggtaggcgc
gcgcagcggggaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtcagcggctgcagcggcgcgga
ggcggggctttccagcccgcgcgctgggcgggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgcagcctccaggtctcgagcttgcaggagcgt
ttggtcccacgtcgccgccgccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacagtcgccctgcg
cgtcctgttctctgcggccagcatcgcttcagactgctgggttcgccccgctcccgccgccgccactcactcggcgccct
tcccctggccctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaaaaaaagaccaaatggcaaag
caaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
tggggcccccacctctctacaaacagagcggcaagacaggagcccagcacccatgagttgtgacaaatcaacacaaaccc
caagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctcaggctgaacccgcagat
atgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaaggagggtaat
gctgttttctttaccccccttttcccctcacaccctccctcccccttacatttaa
>gnl|bcl2dbcds|C1KGB8_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=294 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacagacagagcggcaagcttccatgaggcagtctcaggctgaacccgcagata
tgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaaggagggtaatg
ctgttttctttaccccccttttcccctcacaccctccctcccccttacatttaa
© 1998-2020Legal notice