Dataset for CDS BCL2L11 of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      gaaactcccgatatagagccagggctctcggggctcctgaggctttccgc
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      gaaactcccgatatagagccagggctctcggggctcctgaggctttccgc
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      gaaactcccgatatagagccagggctctcggggctcctgaggctttccgc
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
                                                                          

A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      gggcggcagcggcggggtctggtttacactgtattcggagcgccccctct
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      gggcggcagcggcggggtctggtttacactgtattcggagcgccccctct
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      gggcggcagcggcggggtctggtttacactgtattcggagcgccccctct
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
                                                                          

A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      gttccacgcgcactcctaggccaccgctggttggggaagaggagaggtta
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      gttccacgcgcactcctaggccaccgctggttggggaagaggagaggtta
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      gttccacgcgcactcctaggccaccgctggttggggaagaggagaggtta
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
                                                                          

A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      cactttgagttgggggatgggtgcgcactgagccatccgcagccaagtca
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      cactttgagttgggggatgggtgcgcactgagccatccgcagccaagtca
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      cactttgagttgggggatgggtgcgcactgagccatccgcagccaagtca
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
                                                                          

A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      ctccagtaaacacgcccggcgggggcagggcggtaggcgcgcgcagcggg
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      ctccagtaaacacgcccggcgggggcagggcggtaggcgcgcgcagcggg
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      ctccagtaaacacgcccggcgggggcagggcggtaggcgcgcgcagcggg
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
                                                                          

A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      gaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtc
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      gaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtc
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      gaacccggcggggacgcccccgcctttacctgtcagagcctgcacgcgtc
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
                                                                          

A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      agcggctgcagcggcgcggaggcggggctttccagcccgcgcgctgggcg
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      agcggctgcagcggcgcggaggcggggctttccagcccgcgcgctgggcg
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      agcggctgcagcggcgcggaggcggggctttccagcccgcgcgctgggcg
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
                                                                          

A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      ggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      ggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      ggatttagcgggggcggggcacgcggtgattgggcgcggcctcggggccg
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
                                                                          

A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgc
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgc
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      ccagcctgagctgggctgcagggctgcgcaggtttcacttcgctccgcgc
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
                                                                          

A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      agcctccaggtctcgagcttgcaggagcgtttggtcccacgtcgccgccg
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      agcctccaggtctcgagcttgcaggagcgtttggtcccacgtcgccgccg
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      agcctccaggtctcgagcttgcaggagcgtttggtcccacgtcgccgccg
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
                                                                          

A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      ccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacag
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      ccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacag
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      ccgccgccgccgacaccaccgctatcgccaccaccaccggcttctcacag
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
                                                                          

A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      tcgccctgcgcgtcctgttctctgcggccagcatcgcttcagactgctgg
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      tcgccctgcgcgtcctgttctctgcggccagcatcgcttcagactgctgg
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      tcgccctgcgcgtcctgttctctgcggccagcatcgcttcagactgctgg
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
                                                                          

A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      gttcgccccgctcccgccgccgccactcactcggcgcccttcccctggcc
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      gttcgccccgctcccgccgccgccactcactcggcgcccttcccctggcc
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      gttcgccccgctcccgccgccgccactcactcggcgcccttcccctggcc
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
                                                                          

A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      ctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaa
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
C1KGB6_BCL2L11-01       --------------------------------------------------
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      ctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaa
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      ctcgtccccccaatgtctgactctgactctcggactgagaaacgcaagaa
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
                                                                          

A0A287AEC6_BCL2L11      -----------atggcaaagcaaccttccgatgtaagttctgagtgtgac
A0A4X1VMQ3_BCL2L11      -----------atggcaaagcaaccttccgatgtaagttctgagtgtgac
A0A287AEC6_BCL2L11      aaaaagaccaaatggcaaagcaaccttccgatgtaagttctgagtgtgac
C1KGB8_BCL2L11-01       -----------atggcaaagcaaccttccgatgtaagttctgagtgtgac
A0A4X1VMQ3_BCL2L11      -----------atggcaaagcaaccttccgatgtaagttctgagtgtgac
C1KGB6_BCL2L11-01       -----------atggcaaagcaaccttccgatgtaagttctgagtgtgac
C1KGB7_BCL2L11-01       -----------atggcaaagcaaccttccgatgtaagttctgagtgtgac
A0A287AEC6_BCL2L11      aaaaagaccaaatggcaaagcaaccttccgatgtaagttctgagtgtgac
A0A4X1VMQ3_BCL2L11      -----------atggcaaagcaaccttccgatgtaagttctgagtgtgac
A0A4X1VMQ3_BCL2L11      -----------atggcaaagcaaccttccgatgtaagttctgagtgtgac
A0A287AEC6_BCL2L11      aaaaagaccaaatggcaaagcaaccttccgatgtaagttctgagtgtgac
A0A4X1VMQ3_BCL2L11      -----------atggcaaagcaaccttccgatgtaagttctgagtgtgac
                                   ***************************************

A0A287AEC6_BCL2L11      agagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
A0A4X1VMQ3_BCL2L11      agagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
A0A287AEC6_BCL2L11      agagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
C1KGB8_BCL2L11-01       agagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
A0A4X1VMQ3_BCL2L11      agagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
C1KGB6_BCL2L11-01       agagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
C1KGB7_BCL2L11-01       agagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
A0A287AEC6_BCL2L11      agagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
A0A4X1VMQ3_BCL2L11      agagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
A0A4X1VMQ3_BCL2L11      agagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
A0A287AEC6_BCL2L11      agagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
A0A4X1VMQ3_BCL2L11      agagaaggtggacagttgcagcctgcggaaaggcctcctcagctcaggcc
                        **************************************************

A0A287AEC6_BCL2L11      tggggcccccacctctctacaaacagagcggcaa----------------
A0A4X1VMQ3_BCL2L11      tggggcccccacctctctacaaacagagcggcaa----------------
A0A287AEC6_BCL2L11      tggggcccccacctctctacaaacagagcggca-----------------
C1KGB8_BCL2L11-01       tggggcccccacctctctacagacagagcggcaa----------------
A0A4X1VMQ3_BCL2L11      tggggcccccacctctctacaaacagagcggcaaggtaatccggaaggag
C1KGB6_BCL2L11-01       tggggcccccacctctctacagacagagcggcaaggtaatccggaaggag
C1KGB7_BCL2L11-01       tggggcccccacctctctacagacagagcggca-----------------
A0A287AEC6_BCL2L11      tggggcccccacctctctacaaacagagcggcaaggtaatccggaaggag
A0A4X1VMQ3_BCL2L11      tggggcccccacctctctacaaacagagcggcaaggtaatccggaaggag
A0A4X1VMQ3_BCL2L11      tggggcccccacctctctacaaacagagcggca-----------------
A0A287AEC6_BCL2L11      tggggcccccacctctctacaaacagagcggcaaggtaatccggaaggag
A0A4X1VMQ3_BCL2L11      tggggcccccacctctctacaaacagagcggcaaggtaatccggaaggag
                        ********************* ***********                 

A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      aaggggaccgctgcccccaaggcagcccccagggcccactggccccaccg
C1KGB6_BCL2L11-01       aaggggaccgctgcccccaaggcagcccccagggcccactggccccaccg
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      aaggggaccgctgcccccaaggcagcccccagggcccactggccccaccg
A0A4X1VMQ3_BCL2L11      aaggggaccgctgcccccaaggcagcccccagggcccactggccccaccg
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      aaggggaccgctgcccccaaggcagcccccagggcccactggccccaccg
A0A4X1VMQ3_BCL2L11      aaggggaccgctgcccccaaggcagcccccagggcccactggccccaccg
                                                                          

A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      accagccctggcccctttgctaccagatccccgcttttcatcttcgtgag
C1KGB6_BCL2L11-01       accagccctggcccctttgctaccagatccccgcttttcatcttcgtgag
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      accagccctggcccctttgctaccagatccccgcttttcatcttcgtgag
A0A4X1VMQ3_BCL2L11      accagccctggcccctttgctaccagatccccgcttttcatcttcgtgag
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      accagccctggcccctttgctaccagatccccgcttttcatcttcgtgag
A0A4X1VMQ3_BCL2L11      accagccctggcccctttgctaccagatccccgcttttcatcttcgtgag
                                                                          

A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      aagatcctccctgctgtctcgatcctccagtgggtatttctcttttgaca
C1KGB6_BCL2L11-01       aagatcctccctgctgtctcgatcctccagtgggtatttctcttttgaca
C1KGB7_BCL2L11-01       --------------------------------------------------
A0A287AEC6_BCL2L11      aagatcctccctgctgtctcgatcctccagtgggtatttctcttttgaca
A0A4X1VMQ3_BCL2L11      aagatcctccctgctgtctcgatcctccagtgggtatttctcttttgaca
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      aagatcctccctgctgtctcgatcctccagtgggtatttctcttttgaca
A0A4X1VMQ3_BCL2L11      aagatcctccctgctgtctcgatcctccagtgggtatttctcttttgaca
                                                                          

A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A287AEC6_BCL2L11      -agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccca
C1KGB8_BCL2L11-01       --------------------------------------------------
A0A4X1VMQ3_BCL2L11      cagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccca
C1KGB6_BCL2L11-01       cagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccca
C1KGB7_BCL2L11-01       -agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccca
A0A287AEC6_BCL2L11      cagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccca
A0A4X1VMQ3_BCL2L11      cagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccca
A0A4X1VMQ3_BCL2L11      -agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccca
A0A287AEC6_BCL2L11      cagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccca
A0A4X1VMQ3_BCL2L11      cagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccca
                                                                          

A0A287AEC6_BCL2L11      ------------------------------------------gcttccat
A0A4X1VMQ3_BCL2L11      ------------------------------------------gcttccat
A0A287AEC6_BCL2L11      agtcctccttgccaagccttcaaccattatctcagtgcgatggcttccat
C1KGB8_BCL2L11-01       ------------------------------------------gcttccat
A0A4X1VMQ3_BCL2L11      agtcctccttgccaagccttcaaccattatctcagtgcgatggcttccat
C1KGB6_BCL2L11-01       agtcctccttgccaagccttcaaccattatctcagtgcgatggcttccat
C1KGB7_BCL2L11-01       agtcctccttgccaagccttcaaccattatctcagtgcgatggcttccat
A0A287AEC6_BCL2L11      agtcctccttgccaagccttcaaccattatctcagtgcgatggcttccat
A0A4X1VMQ3_BCL2L11      agtcctccttgccaagccttcaaccattatctcagtgcgatggcttccat
A0A4X1VMQ3_BCL2L11      agtcctccttgccaagccttcaaccattatctcagtgcgatggcttccat
A0A287AEC6_BCL2L11      agtcctccttgccaagccttcaaccattatctcagtgcgatggcttccat
A0A4X1VMQ3_BCL2L11      agtcctccttgccaagccttcaaccattatctcagtgcgatggcttccat
                                                                  ********

A0A287AEC6_BCL2L11      gaggcagtctcaggctgaacccgcagatatgcgcccggagatatggattg
A0A4X1VMQ3_BCL2L11      gaggcagtctcaggctgaacccgcagatatgcgcccggagatatggattg
A0A287AEC6_BCL2L11      gaggcagtctcaggctgaacccgcagatatgcgcccggagatatggattg
C1KGB8_BCL2L11-01       gaggcagtctcaggctgaacccgcagatatgcgcccggagatatggattg
A0A4X1VMQ3_BCL2L11      gaggcagtctcaggctgaacccgcagatatgcgcccggagatatggattg
C1KGB6_BCL2L11-01       gaggcagtctcaggctgaacccgcagatatgcgcccggagatatggattg
C1KGB7_BCL2L11-01       gaggcagtctcaggctgaacccgcagatatgcgcccggagatatggattg
A0A287AEC6_BCL2L11      gaggcagtctcaggctgaacccgcagatatgcgcccggagatatggattg
A0A4X1VMQ3_BCL2L11      gaggcagtctcaggctgaacccgcagatatgcgcccggagatatggattg
A0A4X1VMQ3_BCL2L11      gaggcagtctcaggctgaacccgcagatatgcgcccggagatatggattg
A0A287AEC6_BCL2L11      gaggcagtctcaggctgaacccgcagatatgcgcccggagatatggattg
A0A4X1VMQ3_BCL2L11      gaggcagtctcaggctgaacccgcagatatgcgcccggagatatggattg
                        **************************************************

A0A287AEC6_BCL2L11      cgcaggagttacggcgtattggagacgaatttaatgcatattacccaagg
A0A4X1VMQ3_BCL2L11      cgcaggagttacggcgtattggagacgaatttaatgcatattacccaagg
A0A287AEC6_BCL2L11      cgcaggagttacggcgtattggagacgaatttaatgcatattacccaagg
C1KGB8_BCL2L11-01       cgcaggagttacggcgtattggagacgaatttaatgcatattacccaagg
A0A4X1VMQ3_BCL2L11      cgcaggagttacggcgtattggagacgaatttaatgcatattacccaagg
C1KGB6_BCL2L11-01       cgcaggagttacggcgtattggagacgaatttaatgcatattacccaagg
C1KGB7_BCL2L11-01       cgcaggagttacggcgtattggagacgaatttaatgcatattacccaagg
A0A287AEC6_BCL2L11      cgcaggagttacggcgtattggagacgaatttaatgcatattacccaagg
A0A4X1VMQ3_BCL2L11      cgcaggagttacggcgtattggagacgaatttaatgcatattacccaagg
A0A4X1VMQ3_BCL2L11      cgcaggagttacggcgtattggagacgaatttaatgcatattacccaagg
A0A287AEC6_BCL2L11      cgcaggagttacggcgtattggagacgaatttaatgcatattacccaagg
A0A4X1VMQ3_BCL2L11      cgcaggagttacggcgtattggagacgaatttaatgcatattacccaagg
                        **************************************************

A0A287AEC6_BCL2L11      aggcta--gcagaatg----------------------------------
A0A4X1VMQ3_BCL2L11      aggcta--gcagaatg----------------------------------
A0A287AEC6_BCL2L11      agggtaatgctgttttcttt-----------------accccc-------
C1KGB8_BCL2L11-01       agggtaatgctgttttcttt-----------------accccc-------
A0A4X1VMQ3_BCL2L11      agggtaatgctgttttcttt-----------------accccc-------
C1KGB6_BCL2L11-01       agggtaatgctgttttcttt-----------------accccc-------
C1KGB7_BCL2L11-01       agggtaatgctgttttcttt-----------------accccc-------
A0A287AEC6_BCL2L11      agg-----ttagaacaatag------------------------------
A0A4X1VMQ3_BCL2L11      agg-----ttagaacaatag------------------------------
A0A4X1VMQ3_BCL2L11      agggtctttctgaataattaccaagcagccgaagcccaccctcagatggt
A0A287AEC6_BCL2L11      agggtctttctgaataattaccaagcagccgaagcccaccctcagatggt
A0A4X1VMQ3_BCL2L11      agggtctttctgaataattaccaagcagccgaagcccaccctcagatggt
                        ***        *                                      

A0A287AEC6_BCL2L11      --tctggcatcccacacc-------------------------------t
A0A4X1VMQ3_BCL2L11      --tctggcatcccacacc-------------------------------t
A0A287AEC6_BCL2L11      --cttttcccctcacaccctccctcccccttacatt-------------t
C1KGB8_BCL2L11-01       --cttttcccctcacaccctccctcccccttacatt-------------t
A0A4X1VMQ3_BCL2L11      --cttttcccctcacaccctccctcccccttacatt-------------t
C1KGB6_BCL2L11-01       --cttttcccctcacaccctccctcccccttacatt-------------t
C1KGB7_BCL2L11-01       --cttttcccctcacaccctccctcccccttacatt-------------t
A0A287AEC6_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      --------------------------------------------------
A0A4X1VMQ3_BCL2L11      tatcttacgactgttacgctacatcgcccgtctggtgtggaggatgcagt
A0A287AEC6_BCL2L11      tatcttacgactgttacgctacatcgcccgtctggtgtggaggatgcagt
A0A4X1VMQ3_BCL2L11      tatcttacgactgttacgctacatcgcccgtctggtgtggaggatgcagt
                                                                          

A0A287AEC6_BCL2L11      ga
A0A4X1VMQ3_BCL2L11      ga
A0A287AEC6_BCL2L11      aa
C1KGB8_BCL2L11-01       aa
A0A4X1VMQ3_BCL2L11      aa
C1KGB6_BCL2L11-01       aa
C1KGB7_BCL2L11-01       aa
A0A287AEC6_BCL2L11      --
A0A4X1VMQ3_BCL2L11      --
A0A4X1VMQ3_BCL2L11      ga
A0A287AEC6_BCL2L11      ga
A0A4X1VMQ3_BCL2L11      ga
                          

© 1998-2022Legal notice