Dataset for CDS classical BH3-containing proteins of organism Prolemur simus

[Download (right click)] [Alignment] [Repertoires]

13 sequence(s)

>gnl|bcl2dbcds|A0A8C8YJE2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Prolemur simus GN=BAD (length=504 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctacagataggggcctgggccccagtccctc
aggggaccggcccccaggccccggcaagcatccctgctcggctccaagcttcctgcgggacgccagtcaccagcaggggc
agcccagcagcagcagccaccatggaggagctgggtctgtggagacccggagtcgccacagctcgtaccccgcgggatca
gaggaggatgaaggcatggaggaggagcccagccgctttcggggccgctcacgctcggcgccccccaacctctgggctgc
acagcgctatggccgcgagctccggaggatgagcgacgagttcgaggactccttcaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatacggcagagttccagctggacacgcgtcattcagtcctggtgggatcggaacgtgggcagg
ggaggctctgccccctcccagtga
>gnl|bcl2dbcds|A0A8C8ZAV1_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Prolemur simus GN=BMF (length=555 residues).
atggagccatcccagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggggagtcggggacccagcccgg
gagcgtgctttctgctgacctgtttgcccagagccagctggactgccccctcagccggcttcagctcttccctctcaccc
actgctgtggccctgggcttcgccccaccagccaggaagacaaggccacccagaccctcagcccagcctccccgagccag
ggtgtcatgctgccttgtggggtgaccgaggaaccccagagactcttttatggcaatgctggctaccggcttcctctccc
tgccagtttccctgcaggcttgccccttggggaacagcctgctgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagcgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccaaaatcgcgtgtgg
tggcagatcctcctcttcctacacaaccttgctttgaacggagaagagaacaggaacggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A8C8ZIH1_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Prolemur simus GN=PMAIP1 (length=165 residues).
atgcccgtgaagagggcgcgtaggaacgcgcaaccgaacccgacgcggcctcggacagagatccaagaggagtgtgccct
tcaactcaggagaattggagacaaactgcgtttccagcagaaacttctgaatctgatagccaaacttctccgctcaggaa
cctga
>gnl|bcl2dbcds|A0A8C8ZKT5_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Prolemur simus GN=BIK (length=447 residues).
atgtctgaggtgagacccatctccacggacctcttcatggagaccttcccgttcaggcatctcctggaccctctgatcct
ggaggttgtcagtgtcatggatgccgaggaccccgaccccttggggtgcctcgagggcagtgaccaggtggccctgcggc
tagcctacattggtgatgcgatgaacctgcgtgtcagcagcccccgcctggcccgactgcccaggatgaccatgcgcaga
ctggggctgtcctgtgaccagccggtccgctggggcgtgcttgggagccttagcgacggtttcaccaacctcagggagaa
cgtggccaggctctggaggtcactcagccccaggccctcggtgtgccccgtcccggcgtgggagcaggtgctggtgctgc
tgctggtgctgctgctgggcaggggcctgcacctgctgctcaagtga
>gnl|bcl2dbcds|A0A8C8ZU60_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Prolemur simus GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtggacggttgcaacctgtggagagaccgcccca
gctcaggcctggggcccctacctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggcgaaggggacc
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctctctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatcgcgcaggagttgcggcgtattggagatgag
tttaacgcttattacccaaggagggtatttttgaataattaccaagaggctgaagacctccctcaaatggttatcttacg
actgttacgttaccttgtccgcctggtgtgggggaggcattga
>gnl|bcl2dbcds|A0A8C8ZU60_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Prolemur simus GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtggacggttgcaacctgtggagagaccgcccca
gctcaggcctggggcccctacctccctacagacagagccccaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcaatttcaggctgaa
cctgcagatatgcgcccggagatatggatcgcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaag
gagggtatttttgaataattaccaagaggctgaagacctccctcaaatggttatcttacgactgttacgttaccttgtcc
gcctggtgtgggggaggcattga
>gnl|bcl2dbcds|A0A8C8ZU60_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Prolemur simus GN=BCL2L11 (length=516 residues).
atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtggacggttgcaacctgtggagagaccgcccca
gctcaggcctggggcccctacctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggcgaaggggacc
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctctctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatcgcgcaggagttgcggcgtattggagatgag
tttaacgcttattacccaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A8C8ZU60_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Prolemur simus GN=BCL2L11 (length=264 residues).
atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtggacggttgcaacctgtggagagaccgcccca
gctcaggcctggggcccctacctccctacagacagagccccaagcttccatgaggcaatttcaggctgaacctgcagata
tgcgcccggagatatggatcgcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaaggaggctggca
aaacccctggtaccccccatatga
>gnl|bcl2dbcds|A0A8C9AIW5_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Prolemur simus GN=BBC3 (length=393 residues).
atgaaatttggtgcggggtctgcccgggcatgtccacacgtgcccggggcttccttctcgcgatgggtcccgggccatat
tcgtggtcctcagccatcactctcactggcagagcagcacctggagtcgcccgtccccagcgccccgggggccctggcgg
gcggtcccacccaggcggccccgggagtccggggggaggaggagcagtgggcccgagagatcggggcccagctgcggcgg
atggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagcagagacaccgcccctcgccctggagggt
cctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccctgagatggagcccaattag
>gnl|bcl2dbcds|A0A8C9AIW5_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Prolemur simus GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctgcccgctgcccccgccgcccccgccctgc
tacccgctgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccggccccgaggcccacgcccggacggtcctcagccatcactctcactggcagagcagcacctggagtcgcc
cgtccccagcgccccgggggccctggcgggcggtcccacccaggcggccccgggagtccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcag
cagagacaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagc
ccctgagatggagcccaattag
>gnl|bcl2dbcds|A0A8C9AQA8_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Prolemur simus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcctgggtctgcgcgc
gtccgccgcgcagctcacggccgcccggctcaaggcgctcggcgacgagctgcacgagcgcaccatgcggcggcgccgcg
cgcggagccggagggcgccagcgccccgcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A8C9AR60_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Prolemur simus GN=PMAIP1 (length=186 residues).
atgggcgtattaattcttgctgcttactctggctggaatattgtgaatgttaattttcatgttttgctttctttctcaga
gatccaagaggagtgtgcccttcaactcaggagaattggagacaaactgcatttccagcagaaacttctgaatctgatag
ccaaacttctccgctcaggaacctga
>gnl|bcl2dbcds|A0A8C9DED2_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Prolemur simus GN=PMAIP1 (length=165 residues).
atgcccatgaagagggcgcgtaggaacgcgcaaccgaacccgatgcggcctcggacagagatccaagaggagtgtgccct
tcaactcaggagaattggagacaaactgcatttccagcagaaacttctgaatctgatagccaaacttctccgctcaggaa
cctga
© 1998-2022Legal notice