Dataset for CDS BAD of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4X1VE31_BAD-01      atggggagctcaggcggaaagaagttgtggctggccaggccctccccctc
A0A287AEF3_BAD-01      atgggcatccca---gaaaatccctcatctgcttccacacacacccaagg
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      atgggcatccca---gaaaatccctcatctgcttccacacacacccaagg

A0A4X1VE31_BAD-01      aacagaggaacccttgcctttgccgagcac------------aggcaacc
A0A287AEF3_BAD-01      aataaggaagtccggagctgaaccagggaccccggaggaaggcggtgggc
A0A4X1VE31_BAD-02      --------------------------------------------------
A0A4X1VE31_BAD-03      aataaggaagtccggagctgaaccagggaccccggaggaaggcggtgggc

A0A4X1VE31_BAD-01      ggggtccctcactcagag---------cccagagcatgttccagatccca
A0A287AEF3_BAD-01      ggggccggagccgtagcggccccgcctcccagagcatgttccagatccca
A0A4X1VE31_BAD-02      -----------------------------------atgttccagatccca
A0A4X1VE31_BAD-03      ggggccggagccgccaggggtacctgtcccagagcatgttccagatccca

A0A4X1VE31_BAD-01      gagtttgagcagagtgagcaggaagactccagccctgcagacaggggcct
A0A287AEF3_BAD-01      gagtttgagcagagtgagcaggaagactccagccctgcagacaggggcct
A0A4X1VE31_BAD-02      gagtttgagcagagtgagcaggaagactccagccctgcagacaggggcct
A0A4X1VE31_BAD-03      gagtttgagcagagtgagcaggaagactccagccctgcagacaggggcct

A0A4X1VE31_BAD-01      gggccccagccccacaggggacagacccccaggccccagcaagccctggc
A0A287AEF3_BAD-01      gggccccagccccaca-gggacagaccccc-----------agccctggc
A0A4X1VE31_BAD-02      gggccccagccccacaggggacagacccccaggccccagcaagccctggc
A0A4X1VE31_BAD-03      gggccccagccccacaggggacagacccccaggccccagcaagccctggc
                       **************** *************           *********

A0A4X1VE31_BAD-01      gcacggccccaggccacctgggggaagctggtcaccagcaggggcagccg
A0A287AEF3_BAD-01      gcacggccccaggccacctgggggaagctggtcaccagcaggggcagccg
A0A4X1VE31_BAD-02      gcacggccccaggccacctgggggaagctggtcaccagcaggggcagccg
A0A4X1VE31_BAD-03      gcacggccccaggccacctgggggaagctggtcaccagcaggggcagccg

A0A4X1VE31_BAD-01      gccagcagcagccaccatggaggcgctggggctgtggagacccggagtcg
A0A287AEF3_BAD-01      gccagcagcagccaccatggaggcgctggggctgtggagacccggagtcg
A0A4X1VE31_BAD-02      gccagcagcagccaccatggaggcgctggggctgtggagacccggagtcg
A0A4X1VE31_BAD-03      gccagcagcagccaccatggaggcgctggggctgtggagacccggagtcg

A0A4X1VE31_BAD-01      ccacagctcttacccagaggggaccgaggaggatgaagggactgaggatg
A0A287AEF3_BAD-01      ccacagctcttacccagaggggaccgaggaggatgaagggactgaggatg
A0A4X1VE31_BAD-02      ccacagctcttacccagaggggaccgaggaggatgaagggactgaggatg
A0A4X1VE31_BAD-03      ccacagctcttacccagaggggaccgaggaggatgaagggactgaggatg

A0A4X1VE31_BAD-01      aggagctcagccccttccgcggccgatcgctctcggcgccccccatcctc
A0A287AEF3_BAD-01      aggagctcagccccttccgcggccgatcgctctcggcgccccccatcctc
A0A4X1VE31_BAD-02      aggagctcagccccttccgcggccgatcgctctcggcgccccccatcctc
A0A4X1VE31_BAD-03      aggagctcagccccttccgcggccgatcgctctcggcgccccccatcctc

A0A4X1VE31_BAD-01      tgggctgcacagcgttatggccgcgagctccggaggatgagtgacgagtt
A0A287AEF3_BAD-01      tgggctgcacagcgttatggccgcgagctccggaggatgagtgacgagtt
A0A4X1VE31_BAD-02      tgggctgcacagcgttatggccgcgagctccggaggatgagtgacgagtt
A0A4X1VE31_BAD-03      tgggctgcacagcgttatggccgcgagctccggaggatgagtgacgagtt

A0A4X1VE31_BAD-01      ccagggttccttcaaggtgagcgcgcgcgtgggactgtaccctcgagtct
A0A287AEF3_BAD-01      ccagggttccttcaag----------------------------------
A0A4X1VE31_BAD-02      ccagggttccttcaag----------------------------------
A0A4X1VE31_BAD-03      ccagggttccttc-------------------------------------

A0A4X1VE31_BAD-01      cctcccaatgggctgtcccgttcgagtcccagggcctttcgggatctgag
A0A287AEF3_BAD-01      ------aagggacttcctcgcccga-----agagc---gcgggcacagcg
A0A4X1VE31_BAD-02      ------aagggacttcctcgcccga-----agagc---gcgggcacagcg
A0A4X1VE31_BAD-03      ------aagggacttcctcgcccga-----agagc---gcgggcacagcg
                             ** ** **  * **  ***     ** **    ****  * * *

A0A4X1VE31_BAD-01      gtccaggcccccctccagaaggccaagactc--ctg-----gcttcccca
A0A287AEF3_BAD-01      acgcagatgc----------ggcaaagccccagctggaagcgcttcctcc
A0A4X1VE31_BAD-02      acgcagatgc----------ggcaaagccccagctggaagcgcttcctcc
A0A4X1VE31_BAD-03      acgcagatgc----------ggcaaagccccagctggaagcgcttcctcc
                          ***   *          *** *** * *  ***     ****** * 

A0A4X1VE31_BAD-01      aatcct--------tgaagcgcgaggcaggctggcatctgggctcc----
A0A287AEF3_BAD-01      agtcctggtggtaccggaactcggggagaggaggcccc---gccccctcc
A0A4X1VE31_BAD-02      agtcctggtggtaccggaactcggggagaggaggcccc---gccccctcc
A0A4X1VE31_BAD-03      agtcctggtggtaccggaactcggggagaggaggcccc---gccccctcc
                       * ****         * * * ** **   *  ***  *   ** **    

A0A4X1VE31_BAD-01      ---tga
A0A287AEF3_BAD-01      caatga
A0A4X1VE31_BAD-02      caatga
A0A4X1VE31_BAD-03      caatga

© 1998-2020Legal notice