Dataset for CDS classical BH3-containing proteins of organism Sinocyclocheilus grahami

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A672L1R2_BCL2L11      atg-----------------------------------tctgacacgtc-
A0A672PQD1_BCL2L11      atg-----------------------------------tccgacacgtcc
A0A672LB88_BAD-01       atggataa-------------------------cacactgcatgaccatc
A0A672R7P6_BAD-01       atggataa-------------------------aagattgcatgaccatc
A0A672JWL9_BMF-01       atggatgaggatgagga----------------tgatgtgcgc-------
A0A672JWL9_BMF-02       atggatgaggatgagga----------------tgatgtgcgc-------
A0A672RK14_BMF-01       atggatgatgaggaggacgaacagcttcctcactgctgtgaaacaccgct
A0A672RGH0_BAD-01       atgg--------------------------cacaaatgttcagtatctcg
A0A672SAE4_BAD-01       atgg--------------------------cacaaatgttcagtatctct
A0A672SAE4_BAD-02       atgg--------------------------cacaaatgttcagtatctct
                        ***                                   *           

A0A672L1R2_BCL2L11      --cagagagcaaacgccgggccggggaagcggagagagcgccggtggcgc
A0A672PQD1_BCL2L11      agcagagagcaaacgccgggccggggaagcggagagagcgccggtggcgc
A0A672LB88_BAD-01       ----aagatgattccagcacctggaatgacaaaaagaaaggaagagaaga
A0A672R7P6_BAD-01       ----gaaatgattccagcaccttgaatgacagaaagaaaggaagagaaga
A0A672JWL9_BMF-01       ----aggaagggtctacagcactggccttcc----------------tcc
A0A672JWL9_BMF-02       ----aggaagggtctacagcactggccttcc----------------tcc
A0A672RK14_BMF-01       aagaaacaagagctcagagaacagaga---cgggagaggtggagaggtgg
A0A672RGH0_BAD-01       ----gacaatgagtcagag-accgagacatcggaagactgtgaggaatcg
A0A672SAE4_BAD-01       ----gacaatgagtcggac-accgagacatcggaagactgtgaggactcg
A0A672SAE4_BAD-02       ----gacaatgagtcggac-accgagacatcggaagactgtgaggactcg
                               *               *                          

A0A672L1R2_BCL2L11      agccgtc--------------------------ttaggctccgggcac--
A0A672PQD1_BCL2L11      agccgtc--------------------------ttaggctccgggcac--
A0A672LB88_BAD-01       gacaatc----aaaaaccaaggacaacatcaggatcaaaccttgccaaac
A0A672R7P6_BAD-01       gacaatc----aatacccgtggacaacatcaggatcaaaccttgccaaac
A0A672JWL9_BMF-01       cgcgttcagataa-------------------agcagaccgagaccgcag
A0A672JWL9_BMF-02       cgcgttcagataa-------------------agcagaccgagaccgcag
A0A672RK14_BMF-01       gacaaacagctaacagacacggacgctttgaagacagatc---aacgcag
A0A672RGH0_BAD-01       ggc---caggtgaaaaa-----------taacagtggatc---accacag
A0A672SAE4_BAD-01       gac---ctgacaaaaaa-----------taacagtggatc---accgcag
A0A672SAE4_BAD-02       gac---ctgacaaaaaa-----------taacagtggatc---accgcag
                          *   *                                      *    

A0A672L1R2_BCL2L11      --------------------------------------------------
A0A672PQD1_BCL2L11      --------------------------------------------------
A0A672LB88_BAD-01       a-------------------------------------------------
A0A672R7P6_BAD-01       a-------------------------------------------------
A0A672JWL9_BMF-01       g-------------------------------------------------
A0A672JWL9_BMF-02       g-------------------------------------------------
A0A672RK14_BMF-01       actgccagctctgtgctgaattcagtgagaaacggagatatggcaccatt
A0A672RGH0_BAD-01       a----------------------------gaacg----------------
A0A672SAE4_BAD-01       a----------------------------aaacaaa--------------
A0A672SAE4_BAD-02       a----------------------------aaacaaa--------------

A0A672L1R2_BCL2L11      ------------------tttgacttccctcagccgagcgatggggaccc
A0A672PQD1_BCL2L11      ------------------tttgacttccctcagccgagcgatggggaccc
A0A672LB88_BAD-01       -----------------------tttctcctcaagggcgtgtgcggctct
A0A672R7P6_BAD-01       -----------------------tttctcctcaaggacgtgtgcggctct
A0A672JWL9_BMF-01       --------------------gataccccc--------tctatgccccagc
A0A672JWL9_BMF-02       --------------------gataccccc--------tctatgccccagc
A0A672RK14_BMF-01       ccagggtttagagggagatgcatcatctccctgcagagctgtgga----t
A0A672RGH0_BAD-01       --------------------cagcatctc--------gctgtgcc----t
A0A672SAE4_BAD-01       -------------------ccatgatctc--------gctgtgcc----t
A0A672SAE4_BAD-02       -------------------ccatgatctc--------gctgtgcc----t
                                                  * *            **       

A0A672L1R2_BCL2L11      gttaaggggagggattgccatgtcgagtagtcaccagtcgaggtcaccga
A0A672PQD1_BCL2L11      gttaaggggagggattgccatgtcgagtagtcaccagtcgaggtcaccga
A0A672LB88_BAD-01       attc-------ggagt---ctcaggtgtatacg-----gtgagccgctgg
A0A672R7P6_BAD-01       attc-------ggagt---ctcaggtgtatatg-----gtcagccgctgg
A0A672JWL9_BMF-01       ggca-------tg-ctgccctgtcgagtgcatg-----tggag--cccag
A0A672JWL9_BMF-02       ggca-------tg-ctgccctgtcgagtgcatg-----tggag--cccag
A0A672RK14_BMF-01       gcca-------ggactgcatttggggttaactg-----tgga---accgg
A0A672RGH0_BAD-01       ggta-------gg-ctgaa-aggagaacaacta-----gggagacaccgg
A0A672SAE4_BAD-01       gata-------gg-ctgaa-aggagaacaacta-----gggagacacagg
A0A672SAE4_BAD-02       gata-------gg-ctgaa-aggagaacaacta-----gggagacacagg
                                    *  *        *                     *   

A0A672L1R2_BCL2L11      tg---tcccgaaccttctccaggtcctctagtggctatt-tttccgtcga
A0A672PQD1_BCL2L11      tg---tgccggaccttctccaggtcctctagtggctatt-tttccgtcga
A0A672LB88_BAD-01       caggaagcagagccccaggatggagcattggtgg--aggagaacggagga
A0A672R7P6_BAD-01       caggaagctgagccccaggatggagcatcggcgg--aggagaacggagga
A0A672JWL9_BMF-01       acgctttct-------------------------ctacggtaacacagga
A0A672JWL9_BMF-02       acgctttct-------------------------ctacggtaacacagga
A0A672RK14_BMF-01       gggccttgcgtcacttactatggccc--------ctggggcctcaga--a
A0A672RGH0_BAD-01       aatctttccatgaatgatgaggacctgctggagaccggggcagcagatga
A0A672SAE4_BAD-01       aatctttcgatgaatgatgaggacctgctggagactggggctgcagatga
A0A672SAE4_BAD-02       aatctttcgatgaatgatgaggacctgctggagactggggctgcagatga
                                                                   *     *

A0A672L1R2_BCL2L11      cagcga---------------------------ttctgtgccaagtt---
A0A672PQD1_BCL2L11      cagcga---------------------------ttctgtgccaggtt---
A0A672LB88_BAD-01       acggga------------gatgga--------cttccattcagaggtcgt
A0A672R7P6_BAD-01       acggga------------gatgga--------cttccattcagaggtcgt
A0A672JWL9_BMF-01       ctgc----------tgctgctag---------------------------
A0A672JWL9_BMF-02       ctgc----------tgctgctag---------------------------
A0A672RK14_BMF-01       gggccaagagcactttttcatggaaatgctggatttcgtgcacactt---
A0A672RGH0_BAD-01       aggcga--------tttggttggaggtga-----tcctttcaggcctaga
A0A672SAE4_BAD-01       aggcga--------tttggttggaggtga-----tccattcaggcctaga
A0A672SAE4_BAD-02       aggcga--------tttggttggaggtga-----tccattcaggcctaga

A0A672L1R2_BCL2L11      ccccgctaatgcccaatatttccgaagcgcaagacg----gccaaaatga
A0A672PQD1_BCL2L11      ccccgctaatgcccaatatttccgaagcgcaagacg----gcccaaatga
A0A672LB88_BAD-01       tctcagtctg------ctcctgctgctctgtggaaa----gcaaa-----
A0A672R7P6_BAD-01       tctcagtctg------ctcctgctgcgctgtggaaa----gcaaa-----
A0A672JWL9_BMF-01       cgccgcctag------ccgctctcggcctccagacg--------------
A0A672JWL9_BMF-02       cgccgcctag------ccgctctcggcctccagacg--------------
A0A672RK14_BMF-01       ccccgcactgtttgaacccctcctggatggcacacaaaacgcaga-----
A0A672RGH0_BAD-01       tcccgctcgg------ctcctcctgctttgtgggca----gctaa-----
A0A672SAE4_BAD-01       tctcgctcgg------ctcctcctgctttgtgggca----gctaa-----
A0A672SAE4_BAD-02       tctcgctcgg------ctcctcctgctttgtgggca----gctaa-----
                           *                *                             

A0A672L1R2_BCL2L11      tgaggtatggtctgccgaacctagccaccagcacgtgcagatggcagcac
A0A672PQD1_BCL2L11      tgaggtatggtttgccgaacctagccaccagcacgcacagatggcggcac
A0A672LB88_BAD-01       -gaagtacgggcgacag----------ctgaggagaatgagcgatga-at
A0A672R7P6_BAD-01       -gaagtacggacggcag----------ctgaggagaatgagcgatga-at
A0A672JWL9_BMF-01       -------tggttctccg----------gcagaacctgcgcatgatgg-at
A0A672JWL9_BMF-02       -------tggttctccg----------gcagaacctgcgcatgatgg-at
A0A672RK14_BMF-01       -agaggacgaagggaga----------ccagaagaaaaggaagacga-ac
A0A672RGH0_BAD-01       -gaaatatggccaacag----------ctaaggagaatgagtgatga-gt
A0A672SAE4_BAD-01       -gaaatatggtcgacag----------ctaaggagaatgagtgatga-gt
A0A672SAE4_BAD-02       -gaaatatggtcgacag----------ctaaggagaatgagtgatga-gt
                                *                                 *       

A0A672L1R2_BCL2L11      ctgtcggagccatggggccggagatggcggtcgctcgggagctgcggcgc
A0A672PQD1_BCL2L11      ctgtgggagccatggggccggagatggcggtcgctcgggagctgcggcgc
A0A672LB88_BAD-01       ttgacacatggctcgacaaagggg--------aggtcaaaagagcgaaca
A0A672R7P6_BAD-01       ttgacacatggcttgacaaaggag--------aggtcaaaagagcgaaca
A0A672JWL9_BMF-01       ccggcggag-----agcgtggagaccctcatcgggcagaagctccagctg
A0A672JWL9_BMF-02       ccggcggag-----agcgtggagaccctcatcgggcagaagctccagctg
A0A672RK14_BMF-01       gtgacgtgggaattagtgtggagattcagattggacgtaaactgcgtgaa
A0A672RGH0_BAD-01       ttgacatcctccttgataaagggatgaaga--gggtgaagagtgca-gga
A0A672SAE4_BAD-01       ttgacatcctccttgataaagggatgaaga--gggtgaagagtgca-gga
A0A672SAE4_BAD-02       ttgacatcctccttgataaagggatgaaga--gggtgaagagtgca-gga
                          *                 *                       *     

A0A672L1R2_BCL2L11      attggagacgagttcaaccgtctgtactgtcagggg---gccggtgcagg
A0A672PQD1_BCL2L11      attggagacgagttcaaccgcctgtactgtcagggg---gccggtgcagg
A0A672LB88_BAD-01       gccagaaa-cagac------------ctaccgagga--------------
A0A672R7P6_BAD-01       gtcagaaa-cagac------------ctaccgagga--------------
A0A672JWL9_BMF-01       atcggagatcagtt------------ctatcaggagcacatgatgcatca
A0A672JWL9_BMF-02       atcggagatcagtt------------ctatcagg-----acgctccttta
A0A672RK14_BMF-01       atgggggatcagtt------------tcagcagg-----atcatcttcag
A0A672RGH0_BAD-01       acaacacgtcagat------------gcggcag-------tcccc--cag
A0A672SAE4_BAD-01       acaacacgtcagat------------gcagcag-------tcacc--cag
A0A672SAE4_BAD-02       acaacacgtcagat------------gcagcag-------tcacc--cag
                                  **                  *                   

A0A672L1R2_BCL2L11      cgggaacaacgcggcccagctgc-------------gcgctcccaacgaa
A0A672PQD1_BCL2L11      tgggaacaacggggcccagctgc-------------acgctcccaacgaa
A0A672LB88_BAD-01       ------------------------------------tggttctcgttcct
A0A672R7P6_BAD-01       ------------------------------------tggttctcgttcct
A0A672JWL9_BMF-01       cagaaaccaaaggaaccgggag--------------ccgctgtggtggcg
A0A672JWL9_BMF-02       cacaa---aagtgttccatgtg--------------ccgtgtttgt----
A0A672RK14_BMF-01       ctggtaagagtgatttcagatgagactagttctctgtggttttcattgca
A0A672RGH0_BAD-01       ctggt-------------------------------tggccttcctt---
A0A672SAE4_BAD-01       ctggt-------------------------------tcgctttcctt---
A0A672SAE4_BAD-02       ctggt-------------------------------tcgctttcctt---

A0A672L1R2_BCL2L11      cacg---ccatcatcatgtggatgaacgaccttatcggacg----tgtag
A0A672PQD1_BCL2L11      cacg---ccatcatcatgtggatgaacgaccttatcggacg----tgtag
A0A672LB88_BAD-01       ctgg----agttccaaag-------------------------------a
A0A672R7P6_BAD-01       ctgg----agttccaaag-------------------------------a
A0A672JWL9_BMF-01       cgtg-----gccgtggcgttctacacgcttttatttggaagagagcccaa
A0A672JWL9_BMF-02       tttg-----gccggactgttt------------------------cctga
A0A672RK14_BMF-01       gtggtttctgtcacgatgtgc---aatgacatcatcgtctgttatttcaa
A0A672RGH0_BAD-01       -tgg----agtcacaaag-------------------------agtctga
A0A672SAE4_BAD-01       -tgg----agtcacaaag-------------------------agtctga
A0A672SAE4_BAD-02       -tgg----agtcacaaag-------------------------agtctga
                           *             *                                

A0A672L1R2_BCL2L11      tacagtttttcctgcgaaggagatga
A0A672PQD1_BCL2L11      tacagtttttcctgcgaagaagatga
A0A672LB88_BAD-01       agaggagg------gcagaga-atga
A0A672R7P6_BAD-01       cgaggagg------gcagaga-atga
A0A672JWL9_BMF-01       cgcaagagcaaatcgtag----gtga
A0A672JWL9_BMF-02       ctc-tggtctagttgt------ttga
A0A672RK14_BMF-01       tgctgcat------atgcaaatatga
A0A672RGH0_BAD-01       tgctgagtcacgccccgctga-gtga
A0A672SAE4_BAD-01       tgcggagtcgcgccccgcaga-gtga
A0A672SAE4_BAD-02       tgcggagtcgcgccccgcaga-gtga

© 1998-2021Legal notice