Dataset for CDS BAD of organism Rattus norvegicus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q6P7C5_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Rattus norvegicus GN=BAD (length=345 residues).
atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtccgatcccggaatccggagcct
ggggagcgacgcgggaggaaggcggtggagaccagcagcccagagtatgttccagatcccagagtttgagccgagtgagc
aggaagacgctagtactacagataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
ctcctggggagcatcgttcagcagcagccgggacaggcagccaataacagtcatcatggaggtaggttcctcacttccat
cattttcctgtcccatgtcccctga
© 1998-2022Legal notice