Dataset for CDS BAD of organism Rattus norvegicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


O35147_BAD-01      atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtcc
Q6P7C5_BAD-01      atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtcc
                   ************************************************************

O35147_BAD-01      gatcccggaatccggagcctgggggagcgacgcgggaggaa-gcggtggagaccagcagc
Q6P7C5_BAD-01      gatcccggaatccggagcct-ggggagcgacgcgggaggaaggcggtggagaccagcagc
                   ******************** ******************** ******************

O35147_BAD-01      ccagagtatgttccagatcccagagtttgagccgagtgagcaggaagacgctagtactac
Q6P7C5_BAD-01      ccagagtatgttccagatcccagagtttgagccgagtgagcaggaagacgctagtactac
                   ************************************************************

O35147_BAD-01      agataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccagg
Q6P7C5_BAD-01      agataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccagg
                   ************************************************************

O35147_BAD-01      tctcctggggagcatcgttcagcagcagccgggacaggcagccaataacagtcatcatgg
Q6P7C5_BAD-01      tctcctggggagcatcgttcagcagcagccgggacaggcagccaataacagtcatcatgg
                   ************************************************************

O35147_BAD-01      aggcgctgggactatggagacccggagtcgccacagttcgtacccagcggggactgagga
Q6P7C5_BAD-01      aggt--------------------------------------------------------
                   ***                                                         

O35147_BAD-01      agatgaagggatggaggaggagcttagcccttttcgaggacgctcgcgctcggctccccc
Q6P7C5_BAD-01      ------------------------------------------------------------
                                                                               

O35147_BAD-01      caatctctgggcagcgcagcgctatggccgtgagctccgaaggatgagcgatgaatttga
Q6P7C5_BAD-01      ------------------------------------------------------------
                                                                               

O35147_BAD-01      gggttccttcaagggacttcctcgcccaaagagcgcaggcactgcaacacagatgcgaca
Q6P7C5_BAD-01      aggttcctc------acttccat-------------------------------------
                    *******       ******                                       

O35147_BAD-01      aagcgccagttggacgcgcattatccagtcctggtgggatcgaaatttggggaaaggagg
Q6P7C5_BAD-01      ------------------cattttcctgtc------------------------------
                                     **** *** ***                              

O35147_BAD-01      ctccaccccctcccagtga
Q6P7C5_BAD-01      --ccatgtcccc----tga
                     ***   ** *    ***

© 1998-2022Legal notice