Dataset for CDS BCL2L11 of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


C1KGB6_BCL2L11-03      gaaactcccgatatagagccagggctctcggggctcctgaggctttccgc
C1KGB6_BCL2L11-01      gaaactcccgatatagagccagggctctcggggctcctgaggctttccgc
C1KGB6_BCL2L11-02      gaaactcccgatatagagccagggctctcggggctcctgaggctttccgc
C1KGB8_BCL2L11-01      --------------------------------------------------
                                                                         

C1KGB6_BCL2L11-03      gggcggcagcggcggggtctggtttacactgtattcggagcgccccctct
C1KGB6_BCL2L11-01      gggcggcagcggcggggtctggtttacactgtattcggagcgccccctct
C1KGB6_BCL2L11-02      gggcggcagcggcggggtctggtttacactgtattcggagcgccccctct
C1KGB8_BCL2L11-01      --------------------------------------------------
                                                                         

C1KGB6_BCL2L11-03      gttccacgcgcactcctaggccaccgctggttggggaagaggagaggtta
C1KGB6_BCL2L11-01      gttccacgcgcactcctaggccaccgctggttggggaagaggagaggtta
C1KGB6_BCL2L11-02      gttccacgcgcactcctaggccaccgctggttggggaagaggagaggtta
C1KGB8_BCL2L11-01      --------------------------------------------------
                                                                         

C1KGB6_BCL2L11-03      cactttgagttgggggatgggtgcgcactgagccatccgcagccaagtca
C1KGB6_BCL2L11-01      cactttgagttgggggatgggtgcgcactgagccatccgcagccaagtca
C1KGB6_BCL2L11-02      cactttgagttgggggatgggtgcgcactgagccatccgcagccaagtca
C1KGB8_BCL2L11-01      --------------------------------------------------
                                                                         

C1KGB6_BCL2L11-03      ctccagtaaacacgcccggcgggggcagggcggtaggcgcgcgcagcggg
C1KGB6_BCL2L11-01      ctccagtaaacacgcccggcgggggcagggcggtaggcgcgcgcagcggg
C1KGB6_BCL2L11-02      ctccagtaaacacgcccggcgggggcagggcggtaggcgcgcgcagcggg
C1KGB8_BCL2L11-01      --------------------------------------------------
                                                                         

C1KGB6_BCL2L11-03      gaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtc
C1KGB6_BCL2L11-01      gaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtc
C1KGB6_BCL2L11-02      gaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtc
C1KGB8_BCL2L11-01      --------------------------------------------------
                                                                         

C1KGB6_BCL2L11-03      agcggctgcagcggcgcggaggcggggctttccagcccgcgcgctgggcg
C1KGB6_BCL2L11-01      agcggctgcagcggcgcggaggcggggctttccagcccgcgcgctgggcg
C1KGB6_BCL2L11-02      agcggctgcagcggcgcggaggcggggctttccagcccgcgcgctgggcg
C1KGB8_BCL2L11-01      --------------------------------------------------
                                                                         

C1KGB6_BCL2L11-03      ggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
C1KGB6_BCL2L11-01      ggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
C1KGB6_BCL2L11-02      ggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
C1KGB8_BCL2L11-01      --------------------------------------------------
                                                                         

C1KGB6_BCL2L11-03      ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgc
C1KGB6_BCL2L11-01      ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgc
C1KGB6_BCL2L11-02      ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgc
C1KGB8_BCL2L11-01      --------------------------------------------------
                                                                         

C1KGB6_BCL2L11-03      agcctccaggtctcgagcttgcaggagcgtttggtcccacgtcgccgccg
C1KGB6_BCL2L11-01      agcctccaggtctcgagcttgcaggagcgtttggtcccacgtcgccgccg
C1KGB6_BCL2L11-02      agcctccaggtctcgagcttgcaggagcgtttggtcccacgtcgccgccg
C1KGB8_BCL2L11-01      --------------------------------------------------
                                                                         

C1KGB6_BCL2L11-03      ccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacag
C1KGB6_BCL2L11-01      ccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacag
C1KGB6_BCL2L11-02      ccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacag
C1KGB8_BCL2L11-01      --------------------------------------------------
                                                                         

C1KGB6_BCL2L11-03      tcgccctgcgcgtcctgttctctgcggccagcatcgcttcagactgctgg
C1KGB6_BCL2L11-01      tcgccctgcgcgtcctgttctctgcggccagcatcgcttcagactgctgg
C1KGB6_BCL2L11-02      tcgccctgcgcgtcctgttctctgcggccagcatcgcttcagactgctgg
C1KGB8_BCL2L11-01      --------------------------------------------------
                                                                         

C1KGB6_BCL2L11-03      gttcgccccgctcccgccgccgccactcactcggcgcccttcccctggcc
C1KGB6_BCL2L11-01      gttcgccccgctcccgccgccgccactcactcggcgcccttcccctggcc
C1KGB6_BCL2L11-02      gttcgccccgctcccgccgccgccactcactcggcgcccttcccctggcc
C1KGB8_BCL2L11-01      --------------------------------------------------
                                                                         

C1KGB6_BCL2L11-03      ctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaa
C1KGB6_BCL2L11-01      ctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaa
C1KGB6_BCL2L11-02      ctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaa
C1KGB8_BCL2L11-01      --------------------------------------------------
                                                                         

C1KGB6_BCL2L11-03      aaaaagaccaaatggcaaagcaaccttccgatgtaagttctgagtgtgac
C1KGB6_BCL2L11-01      aaaaagaccaaatggcaaagcaaccttccgatgtaagttctgagtgtgac
C1KGB6_BCL2L11-02      aaaaagaccaaatggcaaagcaaccttccgatgtaagttctgagtgtgac
C1KGB8_BCL2L11-01      -----------atggcaaagcaaccttccgatgtaagttctgagtgtgac
                                  ***************************************

C1KGB6_BCL2L11-03      agagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
C1KGB6_BCL2L11-01      agagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
C1KGB6_BCL2L11-02      agagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
C1KGB8_BCL2L11-01      agagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
                       **************************************************

C1KGB6_BCL2L11-03      tggggcccccacctctctacaaacagagcggcaaggtaatccggaaggag
C1KGB6_BCL2L11-01      tggggcccccacctctctacaaacagagcggcaaggtaatccggaaggag
C1KGB6_BCL2L11-02      tggggcccccacctctctacaaacagagcggca-----------------
C1KGB8_BCL2L11-01      tggggcccccacctctctacagacagagcggca-----------------
                       ********************* ***********                 

C1KGB6_BCL2L11-03      aaggggaccgctgcccccaaggcagcccccagggcccactggccccaccg
C1KGB6_BCL2L11-01      aaggggaccgctgcccccaaggcagcccccagggcccactggccccaccg
C1KGB6_BCL2L11-02      --------------------------------------------------
C1KGB8_BCL2L11-01      --------------------------------------------------
                                                                         

C1KGB6_BCL2L11-03      accagccctggcccctttgctaccagatccccgcttttcatcttcgtgag
C1KGB6_BCL2L11-01      accagccctggcccctttgctaccagatccccgcttttcatcttcgtgag
C1KGB6_BCL2L11-02      --------------------------------------------------
C1KGB8_BCL2L11-01      --------------------------------------------------
                                                                         

C1KGB6_BCL2L11-03      aagatcctccctgctgtctcgatcctccagtgggtatttctcttttgaca
C1KGB6_BCL2L11-01      aagatcctccctgctgtctcgatcctccagtgggtatttctcttttgaca
C1KGB6_BCL2L11-02      --------------------------------------------------
C1KGB8_BCL2L11-01      --------------------------------------------------
                                                                         

C1KGB6_BCL2L11-03      cagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccca
C1KGB6_BCL2L11-01      cagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccca
C1KGB6_BCL2L11-02      -agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccca
C1KGB8_BCL2L11-01      -a------------------------------------------------
                        *                                                

C1KGB6_BCL2L11-03      agtcctccttgccaagccttcaaccattatctcagtgcgatggcttccat
C1KGB6_BCL2L11-01      agtcctccttgccaagccttcaaccattatctcagtgcgatggcttccat
C1KGB6_BCL2L11-02      agtcctccttgccaagccttcaaccattatctcagtgcgatggcttccat
C1KGB8_BCL2L11-01      ------------------------------------------gcttccat
                                                                 ********

C1KGB6_BCL2L11-03      gaggcagtctcaggctgaacccgcagatatgcgcccggagatatggattg
C1KGB6_BCL2L11-01      gaggcagtctcaggctgaacccgcagatatgcgcccggagatatggattg
C1KGB6_BCL2L11-02      gaggcagtctcaggctgaacccgcagatatgcgcccggagatatggattg
C1KGB8_BCL2L11-01      gaggcagtctcaggctgaacccgcagatatgcgcccggagatatggattg
                       **************************************************

C1KGB6_BCL2L11-03      cgcaggagttacggcgtattggagacgaatttaatgcatattacccaagg
C1KGB6_BCL2L11-01      cgcaggagttacggcgtattggagacgaatttaatgcatattacccaagg
C1KGB6_BCL2L11-02      cgcaggagttacggcgtattggagacgaatttaatgcatattacccaagg
C1KGB8_BCL2L11-01      cgcaggagttacggcgtattggagacgaatttaatgcatattacccaagg
                       **************************************************

C1KGB6_BCL2L11-03      agg-----ttagaacaatag------------------------------
C1KGB6_BCL2L11-01      agggtctttctgaataattaccaagcagccgaagcccaccctcagatggt
C1KGB6_BCL2L11-02      agggtaatgctgttttcttt-----------------accccc-------
C1KGB8_BCL2L11-01      agggtaatgctgttttcttt-----------------accccc-------
                       ***        *     *                                

C1KGB6_BCL2L11-03      --------------------------------------------------
C1KGB6_BCL2L11-01      tatcttacgactgttacgctacatcgcccgtctggtgtggaggatgcagt
C1KGB6_BCL2L11-02      --cttttcccctcacaccctccctcccccttacatt-------------t
C1KGB8_BCL2L11-01      --cttttcccctcacaccctccctcccccttacatt-------------t
                                                                         

C1KGB6_BCL2L11-03      --
C1KGB6_BCL2L11-01      ga
C1KGB6_BCL2L11-02      aa
C1KGB8_BCL2L11-01      aa
                         

© 1998-2020Legal notice