Dataset for CDS PMAIP1 of organism Prolemur simus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C8ZIH1_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Prolemur simus GN=PMAIP1 (length=165 residues).
atgcccgtgaagagggcgcgtaggaacgcgcaaccgaacccgacgcggcctcggacagagatccaagaggagtgtgccct
tcaactcaggagaattggagacaaactgcgtttccagcagaaacttctgaatctgatagccaaacttctccgctcaggaa
cctga
>gnl|bcl2dbcds|A0A8C9AR60_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Prolemur simus GN=PMAIP1 (length=186 residues).
atgggcgtattaattcttgctgcttactctggctggaatattgtgaatgttaattttcatgttttgctttctttctcaga
gatccaagaggagtgtgcccttcaactcaggagaattggagacaaactgcatttccagcagaaacttctgaatctgatag
ccaaacttctccgctcaggaacctga
>gnl|bcl2dbcds|A0A8C9DED2_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Prolemur simus GN=PMAIP1 (length=165 residues).
atgcccatgaagagggcgcgtaggaacgcgcaaccgaacccgatgcggcctcggacagagatccaagaggagtgtgccct
tcaactcaggagaattggagacaaactgcatttccagcagaaacttctgaatctgatagccaaacttctccgctcaggaa
cctga
© 1998-2022Legal notice