Dataset for CDS BCL2L11 of organism Rhinolophus ferrumequinum

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A671FCV3_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttccgatgcaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagagaccgcctca
gctcaggcccggggctccgacctctgtacagatagagcggcaaggtaatcctgaaggtgaaggggaccgctgcccccacg
gcagccctcagggcccgctggccccgcctgccagccccgggccttttgccaccagatccccgctcttcatctttgtgaga
agatcctccctgctgtcccgctcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
caaatcaacacaaacgccgagtcctccttgccaggccttcaaccattatctcagtgcaatggcctcccggcggcagcccc
aggccctccccgcggacctgcgcccggagatctggatcgcacaggagcttcggcggatcggggacgagttcaacgcctgt
tacccacggagggtcttcctgaataattaccgagcagcgggagcccacccgcggatggcggtcatacggctgttgcgtta
catcctccgtctgttgtggaggatgcagtga
>gnl|bcl2dbcds|A0A671FCV3_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BCL2L11 (length=396 residues).
atggcaaagcaaccttccgatgcaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagagaccgcctca
gctcaggcccggggctccgacctctgtacagatagagcggcaaggtaatcctgaaggtgaaggggaccgctgcccccacg
gcagccctcagggcccgctggccccgcctgccagccccgggccttttgccaccagatccccgctcttcatctttgtgaga
agatcctccctgctgtcccgctcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
caaatcaacacaaacgccgagtcctccttgccaggccttcaaccattatctcagtgcaatgggtcttcctgaataa
>gnl|bcl2dbcds|A0A671FCV3_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BCL2L11 (length=471 residues).
atggcaaagcaaccttccgatgcaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagagaccgcctca
gctcaggcccggggctccgacctctgtacagatagagcggcaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaacgccgagtcctccttgccaggccttcaaccattatctcagtgcaatggcctcccggcggcagccccaggccctc
cccgcggacctgcgcccggagatctggatcgcacaggagcttcggcggatcggggacgagttcaacgcctgttacccacg
gagggcccgcttcgtacttgggtcccacacagaagtgcctggaattgaagcagagaagaaaggggctcgcactgcggttc
tggctggcttgtatccacgttcgcgttttcatgtgctccgtgtgaccctgacattttttcgtgctgcctga
>gnl|bcl2dbcds|A0A671FCV3_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BCL2L11 (length=504 residues).
atggcaaagcaaccttccgatgcaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagagaccgcctca
gctcaggcccggggctccgacctctgtacagatagagcggcaaggtaatcctgaaggtgaaggggaccgctgcccccacg
gcagccctcagggcccgctggccccgcctgccagccccgggccttttgccaccagatccccgctcttcatctttgtgaga
agatcctccctgctgtcccgctcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
caaatcaacacaaacgccgagtcctccttgccaggccttcaaccattatctcagtgcaatggcctcccggcggcagcccc
aggccctccccgcggacctgcgcccggagatctggatcgcacaggagcttcggcggatcggggacgagttcaacgcctgt
tacccacggaggttcgggcagtag
© 1998-2020Legal notice