Dataset for CDS BCL2L11 of organism Rhinopithecus bieti

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6KJP8_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K6KJP8_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
                        **************************************************

A0A2K6KJP8_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2K6KJP8_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
                        **************************************************

A0A2K6KJP8_BCL2L11      cctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggt
A0A2K6KJP8_BCL2L11      cctccctacagacagaaccaca----------------------------
                        **********************                            

A0A2K6KJP8_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K6KJP8_BCL2L11      --------------------------------------------------
                                                                          

A0A2K6KJP8_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2K6KJP8_BCL2L11      --------------------------------------------------
                                                                          

A0A2K6KJP8_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K6KJP8_BCL2L11      --------------------------------------------------
                                                                          

A0A2K6KJP8_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K6KJP8_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                          ************************************************

A0A2K6KJP8_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatgg------
A0A2K6KJP8_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtca
                        ********************************************      

A0A2K6KJP8_BCL2L11      -cttccaggaggcaggctgaacctgcagatatgcgcccgga--gatacgg
A0A2K6KJP8_BCL2L11      tcctagaggatatagg-tgatacttcat-tgtg-gtttggatttatattt
                         * *  ****   *** ***  ** **  * ** *   ***   ***   

A0A2K6KJP8_BCL2L11      atcgcccaagagttgcg-gcgaatcggagacgagtttaacgcttacta-t
A0A2K6KJP8_BCL2L11      actggcttagatttgtatgtggtttgga-------tttatatttaccacc
                        *  * *  *** ***   * *  * ***       ** *   **** *  

A0A2K6KJP8_BCL2L11      gcaaggaggttagagaa-----------------------atag
A0A2K6KJP8_BCL2L11      acagtcaagatacagaacaactcaaccacagggatttctcatga
                         **   * * ** ****                       **  

© 1998-2020Legal notice