Dataset for CDS classical BH3-containing proteins of organism Suricata suricatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A673UI19_PMAIP1-      --------------------------------------------------
A0A673SRF7_BCL2L11      ---------atggcaaag-------------------------------c
A0A673SRF7_BCL2L11      ---------atggcaaag-------------------------------c
A0A673SRF7_BCL2L11      ---------atggcaaag-------------------------------c
A0A673SRF7_BCL2L11      ---------atggcaaag-------------------------------c
A0A673V4V4_BIK-01       ---------atgacagagccaaacagagaagaaatgtctcacgcaggacc
A0A673V6P8_BAD-01       atgttccagatcccagagtttgagcccagtgagcag------gaagactc
A0A673TA87_BMF-01       tgtttccaagg--gaaggttcgtacattcgtgaccgtccctggcagtcgc
A0A673UKJ9_BBC3-01      -------------------------atgtatagcagt-----gca-----
A0A673UKJ9_BBC3-02      -------------------------atgtatagcagt-----gca-----

A0A673UI19_PMAIP1-      -------------------------------------------------a
A0A673SRF7_BCL2L11      aaccttcagatgtaagttct-------------------------gaatg
A0A673SRF7_BCL2L11      aaccttcagatgtaagttct-------------------------gaatg
A0A673SRF7_BCL2L11      aaccttcagatgtaagttct-------------------------gaatg
A0A673SRF7_BCL2L11      aaccttcagatgtaagttct-------------------------gaatg
A0A673V4V4_BIK-01       cctctccagggatgtctttttgagcaccttcctgcag--------gagca
A0A673V6P8_BAD-01       aagccctacagataggggcctgggccc-------cagccccacaggggac
A0A673TA87_BMF-01       ccagcccgggacttggggct---ccactctccattggccggccgtgggcg
A0A673UKJ9_BBC3-01      --------------ggggct---gccc------------------gggca
A0A673UKJ9_BBC3-02      --------------ggggct---gccc------------------gggca

A0A673UI19_PMAIP1-      tgcccgggaagaaggcgcgca-----------------------------
A0A673SRF7_BCL2L11      tgac---agagaaggtggacaattgcag---------------------c
A0A673SRF7_BCL2L11      tgac---agagaaggtggacaattgcag---------------------c
A0A673SRF7_BCL2L11      tgac---agagaaggtggacaattgcag---------------------c
A0A673SRF7_BCL2L11      tgac---agagaaggtggacaattgcag---------------------c
A0A673V4V4_BIK-01       tggccc-ggaagttctggacgttcccgg------------cgtgactgat
A0A673V6P8_BAD-01       cggccctc--------aggccttggcaagcaccagcggacggccccgggc
A0A673TA87_BMF-01       tgacgcgcgggaggcggggcctcatcagctgtttgcgggatgccccgagc
A0A673UKJ9_BBC3-01      tgtccctggaaggtgggggcttccttag------------tgccccgggt
A0A673UKJ9_BBC3-02      tgtccctggaaggtgggggcttccttag------------tgccccgggt
                         * *               *                              

A0A673UI19_PMAIP1-      --------------------------------------------------
A0A673SRF7_BCL2L11      ctgctgagagacct-----------------------cctcagctcaggc
A0A673SRF7_BCL2L11      ctgctgagagacct-----------------------cctcagctcaggc
A0A673SRF7_BCL2L11      ctgctgagagacct-----------------------cctcagctcaggc
A0A673SRF7_BCL2L11      ctgctgagagacct-----------------------cctcagctcaggc
A0A673V4V4_BIK-01       ctcgtggagtacta--------------------------tgatccc---
A0A673V6P8_BAD-01       ctccttggggaagc--------------------------tggtccccag
A0A673TA87_BMF-01       g----ggcgtattttggaaacaatacggcgcgggccacggtggcctccac
A0A673UKJ9_BBC3-01      gccccgtcagattt-------------------------gtggtcctca-
A0A673UKJ9_BBC3-02      gccccgtcagattt-------------------------gt---------

A0A673UI19_PMAIP1-      --------------------------------------------------
A0A673SRF7_BCL2L11      ctggggcccctacctctctacagacccagc--------------------
A0A673SRF7_BCL2L11      ctggggcccctacctctctacagacccagc--------------------
A0A673SRF7_BCL2L11      ctggggcccctacctctctacagacccagc--------------------
A0A673SRF7_BCL2L11      ctggggcccctacctctctacagacccagc--------------------
A0A673V4V4_BIK-01       ---gggccctcccctaacagcaacagcccc--------------------
A0A673V6P8_BAD-01       caggggcagccggccagcagcagccgcca----tggaggcgct-------
A0A673TA87_BMF-01       ccgcgccagcccgccagctgccgctgccgcccctgccagcgcctcccgcc
A0A673UKJ9_BBC3-01      ----gccctcactctcgccggcggagccacacctggaatcgcc-------
A0A673UKJ9_BBC3-02      --------------------------------------------------

A0A673UI19_PMAIP1-      --------------------------------------------------
A0A673SRF7_BCL2L11      ------------------------------------------------gg
A0A673SRF7_BCL2L11      ------------------------------------------------gg
A0A673SRF7_BCL2L11      ------------------------------------------------gg
A0A673SRF7_BCL2L11      ------------------------------------------------gg
A0A673V4V4_BIK-01       ------------------------------------------------ga
A0A673V6P8_BAD-01       ------------------------------------------------gg
A0A673TA87_BMF-01       acccgccgcagcccgctgggctctttccctccttcccaattgagtctggg
A0A673UKJ9_BBC3-01      ------------------------------------------------gg
A0A673UKJ9_BBC3-02      --------------------------------------------------

A0A673UI19_PMAIP1-      --------------------------------------------------
A0A673SRF7_BCL2L11      caaggtaatcctgaaggcgaaggggaccgctgcccccaaggcagccctca
A0A673SRF7_BCL2L11      caaggtaatcctgaaggcgaaggggaccgctgcccccaaggcagccctca
A0A673SRF7_BCL2L11      ca------------------------------------------------
A0A673SRF7_BCL2L11      ca------------------------------------------------
A0A673V4V4_BIK-01       tgacgtggccatgcgg------------ctggccttcatcgggg------
A0A673V6P8_BAD-01       ggctgtggagacacggagtcgtcacagctcgtaccccgccggga------
A0A673TA87_BMF-01       cgccaagcccccgagtgttcgtcacg--ctggaccctggcgcggagccct
A0A673UKJ9_BBC3-01      tgcccagcgccccgg---------------gggccctggcgggcggcccc
A0A673UKJ9_BBC3-02      --------------------------------------------------

A0A673UI19_PMAIP1-      --------------------------------------------------
A0A673SRF7_BCL2L11      gggcccgctggccccaccag------------------------------
A0A673SRF7_BCL2L11      gggcccgctggccccaccag------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673V4V4_BIK-01       ------------acgagatgga---------------------agtgagg
A0A673V6P8_BAD-01       ------------ccgaggagga---------------tgaagggacggag
A0A673TA87_BMF-01       ggcatcacgactcggaggcggagactctctcctggagtcacccagcaggg
A0A673UKJ9_BBC3-01      acccaggcagccccgggaat--------------------ccggggggag
A0A673UKJ9_BBC3-02      --------------------------------------------------

A0A673UI19_PMAIP1-      --------------------------------------------------
A0A673SRF7_BCL2L11      ----------ccagccccgggccttttgctaccagatccccgcttttcat
A0A673SRF7_BCL2L11      ----------ccagccccgggccttttgctaccagatccccgcttttcat
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673V4V4_BIK-01       tggatggtgccccgc-----------------------------------
A0A673V6P8_BAD-01       gaggaagagcccagcc-------------------------ctttccggg
A0A673TA87_BMF-01       gagatggagccagcctgggagcttgctgtctgccaacctgtttgcccaga
A0A673UKJ9_BBC3-01      gaagagcagtgggcccgggagatcg----------------------ggg
A0A673UKJ9_BBC3-02      --------------------------------------------------

A0A673UI19_PMAIP1-      --------------------------------------------------
A0A673SRF7_BCL2L11      ctttgtgagaagatcctccctgctgtct--cgatcctccagtgggtattt
A0A673SRF7_BCL2L11      ctttgtgagaagatcctccctgctgtct--cgatcctccagtgggtattt
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673V4V4_BIK-01       -------------gttggcgagctgcctgggatggccttgtacagct---
A0A673V6P8_BAD-01       gtcgctcacgctcggcgccccccaacct---------ctgtgctgcactg
A0A673TA87_BMF-01       gccaactggactgtcctctcagccacctgcaactcttccctctcacccac
A0A673UKJ9_BBC3-01      cccagctgcggcggatggcggacgacct--------------caacgcgc
A0A673UKJ9_BBC3-02      --------------------------------------------------

A0A673UI19_PMAIP1-      --------------------------------------------------
A0A673SRF7_BCL2L11      ctcttttgacacagacaggagcccggcacccatgagttgtgacaaatcaa
A0A673SRF7_BCL2L11      ctcttttgacacagacaggagcccggcacccatgagttgtgacaaatcaa
A0A673SRF7_BCL2L11      ------------agacaggagcccggcacccatgagttgtgacaaatcaa
A0A673SRF7_BCL2L11      ------------a-------------------------------------
A0A673V4V4_BIK-01       -----tggcctttacctacaaccagacgggcctgagg-------------
A0A673V6P8_BAD-01       cgctacggccgtgagct-------------ccggaggatgagcga--cga
A0A673TA87_BMF-01       tgctgtggccctgggcttcgacccaccagccaggaggacaag--g--cca
A0A673UKJ9_BBC3-01      tgtacgagcggcgg-------------agacaagaggagcagcag--cga
A0A673UKJ9_BBC3-02      -------------g-------------agacaagaggagcagcag--cga

A0A673UI19_PMAIP1-      ------------------------------agagcgcgcagc--------
A0A673SRF7_BCL2L11      cacaaaccccaagtcctccttgcc------aggccatcaaccattatctc
A0A673SRF7_BCL2L11      cacaaaccccaagtcctccttgcc------aggccatcaaccattatctc
A0A673SRF7_BCL2L11      cacaaaccccaagtcctccttgcc------aggccatcaaccattatctc
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673V4V4_BIK-01       ------------------------------ggtgttctcaggagtctcat
A0A673V6P8_BAD-01       ----gttcc---------------------aggg----------ctcctt
A0A673TA87_BMF-01       cccagacccttagtccggcttccccgagtcagggtgtcatgctgccttgt
A0A673UKJ9_BBC3-01      caccgcccctcaccctgg------------agggtcctgtacaatctcat
A0A673UKJ9_BBC3-02      caccgcccctcaccctgg------------agggtcctgtacaatctcat

A0A673UI19_PMAIP1-      --------------------------------------------------
A0A673SRF7_BCL2L11      agtgcaat------------------------------------------
A0A673SRF7_BCL2L11      agtgcaat------------------------------------------
A0A673SRF7_BCL2L11      agtgcaat------------------------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673V4V4_BIK-01       ggacgggc------------------------------------------
A0A673V6P8_BAD-01       caagggac------------------------------------------
A0A673TA87_BMF-01       ggggtgaccgaagaaccccagcgactcttttatggcaacgccggctaccg
A0A673UKJ9_BBC3-01      catgggac------------------------------------------
A0A673UKJ9_BBC3-02      catgggac------------------------------------------

A0A673UI19_PMAIP1-      ------------------------------caagccc-----cgcgcggg
A0A673SRF7_BCL2L11      ---------------------------------ggcttccatgaggcagt
A0A673SRF7_BCL2L11      ---------------------------------ggcttccatgaggcagt
A0A673SRF7_BCL2L11      ---------------------------------ggcttccatgaggcagt
A0A673SRF7_BCL2L11      ----------------------------------gcttccatgaggcagt
A0A673V4V4_BIK-01       ---------tcg------------------ccagcctcagggagaacatc
A0A673V6P8_BAD-01       ---------ttc------------------cacgccc-------------
A0A673TA87_BMF-01       gctccctctccctgccagtttccctgcaggcttgccccttggtgagcagc
A0A673UKJ9_BBC3-01      ---------tcctgcc--------------cttaccc-------------
A0A673UKJ9_BBC3-02      ---------tcctgcc--------------cttaccc-------------

A0A673UI19_PMAIP1-      ccccggcagagccc---------------gaggtggaatgtgccatgcag
A0A673SRF7_BCL2L11      ctcaggctgcacctgcagacatgcgcccggagatctggatcgcacaggag
A0A673SRF7_BCL2L11      ctcaggctgcacctgcagacatgcgcccggagatctggatcgcacaggag
A0A673SRF7_BCL2L11      ctcaggctgcacctgcagacatgcgcccggagatctggatcgcacaggag
A0A673SRF7_BCL2L11      ctcaggctgcacctgcagacatgcgcccggagatctggatcgcacaggag
A0A673V4V4_BIK-01       cgcgtgtggagctt----cctgaccctcaggaacagggtgtccccgaacg
A0A673V6P8_BAD-01       -----gaagagcgcgggcacagcgacgcagatgcggcaaagccccagc--
A0A673TA87_BMF-01       cccctgaagggcattggcaacatcgagcagaggtacagattgcccggaag
A0A673UKJ9_BBC3-01      -------agggccc------------gcggag---------ccccggaga
A0A673UKJ9_BBC3-02      -------agggccc------------gcggag---------ccccggaga
                                *  *                 *            *       

A0A673UI19_PMAIP1-      ctccggagaattgga---gacaaactgaatttccggcagaaacttatgaa
A0A673SRF7_BCL2L11      ctgcggcgtattgga---gacgaat-----------ttaatgcatattac
A0A673SRF7_BCL2L11      ctgcggcgtattgga---gacgaat-----------ttaatgcatattac
A0A673SRF7_BCL2L11      ctgcggcgtattgga---gacgaat-----------ttaatgcatattac
A0A673SRF7_BCL2L11      ctgcggcgtattgga---gacgaat-----------ttaatgcatattac
A0A673V4V4_BIK-01       ctggccg----tgggctggcgctgtccctgctgctgctggtgctgctgct
A0A673V6P8_BAD-01       -----------tggacgcgcttcat-------------------ccagtc
A0A673TA87_BMF-01       cttcagtgcattgca---gaccagttccatcggcttcatatgcagcaaca
A0A673UKJ9_BBC3-01      -----------tgga---gcccaat-------------tag---------
A0A673UKJ9_BBC3-02      -----------tgga---gcccaat-------------taggtgcctgca
                                   **     *                               

A0A673UI19_PMAIP1-      tctg----------------------------------------------
A0A673SRF7_BCL2L11      ccaaggagggtctttttgaataa---------------------------
A0A673SRF7_BCL2L11      ccaaggagg-----ttagagcaa---------------------------
A0A673SRF7_BCL2L11      ccaaggagg-----ggggaaggaccaagcatgttcactgagcccaagagg
A0A673SRF7_BCL2L11      ccaaggagg-----ctggcagga--------gttc---------------
A0A673V4V4_BIK-01       c-------------------------------------------------
A0A673V6P8_BAD-01       ctggtgggatcggaacttgg------------------------------
A0A673TA87_BMF-01       ccagcaaaaccgaaatcgag------------------------------
A0A673UKJ9_BBC3-01      --------------------------------------------------
A0A673UKJ9_BBC3-02      cccgcccggtggacgtcggggac---------------------------

A0A673UI19_PMAIP1-      ------------------------atagccaaactcttccgctcgg----
A0A673SRF7_BCL2L11      --------------------ttaccaagcagccgaagcccaccccc----
A0A673SRF7_BCL2L11      --------------------tag---------------------------
A0A673SRF7_BCL2L11      gtgtgtgcgtccgctaaggctgctgtaacagagtacgacagactccaggg
A0A673SRF7_BCL2L11      --------------------------------------cagcatcc----
A0A673V4V4_BIK-01       -----------------------agctgggggctccaccacctcca----
A0A673V6P8_BAD-01       ----------------------ggagaggaggctccgccccctccc----
A0A673TA87_BMF-01       ---------------------tgtggtggcaactcctcctcttcct----
A0A673UKJ9_BBC3-01      --------------------------------------------------
A0A673UKJ9_BBC3-02      --------------------ttggggggcaggaccctcccgcctcc----

A0A673UI19_PMAIP1-      --------------------------------------------------
A0A673SRF7_BCL2L11      ------------aaatgataatcttacgactgttacgttacatcgtccgc
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      gagggagtgcataaacgacagaaccgcatttattcagtcctggaggccag
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673V4V4_BIK-01       --------------------------------------------------
A0A673V6P8_BAD-01       -----------------------------------------a--------
A0A673TA87_BMF-01       -----------------------------------------acacaacct
A0A673UKJ9_BBC3-01      --------------------------------------------------
A0A673UKJ9_BBC3-02      -----------------------------------------tgacgccct

A0A673UI19_PMAIP1-      ---------------------------------------------gaacc
A0A673SRF7_BCL2L11      ttggtgtggcgattgcagcga-----------------------------
A0A673SRF7_BCL2L11      --------------------------------------------------
A0A673SRF7_BCL2L11      aggcttgggagctcgggctggctgcgcctgtgtgctgtgcaaggtctttt
A0A673SRF7_BCL2L11      --------------------------------------------tctatc
A0A673V4V4_BIK-01       -------------------------------------------------g
A0A673V6P8_BAD-01       -------------------------------------------------g
A0A673TA87_BMF-01       ggccttgaatgcagaagagaacaggaatggggcaggtc-------ccagg
A0A673UKJ9_BBC3-01      --------------------------------------------------
A0A673UKJ9_BBC3-02      ggcc-------------------agcgcgggggacttcttctgcaccatg

A0A673UI19_PMAIP1-      tga
A0A673SRF7_BCL2L11      ---
A0A673SRF7_BCL2L11      ---
A0A673SRF7_BCL2L11      tga
A0A673SRF7_BCL2L11      tta
A0A673V4V4_BIK-01       tga
A0A673V6P8_BAD-01       tga
A0A673TA87_BMF-01       tga
A0A673UKJ9_BBC3-01      ---
A0A673UKJ9_BBC3-02      tag

© 1998-2021Legal notice