Dataset for CDS BCL2L11 of organism Rhinopithecus bieti

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A2K6KJP8_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2K6KJP8_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2L11 (length=354 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcatcctagaggatataggtgat
acttcattgtggtttggatttatatttactggcttagatttgtatgtggtttggatttatatttaccaccacagtcaaga
tacagaacaactcaaccacagggatttctcatga
© 1998-2020Legal notice