Dataset for CDS classical BH3-containing proteins of organism Sinocyclocheilus grahami

[Download (right click)] [Alignment] [Repertoires]

10 sequence(s)

>gnl|bcl2dbcds|A0A672JWL9_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Sinocyclocheilus grahami GN=BMF (length=432 residues).
atggatgaggatgaggatgatgtgcgcaggaagggtctacagcactggccttcctcccgcgttcagataaagcagaccga
gaccgcagggataccccctctatgccccagcggcatgctgccctgtcgagtgcatgtggagcccagacgctttctctacg
gtaacacaggactgctgctgctagcgccgcctagccgctctcggcctccagacgtggttctccggcagaacctgcgcatg
atggatccggcggagagcgtggagaccctcatcgggcagaagctccagctgatcggagatcagttctatcaggagcacat
gatgcatcacagaaaccaaaggaaccgggagccgctgtggtggcgcgtggccgtggcgttctacacgcttttatttggaa
gagagcccaacgcaagagcaaatcgtaggtga
>gnl|bcl2dbcds|A0A672JWL9_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Sinocyclocheilus grahami GN=BMF (length=393 residues).
atggatgaggatgaggatgatgtgcgcaggaagggtctacagcactggccttcctcccgcgttcagataaagcagaccga
gaccgcagggataccccctctatgccccagcggcatgctgccctgtcgagtgcatgtggagcccagacgctttctctacg
gtaacacaggactgctgctgctagcgccgcctagccgctctcggcctccagacgtggttctccggcagaacctgcgcatg
atggatccggcggagagcgtggagaccctcatcgggcagaagctccagctgatcggagatcagttctatcaggacgctcc
tttacacaaaagtgttccatgtgccgtgtttgttttggccggactgtttcctgactctggtctagttgtttga
>gnl|bcl2dbcds|A0A672L1R2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=BCL2L11 (length=531 residues).
atgtctgacacgtccagagagcaaacgccgggccggggaagcggagagagcgccggtggcgcagccgtcttaggctccgg
gcactttgacttccctcagccgagcgatggggacccgttaaggggagggattgccatgtcgagtagtcaccagtcgaggt
caccgatgtcccgaaccttctccaggtcctctagtggctatttttccgtcgacagcgattctgtgccaagttccccgcta
atgcccaatatttccgaagcgcaagacggccaaaatgatgaggtatggtctgccgaacctagccaccagcacgtgcagat
ggcagcacctgtcggagccatggggccggagatggcggtcgctcgggagctgcggcgcattggagacgagttcaaccgtc
tgtactgtcagggggccggtgcaggcgggaacaacgcggcccagctgcgcgctcccaacgaacacgccatcatcatgtgg
atgaacgaccttatcggacgtgtagtacagtttttcctgcgaaggagatga
>gnl|bcl2dbcds|A0A672LB88_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Sinocyclocheilus grahami GN=BAD (length=444 residues).
atggataacacactgcatgaccatcaagatgattccagcacctggaatgacaaaaagaaaggaagagaagagacaatcaa
aaaccaaggacaacatcaggatcaaaccttgccaaacatttctcctcaagggcgtgtgcggctctattcggagtctcagg
tgtatacggtgagccgctggcaggaagcagagccccaggatggagcattggtggaggagaacggaggaacgggagatgga
cttccattcagaggtcgttctcagtctgctcctgctgctctgtggaaagcaaagaagtacgggcgacagctgaggagaat
gagcgatgaatttgacacatggctcgacaaaggggaggtcaaaagagcgaacagccagaaacagacctaccgaggatggt
tctcgttcctctggagttccaaagaagaggagggcagagaatga
>gnl|bcl2dbcds|A0A672PQD1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=BCL2L11 (length=534 residues).
atgtccgacacgtccagcagagagcaaacgccgggccggggaagcggagagagcgccggtggcgcagccgtcttaggctc
cgggcactttgacttccctcagccgagcgatggggacccgttaaggggagggattgccatgtcgagtagtcaccagtcga
ggtcaccgatgtgccggaccttctccaggtcctctagtggctatttttccgtcgacagcgattctgtgccaggttccccg
ctaatgcccaatatttccgaagcgcaagacggcccaaatgatgaggtatggtttgccgaacctagccaccagcacgcaca
gatggcggcacctgtgggagccatggggccggagatggcggtcgctcgggagctgcggcgcattggagacgagttcaacc
gcctgtactgtcagggggccggtgcaggtgggaacaacggggcccagctgcacgctcccaacgaacacgccatcatcatg
tggatgaacgaccttatcggacgtgtagtacagtttttcctgcgaagaagatga
>gnl|bcl2dbcds|A0A672R7P6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Sinocyclocheilus grahami GN=BAD (length=444 residues).
atggataaaagattgcatgaccatcgaaatgattccagcaccttgaatgacagaaagaaaggaagagaagagacaatcaa
tacccgtggacaacatcaggatcaaaccttgccaaacatttctcctcaaggacgtgtgcggctctattcggagtctcagg
tgtatatggtcagccgctggcaggaagctgagccccaggatggagcatcggcggaggagaacggaggaacgggagatgga
cttccattcagaggtcgttctcagtctgctcctgctgcgctgtggaaagcaaagaagtacggacggcagctgaggagaat
gagcgatgaatttgacacatggcttgacaaaggagaggtcaaaagagcgaacagtcagaaacagacctaccgaggatggt
tctcgttcctctggagttccaaagacgaggagggcagagaatga
>gnl|bcl2dbcds|A0A672RGH0_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Sinocyclocheilus grahami GN=BAD (length=459 residues).
atggcacaaatgttcagtatctcggacaatgagtcagagaccgagacatcggaagactgtgaggaatcgggccaggtgaa
aaataacagtggatcaccacagagaacgcagcatctcgctgtgcctggtaggctgaaaggagaacaactagggagacacc
ggaatctttccatgaatgatgaggacctgctggagaccggggcagcagatgaaggcgatttggttggaggtgatcctttc
aggcctagatcccgctcggctcctcctgctttgtgggcagctaagaaatatggccaacagctaaggagaatgagtgatga
gtttgacatcctccttgataaagggatgaagagggtgaagagtgcaggaacaacacgtcagatgcggcagtcccccagct
ggttggccttcctttggagtcacaaagagtctgatgctgagtcacgccccgctgagtga
>gnl|bcl2dbcds|A0A672RK14_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Sinocyclocheilus grahami GN=BMF (length=645 residues).
atggatgatgaggaggacgaacagcttcctcactgctgtgaaacaccgctaagaaacaagagctcagagaacagagacgg
gagaggtggagaggtgggacaaacagctaacagacacggacgctttgaagacagatcaacgcagactgccagctctgtgc
tgaattcagtgagaaacggagatatggcaccattccagggtttagagggagatgcatcatctccctgcagagctgtggat
gccaggactgcatttggggttaactgtggaaccgggggccttgcgtcacttactatggcccctggggcctcagaagggcc
aagagcactttttcatggaaatgctggatttcgtgcacacttccccgcactgtttgaacccctcctggatggcacacaaa
acgcagaagaggacgaagggagaccagaagaaaaggaagacgaacgtgacgtgggaattagtgtggagattcagattgga
cgtaaactgcgtgaaatgggggatcagtttcagcaggatcatcttcagctggtaagagtgatttcagatgagactagttc
tctgtggttttcattgcagtggtttctgtcacgatgtgcaatgacatcatcgtctgttatttcaatgctgcatatgcaaa
tatga
>gnl|bcl2dbcds|A0A672SAE4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Sinocyclocheilus grahami GN=BAD (length=462 residues).
atggcacaaatgttcagtatctctgacaatgagtcggacaccgagacatcggaagactgtgaggactcggacctgacaaa
aaataacagtggatcaccgcagaaaacaaaccatgatctcgctgtgcctgataggctgaaaggagaacaactagggagac
acaggaatctttcgatgaatgatgaggacctgctggagactggggctgcagatgaaggcgatttggttggaggtgatcca
ttcaggcctagatctcgctcggctcctcctgctttgtgggcagctaagaaatatggtcgacagctaaggagaatgagtga
tgagtttgacatcctccttgataaagggatgaagagggtgaagagtgcaggaacaacacgtcagatgcagcagtcaccca
gctggttcgctttcctttggagtcacaaagagtctgatgcggagtcgcgccccgcagagtga
>gnl|bcl2dbcds|A0A672SAE4_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Sinocyclocheilus grahami GN=BAD (length=462 residues).
atggcacaaatgttcagtatctctgacaatgagtcggacaccgagacatcggaagactgtgaggactcggacctgacaaa
aaataacagtggatcaccgcagaaaacaaaccatgatctcgctgtgcctgataggctgaaaggagaacaactagggagac
acaggaatctttcgatgaatgatgaggacctgctggagactggggctgcagatgaaggcgatttggttggaggtgatcca
ttcaggcctagatctcgctcggctcctcctgctttgtgggcagctaagaaatatggtcgacagctaaggagaatgagtga
tgagtttgacatcctccttgataaagggatgaagagggtgaagagtgcaggaacaacacgtcagatgcagcagtcaccca
gctggttcgctttcctttggagtcacaaagagtctgatgcggagtcgcgccccgcagagtga
© 1998-2020Legal notice