Dataset for CDS BBC3 of organism Rhinolophus ferrumequinum

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A671F3X5_BBC3-03      agagtcagtgcaggggctgcccgggcatgtccatgccaggtgccgaggct
A0A671F3X5_BBC3-01      agagtcagtgcaggggctgcccgggcatgtccatgccaggtgccgaggct
A0A671F3X5_BBC3-02      agagtcagtgcaggggctgcccgggcatgtccatgccaggtgccgaggct
                        **************************************************

A0A671F3X5_BBC3-03      tccttctggttgggtcccccatcagatttgt-------------------
A0A671F3X5_BBC3-01      tccttctggttgggtcccccatcagatttgtggccccagggagcgccatg
A0A671F3X5_BBC3-02      tccttctggttgggtcccccatcagatttgt-------------------
                        *******************************                   

A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      gcccgagcactccaggagggcagctccccggagcccgtagagggcctggc
A0A671F3X5_BBC3-02      --------------------------------------------------
                                                                          

A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      ccgcgacggcccgcgccccttcccactcagccgcctggtgccctcggctg
A0A671F3X5_BBC3-02      --------------------------------------------------
                                                                          

A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      tgtcctgcggcctctgcgagccaggcctgcccgctgcccccgccgcccct
A0A671F3X5_BBC3-02      --------------------------------------------------
                                                                          

A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      gccctgctgccagctgcctacctctgcgcccccacagccccgcccaccgt
A0A671F3X5_BBC3-02      --------------------------------------------------
                                                                          

A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      cacctccaccctggggggcccccgctggcctgggggtccccgcagccggc
A0A671F3X5_BBC3-02      --------------------------------------------------
                                                                          

A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      cccgaggcccgcgccccgacggtcctcagccctcactctcacccgcggag
A0A671F3X5_BBC3-02      --------------------ggtcctcagccctcactctcacccgcggag
                                                                          

A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      cagcacctggaatcgccggtgcccagcgccccgggtgccctggcgggcgg
A0A671F3X5_BBC3-02      cagcacctggaatcgccggtgcccagcgccccgggtgccctggcgggcgg
                                                                          

A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      ccccacccacgcagccccgggagtccggggggaggaggagcagtgggccc
A0A671F3X5_BBC3-02      ccccacccacgcagccccgggagtccggggggaggaggagcagtgggccc
                                                                          

A0A671F3X5_BBC3-03      --------------------------------------------------
A0A671F3X5_BBC3-01      gagagatcggggcccagctgcggcgaatggcggacgacctcgacgcactg
A0A671F3X5_BBC3-02      gagagatcggggcccagctgcggcgaatggcggacgacctcgacgcactg
                                                                          

A0A671F3X5_BBC3-03      -----------gagacaagaggagcagcagcgacaccgcccctcgccctg
A0A671F3X5_BBC3-01      tacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctg
A0A671F3X5_BBC3-02      tacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctg
                                   ***************************************

A0A671F3X5_BBC3-03      gagggtcctgtacaacctgatcatgggactgctgcccttacccaggggcc
A0A671F3X5_BBC3-01      gagggtcctgtacaacctgatcatgggactgctgcccttacccaggggcc
A0A671F3X5_BBC3-02      gagggtcctgtacaacctgatcatgggactgctgcccttacccaggggcc
                        **************************************************

A0A671F3X5_BBC3-03      gtggagcccccgagatggagcccaattaggtgcctgcacccgcacggtgg
A0A671F3X5_BBC3-01      gtggagcccccgagatggagcccaattaggtgcctgcacccgcacggtgg
A0A671F3X5_BBC3-02      gtggagcccccgagatggagcccaattag---------------------
                        *****************************                     

A0A671F3X5_BBC3-03      acgtcagggacttggggggcaggaccctcccacctcctgacgccctggcc
A0A671F3X5_BBC3-01      acgtcagggacttggggggcaggaccctcccacctcctgacgccctggcc
A0A671F3X5_BBC3-02      --------------------------------------------------
                                                                          

A0A671F3X5_BBC3-03      agcgcgggggacattttctgcaccatgtag
A0A671F3X5_BBC3-01      agcgcgggggacattttctgcaccatgtag
A0A671F3X5_BBC3-02      ------------------------------
                                                      

© 1998-2020Legal notice