Dataset for CDS BAD of organism Sus scrofa

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A287AEF3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Sus scrofa GN=BAD (length=630 residues).
atgggcatcccagaaaatccctcatctgcttccacacacacccaaggaataaggaagtccggagctgaaccagggacccc
ggaggaaggcggtgggcggggccggagccgtagcggccccgcctcccagagcatgttccagatcccagagtttgagcaga
gtgagcaggaagactccagccctgcagacaggggcctgggccccagccccacagggacagacccccagccctggcgcacg
gccccaggccacctgggggaagctggtcaccagcaggggcagccggccagcagcagccaccatggaggcgctggggctgt
ggagacccggagtcgccacagctcttacccagaggggaccgaggaggatgaagggactgaggatgaggagctcagcccct
tccgcggccgatcgctctcggcgccccccatcctctgggctgcacagcgttatggccgcgagctccggaggatgagtgac
gagttccagggttccttcaagaagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagccccag
ctggaagcgcttcctccagtcctggtggtaccggaactcggggagaggaggccccgccccctcccaatga
>gnl|bcl2dbcds|A0A4X1VE31_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Sus scrofa GN=BAD (length=663 residues).
atggggagctcaggcggaaagaagttgtggctggccaggccctccccctcaacagaggaacccttgcctttgccgagcac
aggcaaccggggtccctcactcagagcccagagcatgttccagatcccagagtttgagcagagtgagcaggaagactcca
gccctgcagacaggggcctgggccccagccccacaggggacagacccccaggccccagcaagccctggcgcacggcccca
ggccacctgggggaagctggtcaccagcaggggcagccggccagcagcagccaccatggaggcgctggggctgtggagac
ccggagtcgccacagctcttacccagaggggaccgaggaggatgaagggactgaggatgaggagctcagccccttccgcg
gccgatcgctctcggcgccccccatcctctgggctgcacagcgttatggccgcgagctccggaggatgagtgacgagttc
cagggttccttcaaggtgagcgcgcgcgtgggactgtaccctcgagtctcctcccaatgggctgtcccgttcgagtccca
gggcctttcgggatctgaggtccaggcccccctccagaaggccaagactcctggcttccccaaatccttgaagcgcgagg
caggctggcatctgggctcctga
>gnl|bcl2dbcds|A0A4X1VE31_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Sus scrofa GN=BAD (length=510 residues).
atgttccagatcccagagtttgagcagagtgagcaggaagactccagccctgcagacaggggcctgggccccagccccac
aggggacagacccccaggccccagcaagccctggcgcacggccccaggccacctgggggaagctggtcaccagcaggggc
agccggccagcagcagccaccatggaggcgctggggctgtggagacccggagtcgccacagctcttacccagaggggacc
gaggaggatgaagggactgaggatgaggagctcagccccttccgcggccgatcgctctcggcgccccccatcctctgggc
tgcacagcgttatggccgcgagctccggaggatgagtgacgagttccagggttccttcaagaagggacttcctcgcccga
agagcgcgggcacagcgacgcagatgcggcaaagccccagctggaagcgcttcctccagtcctggtggtaccggaactcg
gggagaggaggccccgccccctcccaatga
>gnl|bcl2dbcds|A0A4X1VE31_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Sus scrofa GN=BAD (length=639 residues).
atgggcatcccagaaaatccctcatctgcttccacacacacccaaggaataaggaagtccggagctgaaccagggacccc
ggaggaaggcggtgggcggggccggagccgccaggggtacctgtcccagagcatgttccagatcccagagtttgagcaga
gtgagcaggaagactccagccctgcagacaggggcctgggccccagccccacaggggacagacccccaggccccagcaag
ccctggcgcacggccccaggccacctgggggaagctggtcaccagcaggggcagccggccagcagcagccaccatggagg
cgctggggctgtggagacccggagtcgccacagctcttacccagaggggaccgaggaggatgaagggactgaggatgagg
agctcagccccttccgcggccgatcgctctcggcgccccccatcctctgggctgcacagcgttatggccgcgagctccgg
aggatgagtgacgagttccagggttccttcaagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggca
aagccccagctggaagcgcttcctccagtcctggtggtaccggaactcggggagaggaggccccgccccctcccaatga
© 1998-2022Legal notice