Dataset for CDS BCL2L11 of organism Rhinolophus ferrumequinum

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A671FCV3_BCL2L11      atggcaaagcaaccttccgatgcaagttctgagtgtgacagagaaggtgg
A0A671FCV3_BCL2L11      atggcaaagcaaccttccgatgcaagttctgagtgtgacagagaaggtgg
A0A671FCV3_BCL2L11      atggcaaagcaaccttccgatgcaagttctgagtgtgacagagaaggtgg
A0A671FCV3_BCL2L11      atggcaaagcaaccttccgatgcaagttctgagtgtgacagagaaggtgg
                        **************************************************

A0A671FCV3_BCL2L11      acaattgcagcctgctgagagaccgcctcagctcaggcccggggctccga
A0A671FCV3_BCL2L11      acaattgcagcctgctgagagaccgcctcagctcaggcccggggctccga
A0A671FCV3_BCL2L11      acaattgcagcctgctgagagaccgcctcagctcaggcccggggctccga
A0A671FCV3_BCL2L11      acaattgcagcctgctgagagaccgcctcagctcaggcccggggctccga
                        **************************************************

A0A671FCV3_BCL2L11      cctctgtacagatagagcggca----------------------------
A0A671FCV3_BCL2L11      cctctgtacagatagagcggcaaggtaatcctgaaggtgaaggggaccgc
A0A671FCV3_BCL2L11      cctctgtacagatagagcggcaaggtaatcctgaaggtgaaggggaccgc
A0A671FCV3_BCL2L11      cctctgtacagatagagcggcaaggtaatcctgaaggtgaaggggaccgc
                        **********************                            

A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      tgcccccacggcagccctcagggcccgctggccccgcctgccagccccgg
A0A671FCV3_BCL2L11      tgcccccacggcagccctcagggcccgctggccccgcctgccagccccgg
A0A671FCV3_BCL2L11      tgcccccacggcagccctcagggcccgctggccccgcctgccagccccgg
                                                                          

A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      gccttttgccaccagatccccgctcttcatctttgtgagaagatcctccc
A0A671FCV3_BCL2L11      gccttttgccaccagatccccgctcttcatctttgtgagaagatcctccc
A0A671FCV3_BCL2L11      gccttttgccaccagatccccgctcttcatctttgtgagaagatcctccc
                                                                          

A0A671FCV3_BCL2L11      ----------------------------------------agacaggagc
A0A671FCV3_BCL2L11      tgctgtcccgctcctccagtgggtatttctcttttgacacagacaggagc
A0A671FCV3_BCL2L11      tgctgtcccgctcctccagtgggtatttctcttttgacacagacaggagc
A0A671FCV3_BCL2L11      tgctgtcccgctcctccagtgggtatttctcttttgacacagacaggagc
                                                                **********

A0A671FCV3_BCL2L11      ccagcacccatgagttgtgacaaatcaacacaaacgccgagtcctccttg
A0A671FCV3_BCL2L11      ccagcacccatgagttgtgacaaatcaacacaaacgccgagtcctccttg
A0A671FCV3_BCL2L11      ccagcacccatgagttgtgacaaatcaacacaaacgccgagtcctccttg
A0A671FCV3_BCL2L11      ccagcacccatgagttgtgacaaatcaacacaaacgccgagtcctccttg
                        **************************************************

A0A671FCV3_BCL2L11      ccaggccttcaaccattatctcagtgcaatggcctcccggcggcagcccc
A0A671FCV3_BCL2L11      ccaggccttcaaccattatctcagtgcaatggcctcccggcggcagcccc
A0A671FCV3_BCL2L11      ccaggccttcaaccattatctcagtgcaatggcctcccggcggcagcccc
A0A671FCV3_BCL2L11      ccaggccttcaaccattatctcagtgcaat--------------------
                        ******************************                    

A0A671FCV3_BCL2L11      aggccctccccgcggacctgcgcccggagatctggatcgcacaggagctt
A0A671FCV3_BCL2L11      aggccctccccgcggacctgcgcccggagatctggatcgcacaggagctt
A0A671FCV3_BCL2L11      aggccctccccgcggacctgcgcccggagatctggatcgcacaggagctt
A0A671FCV3_BCL2L11      --------------------------------------------------
                                                                          

A0A671FCV3_BCL2L11      cggcggatcggggacgagttcaacgcctgttacccacggagggcccgctt
A0A671FCV3_BCL2L11      cggcggatcggggacgagttcaacgcctgttacccacggaggttc-----
A0A671FCV3_BCL2L11      cggcggatcggggacgagttcaacgcctgttacccacggagggtcttcct
A0A671FCV3_BCL2L11      ----------------------------------------gggtcttcct
                                                                **  *     

A0A671FCV3_BCL2L11      cgtacttgggtcccacacagaagtgcctggaattgaagcagagaagaaag
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      ------------------------------gaataattaccgagcagcgg
A0A671FCV3_BCL2L11      ------------------------------gaataa--------------
                                                                          

A0A671FCV3_BCL2L11      gggctcgcactgcggttctggctggcttgtatccacgttcgcgttttcat
A0A671FCV3_BCL2L11      --------------------------------------------------
A0A671FCV3_BCL2L11      gagcccacccgcggatggcggtcatacggctgttgcgttacatcctccgt
A0A671FCV3_BCL2L11      --------------------------------------------------
                                                                          

A0A671FCV3_BCL2L11      gtgctccgtgtgaccctgacattttttcgtgctgcctga
A0A671FCV3_BCL2L11      ------------gggcag------------------tag
A0A671FCV3_BCL2L11      ctgttgtggaggatgcag------------------tga
A0A671FCV3_BCL2L11      ---------------------------------------
                                                               

© 1998-2020Legal notice