Dataset for CDS PMAIP1 of organism Prolemur simus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9AR60_PMAIP1-      at-----------gggcgtattaattcttgctgcttactctggctggaat
A0A8C8ZIH1_PMAIP1-      atgcccgtgaagagggcgcgtaggaacgcgcaaccgaacccgac------
A0A8C9DED2_PMAIP1-      atgcccatgaagagggcgcgtaggaacgcgcaaccgaacccgat------
                        **           *****  *     *  **  *  *  * *        

A0A8C9AR60_PMAIP1-      attgtgaatgttaattttcatgttttgctttctttctcagagatccaaga
A0A8C8ZIH1_PMAIP1-      --------------------------gcggcctcggacagagatccaaga
A0A8C9DED2_PMAIP1-      --------------------------gcggcctcggacagagatccaaga
                                                  **   **    *************

A0A8C9AR60_PMAIP1-      ggagtgtgcccttcaactcaggagaattggagacaaactgcatttccagc
A0A8C8ZIH1_PMAIP1-      ggagtgtgcccttcaactcaggagaattggagacaaactgcgtttccagc
A0A8C9DED2_PMAIP1-      ggagtgtgcccttcaactcaggagaattggagacaaactgcatttccagc
                        ***************************************** ********

A0A8C9AR60_PMAIP1-      agaaacttctgaatctgatagccaaacttctccgctcaggaacctga
A0A8C8ZIH1_PMAIP1-      agaaacttctgaatctgatagccaaacttctccgctcaggaacctga
A0A8C9DED2_PMAIP1-      agaaacttctgaatctgatagccaaacttctccgctcaggaacctga
                        ***********************************************

© 1998-2022Legal notice