Dataset for CDS BCL2L11 of organism Sus scrofa

[Download (right click)] [Alignment] [Repertoires]

12 sequence(s)

>gnl|bcl2dbcds|A0A287AEC6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=1302 residues).
gaaactcccgatatagagccagggctctcggggctcctgaggctttccgcgggcggcagcggcggggtctggtttacact
gtattcggagcgccccctctgttccacgcgcactcctaggccaccgctggttggggaagaggagaggttacactttgagt
tgggggatgggtgcgcactgagccatccgcagccaagtcactccagtaaacacgcccggcgggggcagggcggtaggcgc
gcgcagcggggaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtcagcggctgcagcggcgcgga
ggcggggctttccagcccgcgcgctgggcgggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgcagcctccaggtctcgagcttgcaggagcgt
ttggtcccacgtcgccgccgccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacagtcgccctgcg
cgtcctgttctctgcggccagcatcgcttcagactgctgggttcgccccgctcccgccgccgccactcactcggcgccct
tcccctggccctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaaaaaaagaccaaatggcaaag
caaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
tggggcccccacctctctacaaacagagcggcaaggtaatccggaaggagaaggggaccgctgcccccaaggcagccccc
agggcccactggccccaccgaccagccctggcccctttgctaccagatccccgcttttcatcttcgtgagaagatcctcc
ctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtgacaaatcaac
acaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctcaggctgaac
ccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaagg
agggtctttctgaataattaccaagcagccgaagcccaccctcagatggttatcttacgactgttacgctacatcgcccg
tctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A287AEC6_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=1095 residues).
gaaactcccgatatagagccagggctctcggggctcctgaggctttccgcgggcggcagcggcggggtctggtttacact
gtattcggagcgccccctctgttccacgcgcactcctaggccaccgctggttggggaagaggagaggttacactttgagt
tgggggatgggtgcgcactgagccatccgcagccaagtcactccagtaaacacgcccggcgggggcagggcggtaggcgc
gcgcagcggggaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtcagcggctgcagcggcgcgga
ggcggggctttccagcccgcgcgctgggcgggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgcagcctccaggtctcgagcttgcaggagcgt
ttggtcccacgtcgccgccgccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacagtcgccctgcg
cgtcctgttctctgcggccagcatcgcttcagactgctgggttcgccccgctcccgccgccgccactcactcggcgccct
tcccctggccctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaaaaaaagaccaaatggcaaag
caaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
tggggcccccacctctctacaaacagagcggcaagacaggagcccagcacccatgagttgtgacaaatcaacacaaaccc
caagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctcaggctgaacccgcagat
atgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaaggagggtaat
gctgttttctttaccccccttttcccctcacaccctccctcccccttacatttaa
>gnl|bcl2dbcds|A0A287AEC6_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=1215 residues).
gaaactcccgatatagagccagggctctcggggctcctgaggctttccgcgggcggcagcggcggggtctggtttacact
gtattcggagcgccccctctgttccacgcgcactcctaggccaccgctggttggggaagaggagaggttacactttgagt
tgggggatgggtgcgcactgagccatccgcagccaagtcactccagtaaacacgcccggcgggggcagggcggtaggcgc
gcgcagcggggaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtcagcggctgcagcggcgcgga
ggcggggctttccagcccgcgcgctgggcgggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgcagcctccaggtctcgagcttgcaggagcgt
ttggtcccacgtcgccgccgccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacagtcgccctgcg
cgtcctgttctctgcggccagcatcgcttcagactgctgggttcgccccgctcccgccgccgccactcactcggcgccct
tcccctggccctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaaaaaaagaccaaatggcaaag
caaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
tggggcccccacctctctacaaacagagcggcaaggtaatccggaaggagaaggggaccgctgcccccaaggcagccccc
agggcccactggccccaccgaccagccctggcccctttgctaccagatccccgcttttcatcttcgtgagaagatcctcc
ctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtgacaaatcaac
acaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctcaggctgaac
ccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaagg
aggttagaacaatag
>gnl|bcl2dbcds|A0A287AEC6_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=264 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacaaacagagcggcaagcttccatgaggcagtctcaggctgaacccgcagata
tgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaaggaggctagca
gaatgtctggcatcccacacctga
>gnl|bcl2dbcds|A0A4X1VMQ3_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacaaacagagcggcaaggtaatccggaaggagaaggggaccgctgcccccaag
gcagcccccagggcccactggccccaccgaccagccctggcccctttgctaccagatccccgcttttcatcttcgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
aggctgaacccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatat
tacccaaggagggtctttctgaataattaccaagcagccgaagcccaccctcagatggttatcttacgactgttacgcta
catcgcccgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A4X1VMQ3_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacaaacagagcggcaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctcaggctgaa
cccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaag
gagggtctttctgaataattaccaagcagccgaagcccaccctcagatggttatcttacgactgttacgctacatcgccc
gtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A4X1VMQ3_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=504 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacaaacagagcggcaaggtaatccggaaggagaaggggaccgctgcccccaag
gcagcccccagggcccactggccccaccgaccagccctggcccctttgctaccagatccccgcttttcatcttcgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
aggctgaacccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatat
tacccaaggaggttagaacaatag
>gnl|bcl2dbcds|A0A4X1VMQ3_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=264 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacaaacagagcggcaagcttccatgaggcagtctcaggctgaacccgcagata
tgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaaggaggctagca
gaatgtctggcatcccacacctga
>gnl|bcl2dbcds|A0A4X1VMQ3_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=552 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacaaacagagcggcaaggtaatccggaaggagaaggggaccgctgcccccaag
gcagcccccagggcccactggccccaccgaccagccctggcccctttgctaccagatccccgcttttcatcttcgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
aggctgaacccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatat
tacccaaggagggtaatgctgttttctttaccccccttttcccctcacaccctccctcccccttacatttaa
>gnl|bcl2dbcds|C1KGB6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=552 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacagacagagcggcaaggtaatccggaaggagaaggggaccgctgcccccaag
gcagcccccagggcccactggccccaccgaccagccctggcccctttgctaccagatccccgcttttcatcttcgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
aggctgaacccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatat
tacccaaggagggtaatgctgttttctttaccccccttttcccctcacaccctccctcccccttacatttaa
>gnl|bcl2dbcds|C1KGB7_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=384 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacagacagagcggcaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctcaggctgaa
cccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaag
gagggtaatgctgttttctttaccccccttttcccctcacaccctccctcccccttacatttaa
>gnl|bcl2dbcds|C1KGB8_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=294 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacagacagagcggcaagcttccatgaggcagtctcaggctgaacccgcagata
tgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaaggagggtaatg
ctgttttctttaccccccttttcccctcacaccctccctcccccttacatttaa
© 1998-2022Legal notice