Dataset for CDS classical BH3-containing proteins of organism Suricata suricatta

[Download (right click)] [Alignment] [Repertoires]

10 sequence(s)

>gnl|bcl2dbcds|A0A673SRF7_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Suricata suricatta GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttcagatgtaagttctgaatgtgacagagaaggtggacaattgcagcctgctgagagacctcctca
gctcaggcctggggcccctacctctctacagacccagcggcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccgggccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccatcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgcacctgcagacatgcgcccggagatctggatcgcacaggagctgcggcgtattggagacgaatttaatgcatat
tacccaaggagggtctttttgaataattaccaagcagccgaagcccacccccaaatgataatcttacgactgttacgtta
catcgtccgcttggtgtggcgattgcagcga
>gnl|bcl2dbcds|A0A673SRF7_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Suricata suricatta GN=BCL2L11 (length=513 residues).
atggcaaagcaaccttcagatgtaagttctgaatgtgacagagaaggtggacaattgcagcctgctgagagacctcctca
gctcaggcctggggcccctacctctctacagacccagcggcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccatcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgca
cctgcagacatgcgcccggagatctggatcgcacaggagctgcggcgtattggagacgaatttaatgcatattacccaag
gaggggggaaggaccaagcatgttcactgagcccaagagggtgtgtgcgtccgctaaggctgctgtaacagagtacgaca
gactccaggggagggagtgcataaacgacagaaccgcatttattcagtcctggaggccagaggcttgggagctcgggctg
gctgcgcctgtgtgctgtgcaaggtctttttga
>gnl|bcl2dbcds|A0A673SRF7_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Suricata suricatta GN=BCL2L11 (length=504 residues).
atggcaaagcaaccttcagatgtaagttctgaatgtgacagagaaggtggacaattgcagcctgctgagagacctcctca
gctcaggcctggggcccctacctctctacagacccagcggcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccgggccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccatcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgcacctgcagacatgcgcccggagatctggatcgcacaggagctgcggcgtattggagacgaatttaatgcatat
tacccaaggaggttagagcaatag
>gnl|bcl2dbcds|A0A673SRF7_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Suricata suricatta GN=BCL2L11 (length=264 residues).
atggcaaagcaaccttcagatgtaagttctgaatgtgacagagaaggtggacaattgcagcctgctgagagacctcctca
gctcaggcctggggcccctacctctctacagacccagcggcaagcttccatgaggcagtctcaggctgcacctgcagaca
tgcgcccggagatctggatcgcacaggagctgcggcgtattggagacgaatttaatgcatattacccaaggaggctggca
ggagttccagcatcctctatctta
>gnl|bcl2dbcds|A0A673TA87_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Suricata suricatta GN=BMF (length=882 residues).
tgtttccaagggaaggttcgtacattcgtgaccgtccctggcagtcgcccagcccgggacttggggctccactctccatt
ggccggccgtgggcgtgacgcgcgggaggcggggcctcatcagctgtttgcgggatgccccgagcgggcgtattttggaa
acaatacggcgcgggccacggtggcctccacccgcgccagcccgccagctgccgctgccgcccctgccagcgcctcccgc
cacccgccgcagcccgctgggctctttccctccttcccaattgagtctgggcgccaagcccccgagtgttcgtcacgctg
gaccctggcgcggagccctggcatcacgactcggaggcggagactctctcctggagtcacccagcaggggagatggagcc
agcctgggagcttgctgtctgccaacctgtttgcccagagccaactggactgtcctctcagccacctgcaactcttccct
ctcacccactgctgtggccctgggcttcgacccaccagccaggaggacaaggccacccagacccttagtccggcttcccc
gagtcagggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatggcaacgccggctaccggctcc
ctctccctgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcattggcaacatcgagcagaggta
cagattgcccggaagcttcagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcaaaaccgaaatcg
agtgtggtggcaactcctcctcttcctacacaacctggccttgaatgcagaagagaacaggaatggggcaggtcccaggt
ga
>gnl|bcl2dbcds|A0A673UI19_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Suricata suricatta GN=PMAIP1 (length=165 residues).
atgcccgggaagaaggcgcgcaagagcgcgcagccaagccccgcgcgggccccggcagagcccgaggtggaatgtgccat
gcagctccggagaattggagacaaactgaatttccggcagaaacttatgaatctgatagccaaactcttccgctcgggaa
cctga
>gnl|bcl2dbcds|A0A673UKJ9_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Suricata suricatta GN=BBC3 (length=393 residues).
atgtatagcagtgcaggggctgcccgggcatgtccctggaaggtgggggcttccttagtgccccgggtgccccgtcagat
ttgtggtcctcagccctcactctcgccggcggagccacacctggaatcgccggtgcccagcgccccgggggccctggcgg
gcggccccacccaggcagccccgggaatccggggggaggaagagcagtgggcccgggagatcggggcccagctgcggcgg
atggcggacgacctcaacgcgctgtacgagcggcggagacaagaggagcagcagcgacaccgcccctcaccctggagggt
cctgtacaatctcatcatgggactcctgcccttacccagggcccgcggagccccggagatggagcccaattag
>gnl|bcl2dbcds|A0A673UKJ9_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Suricata suricatta GN=BBC3 (length=303 residues).
atgtatagcagtgcaggggctgcccgggcatgtccctggaaggtgggggcttccttagtgccccgggtgccccgtcagat
ttgtgagacaagaggagcagcagcgacaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgccc
ttacccagggcccgcggagccccggagatggagcccaattaggtgcctgcacccgcccggtggacgtcggggacttgggg
ggcaggaccctcccgcctcctgacgccctggccagcgcgggggacttcttctgcaccatgtag
>gnl|bcl2dbcds|A0A673V4V4_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Suricata suricatta GN=BIK (length=471 residues).
atgacagagccaaacagagaagaaatgtctcacgcaggacccctctccagggatgtctttttgagcaccttcctgcagga
gcatggcccggaagttctggacgttcccggcgtgactgatctcgtggagtactatgatcccgggccctcccctaacagca
acagccccgatgacgtggccatgcggctggccttcatcggggacgagatggaagtgaggtggatggtgccccgcgttggc
gagctgcctgggatggccttgtacagcttggcctttacctacaaccagacgggcctgaggggtgttctcaggagtctcat
ggacgggctcgccagcctcagggagaacatccgcgtgtggagcttcctgaccctcaggaacagggtgtccccgaacgctg
gccgtgggctggcgctgtccctgctgctgctggtgctgctgctcagctgggggctccaccacctccagtga
>gnl|bcl2dbcds|A0A673V6P8_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Suricata suricatta GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcccagtgagcaggaagactcaagccctacagataggggcctgggccccagccccac
aggggaccggccctcaggccttggcaagcaccagcggacggccccgggcctccttggggaagctggtccccagcaggggc
agccggccagcagcagccgccatggaggcgctggggctgtggagacacggagtcgtcacagctcgtaccccgccgggacc
gaggaggatgaagggacggaggaggaagagcccagccctttccggggtcgctcacgctcggcgccccccaacctctgtgc
tgcactgcgctacggccgtgagctccggaggatgagcgacgagttccagggctccttcaagggacttccacgcccgaaga
gcgcgggcacagcgacgcagatgcggcaaagccccagctggacgcgcttcatccagtcctggtgggatcggaacttgggg
agaggaggctccgccccctcccagtga
© 1998-2020Legal notice