Dataset for CDS BBC3 of organism Rhinolophus ferrumequinum

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A671F3X5_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BBC3 (length=780 residues).
agagtcagtgcaggggctgcccgggcatgtccatgccaggtgccgaggcttccttctggttgggtcccccatcagatttg
tggccccagggagcgccatggcccgagcactccaggagggcagctccccggagcccgtagagggcctggcccgcgacggc
ccgcgccccttcccactcagccgcctggtgccctcggctgtgtcctgcggcctctgcgagccaggcctgcccgctgcccc
cgccgcccctgccctgctgccagctgcctacctctgcgcccccacagccccgcccaccgtcacctccaccctggggggcc
cccgctggcctgggggtccccgcagccggccccgaggcccgcgccccgacggtcctcagccctcactctcacccgcggag
cagcacctggaatcgccggtgcccagcgccccgggtgccctggcgggcggccccacccacgcagccccgggagtccgggg
ggaggaggagcagtgggcccgagagatcggggcccagctgcggcgaatggcggacgacctcgacgcactgtacgagcggc
ggagacaagaggagcagcagcgacaccgcccctcgccctggagggtcctgtacaacctgatcatgggactgctgccctta
cccaggggccgtggagcccccgagatggagcccaattaggtgcctgcacccgcacggtggacgtcagggacttggggggc
aggaccctcccacctcctgacgccctggccagcgcgggggacattttctgcaccatgtag
>gnl|bcl2dbcds|A0A671F3X5_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BBC3 (length=390 residues).
agagtcagtgcaggggctgcccgggcatgtccatgccaggtgccgaggcttccttctggttgggtcccccatcagatttg
tggtcctcagccctcactctcacccgcggagcagcacctggaatcgccggtgcccagcgccccgggtgccctggcgggcg
gccccacccacgcagccccgggagtccggggggaggaggagcagtgggcccgagagatcggggcccagctgcggcgaatg
gcggacgacctcgacgcactgtacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctggagggtcct
gtacaacctgatcatgggactgctgcccttacccaggggccgtggagcccccgagatggagcccaattag
>gnl|bcl2dbcds|A0A671F3X5_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BBC3 (length=300 residues).
agagtcagtgcaggggctgcccgggcatgtccatgccaggtgccgaggcttccttctggttgggtcccccatcagatttg
tgagacaagaggagcagcagcgacaccgcccctcgccctggagggtcctgtacaacctgatcatgggactgctgccctta
cccaggggccgtggagcccccgagatggagcccaattaggtgcctgcacccgcacggtggacgtcagggacttggggggc
aggaccctcccacctcctgacgccctggccagcgcgggggacattttctgcaccatgtag
© 1998-2020Legal notice