Dataset for CDS BAD of organism Rattus norvegicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

O35147_BAD-01      atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtcc
Q6P7C5_BAD-01      atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtcc

O35147_BAD-01      gatcccggaatccggagcctggggagcgacgcgggaggaaggcggtggagaccagcagcc
Q6P7C5_BAD-01      gatcccggaatccggagcctggggagcgacgcgggaggaaggcggtggagaccagcagcc

O35147_BAD-01      cagagtatgttccagatcccagagtttgagccgagtgagcaggaagacgctagtactaca
Q6P7C5_BAD-01      cagagtatgttccagatcccagagtttgagccgagtgagcaggaagacgctagtactaca

O35147_BAD-01      gataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
Q6P7C5_BAD-01      gataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt

O35147_BAD-01      ctcctggggagcatcgttcagcagcagccgggacaggcagccaataacagtcatcatgga
Q6P7C5_BAD-01      ctcctggggagcatcgttcagcagcagccgggacaggcagccaataacagtcatcatgga

O35147_BAD-01      ggcgctgggactatggagacccggagtcgccacagttcgtacccagcggggactgaggaa
Q6P7C5_BAD-01      ggt---------------------------------------------------------

O35147_BAD-01      gatgaagggatggaggaggagcttagcccttttcgaggacgctcgcgctcggctcccccc
Q6P7C5_BAD-01      ------------------------------------------------------------

O35147_BAD-01      aatctctgggcagcgcagcgctatggccgtgagctccgaagaatgagcgatgaatttgag
Q6P7C5_BAD-01      -----------------------------------------------------------a

O35147_BAD-01      ggttccttcaagggacttcctcgcccaaagagcgcaggcactgcaacacagatgcgacaa
Q6P7C5_BAD-01      ggttcctc------acttccat--------------------------------------
                   *******       ******                                        

O35147_BAD-01      agcgccagttggacgcgcattatccagtcctggtgggatcgaaatttggggaaaggaggc
Q6P7C5_BAD-01      -----------------cattttcctgtc-------------------------------
                                    **** *** ***                               

O35147_BAD-01      tccactccctcccagtga
Q6P7C5_BAD-01      -ccatgtcccc----tga
                    ***   ** *    ***

© 1998-2022Legal notice