Dataset for CDS classical BH3-containing proteins of organism Prolemur simus

[Download (right click)] [Edit] [Sequences] [Repertoires]

13 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9AR60_PMAIP1-      at------------------------------------------------
A0A8C8ZIH1_PMAIP1-      atgcccgtgaa---------------------------------------
A0A8C9DED2_PMAIP1-      atgcccatgaa---------------------------------------
A0A8C8ZU60_BCL2L11      atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtgg
A0A8C8ZU60_BCL2L11      atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtgg
A0A8C8ZU60_BCL2L11      atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtgg
A0A8C8ZU60_BCL2L11      atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtgg
A0A8C8ZKT5_BIK-01       atgtc----------tgaggt-------------------gagacccatc
A0A8C8ZAV1_BMF-01       atgga----------gccatcccagtgtgtggaggagctggaggatgatg
A0A8C8YJE2_BAD-01       atgtt----------ccagatcccagagtttgagccgagtgagcaggaag
A0A8C9AQA8_HRK-01       atgt----------------------------------------------
A0A8C9AIW5_BBC3-01      atga----------------------------------------------
A0A8C9AIW5_BBC3-02      atggc----------ccgcgcacgccaggagggcagctccccggagcccg
                        **                                                

A0A8C9AR60_PMAIP1-      --------------------------------------------------
A0A8C8ZIH1_PMAIP1-      --------------------------------------------------
A0A8C9DED2_PMAIP1-      --------------------------------------------------
A0A8C8ZU60_BCL2L11      acggttgcaacctgtggagagaccgccccagctcaggcctggggccccta
A0A8C8ZU60_BCL2L11      acggttgcaacctgtggagagaccgccccagctcaggcctggggccccta
A0A8C8ZU60_BCL2L11      acggttgcaacctgtggagagaccgccccagctcaggcctggggccccta
A0A8C8ZU60_BCL2L11      acggttgcaacctgtggagagaccgccccagctcaggcctggggccccta
A0A8C8ZKT5_BIK-01       tccacggacctcttcatggagaccttccc-------gttcaggcatctcc
A0A8C8ZAV1_BMF-01       tgttccaaccagaggatgggga--------------gtcggggacccagc
A0A8C8YJE2_BAD-01       actccagctctacagataggg---------------gcctgggcccc---
A0A8C9AQA8_HRK-01       ------------------------------------gcccgtgccccc--
A0A8C9AIW5_BBC3-01      --------------------------------------------------
A0A8C9AIW5_BBC3-02      tagagggcctggcccgcgacg---------------gcccgcgccccttc
                                                                          

A0A8C9AR60_PMAIP1-      --------------------------------------------------
A0A8C8ZIH1_PMAIP1-      --------------------------------------------------
A0A8C9DED2_PMAIP1-      --------------------------------------------------
A0A8C8ZU60_BCL2L11      cctccctacagacagagccccaa---------------------------
A0A8C8ZU60_BCL2L11      cctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggc
A0A8C8ZU60_BCL2L11      cctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggc
A0A8C8ZU60_BCL2L11      cctccctacagacagagcccca----------------------------
A0A8C8ZKT5_BIK-01       tggaccctctgatcctggaggttgtcagtgtcatggatgccgaggacccc
A0A8C8ZAV1_BMF-01       ccgggagcgtgctttctgctgacctgtttgcccagagccagctggactgc
A0A8C8YJE2_BAD-01       --------------------------agtccctcaggggaccggccccca
A0A8C9AQA8_HRK-01       ----------------------------tgcaccgcggccgcggcccccc
A0A8C9AIW5_BBC3-01      --------------------------aatttggtgcggggtctgc---cc
A0A8C9AIW5_BBC3-02      ccgctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcc
                                                                          

A0A8C9AR60_PMAIP1-      --------------------------------------------------
A0A8C8ZIH1_PMAIP1-      --------------------------------------------------
A0A8C9DED2_PMAIP1-      --------------------------------------------------
A0A8C8ZU60_BCL2L11      --------------------------------------------------
A0A8C8ZU60_BCL2L11      gaaggggaccgctgcccccacggcagccctcagggcccgctggccccacc
A0A8C8ZU60_BCL2L11      gaaggggaccgctgcccccacggcagccctcagggcccgctggccccacc
A0A8C8ZU60_BCL2L11      --------------------------------------------------
A0A8C8ZKT5_BIK-01       gaccccttggggtgcctcgagggcagtgaccag-------gtggccctgc
A0A8C8ZAV1_BMF-01       cccctcagccggcttcagctcttccctctcacccactgctgtggccctgg
A0A8C8YJE2_BAD-01       ggccccggcaagcatccctgc--tcggctccaagcttcctgcgggacgcc
A0A8C9AQA8_HRK-01       ggccgtg-------------------------------------------
A0A8C9AIW5_BBC3-01      gggcatgtccac--------------------------------------
A0A8C9AIW5_BBC3-02      cggcctgcccgctgcccccgccgcccccgccctgctacccgctgcctacc
                                                                          

A0A8C9AR60_PMAIP1-      --------------------------------------------------
A0A8C8ZIH1_PMAIP1-      --------------------------------------------------
A0A8C9DED2_PMAIP1-      --------------------------------------------------
A0A8C8ZU60_BCL2L11      --------------------------------------------------
A0A8C8ZU60_BCL2L11      ggccagccctggcccttttgctacc-------------------------
A0A8C8ZU60_BCL2L11      ggccagccctggcccttttgctacc-------------------------
A0A8C8ZU60_BCL2L11      --------------------------------------------------
A0A8C8ZKT5_BIK-01       ggctagcctacatt------------------------------------
A0A8C8ZAV1_BMF-01       gcttcgccc----------------------caccagccaggaagac---
A0A8C8YJE2_BAD-01       agt-caccagcaggggcagcccagcagcagcagccaccatggaggagct-
A0A8C9AQA8_HRK-01       --tgcgcctgcagcgc--------------------------gggtcgcc
A0A8C9AIW5_BBC3-01      -acgtgccc---------------------------------ggggcttc
A0A8C9AIW5_BBC3-02      tctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccc
                                                                          

A0A8C9AR60_PMAIP1-      -------------gggcgtattaattct----------------------
A0A8C8ZIH1_PMAIP1-      -----------gagggcgcgtaggaacg----------------------
A0A8C9DED2_PMAIP1-      -----------gagggcgcgtaggaacg----------------------
A0A8C8ZU60_BCL2L11      --------------------------------------------------
A0A8C8ZU60_BCL2L11      -----------agatccccgcttttcatctttgtgagaagatcctctctg
A0A8C8ZU60_BCL2L11      -----------agatccccgcttttcatctttgtgagaagatcctctctg
A0A8C8ZU60_BCL2L11      --------------------------------------------------
A0A8C8ZKT5_BIK-01       -----------ggtgatgcgatgaacctgcgtgtcagcagcccccgcctg
A0A8C8ZAV1_BMF-01       -----------aaggccacccagaccct---------cagcccagcctcc
A0A8C8YJE2_BAD-01       -----------gggtctgtggagacccggagtcgccacagctcgtacccc
A0A8C9AQA8_HRK-01       t----------gggtctgcgcgcgtccg----ccgcgcagctcacggccg
A0A8C9AIW5_BBC3-01      c-------------ttctcgcg-atggg----tcccggg--ccatattcg
A0A8C9AIW5_BBC3-02      cgctggcctgggggtccccgca-gccgg----ccccgaggcccacgcccg
                                                                          

A0A8C9AR60_PMAIP1-      ---------------------------------------------tgctg
A0A8C8ZIH1_PMAIP1-      ---------------------------------------------cgcaa
A0A8C9DED2_PMAIP1-      ---------------------------------------------cgcaa
A0A8C8ZU60_BCL2L11      --------------------------------------------------
A0A8C8ZU60_BCL2L11      ctgtctcgatc---ctccagtgggtatttctcttttgacacagacaggag
A0A8C8ZU60_BCL2L11      ctgtctcgatc---ctccagtgggtatttctcttttgacacagacaggag
A0A8C8ZU60_BCL2L11      -----------------------------------------agacaggag
A0A8C8ZKT5_BIK-01       gcccg---------actgcccaggatgaccat--gcgcagactggggctg
A0A8C8ZAV1_BMF-01       ccgag---------ccagggtgtcatgct-------gccttgtggggtga
A0A8C8YJE2_BAD-01       gcggg---------atcag-----aggaggatgaaggcatggaggaggag
A0A8C9AQA8_HRK-01       cccggctcaaggcgctcggcgacgagctgcacgagcgcaccatgcggcgg
A0A8C9AIW5_BBC3-01      --tggtc-------ctcagccatcactctcac------------tggcag
A0A8C9AIW5_BBC3-02      gacggtc-------ctcagccatcactctcac------------tggcag
                                                                          

A0A8C9AR60_PMAIP1-      cttactctggctggaatattgtgaatgttaattttcatgttttgctttct
A0A8C8ZIH1_PMAIP1-      ccgaacccgac--------------------------------gcggcct
A0A8C9DED2_PMAIP1-      ccgaacccgat--------------------------------gcggcct
A0A8C8ZU60_BCL2L11      --------------------------------------------------
A0A8C8ZU60_BCL2L11      cccagcacccat--gagttgtgacaaatcaacacaaaccccaagtcctcc
A0A8C8ZU60_BCL2L11      cccagcacccat--gagttgtgacaaatcaacacaaaccccaagtcctcc
A0A8C8ZU60_BCL2L11      cccagcacccat--gagttgtgacaaatcaacacaaaccccaagtcctcc
A0A8C8ZKT5_BIK-01       tcctgtgaccagccggtc-------------cgctgg-----ggcgtgct
A0A8C8ZAV1_BMF-01       ccgaggaaccccagagactcttttatggcaatgctggctaccggcttcct
A0A8C8YJE2_BAD-01       cccagccgctttcggggc-------------cgctcacgctcggcgcccc
A0A8C9AQA8_HRK-01       ---cgccgcgcgcggagc-------------cggagggcgccagcgcccc
A0A8C9AIW5_BBC3-01      ---agcagcacctggagt-------------cgcccgtccccagcgcccc
A0A8C9AIW5_BBC3-02      ---agcagcacctggagt-------------cgcccgtccccagcgcccc
                                                                          

A0A8C9AR60_PMAIP1-      ttc-----------------------------------------------
A0A8C8ZIH1_PMAIP1-      cgg-----------------------------------------------
A0A8C9DED2_PMAIP1-      cgg-----------------------------------------------
A0A8C8ZU60_BCL2L11      ----------------------------------gcttc-catgaggcaa
A0A8C8ZU60_BCL2L11      ttgccaggccttcaaccattatctcagtgcaatggcttc-catgaggcaa
A0A8C8ZU60_BCL2L11      ttgccaggccttcaaccattatctcagtgcaatggcttc-catgaggcaa
A0A8C8ZU60_BCL2L11      ttgccaggccttcaaccattatctcagtgcaatggcttc-catgaggcaa
A0A8C8ZKT5_BIK-01       tgg---gagccttagcgacggtttcaccaa-----cctc-----------
A0A8C8ZAV1_BMF-01       --------ctccctgccagtttccctgcaggcttgccccttggggaacag
A0A8C8YJE2_BAD-01       cca---acctctgggctg----cacagcgctatggccgc----gagctcc
A0A8C9AQA8_HRK-01       gcg---cgctc-----------cccaccta-ctggccct----gg-----
A0A8C9AIW5_BBC3-01      ggg---ggccctggcgggcggtcccacccaggcggcccc----gggagtc
A0A8C9AIW5_BBC3-02      ggg---ggccctggcgggcggtcccacccaggcggcccc----gggagtc
                                                                          

A0A8C9AR60_PMAIP1-      ---------------tcagagatccaagagg------agtgtgcccttca
A0A8C8ZIH1_PMAIP1-      ---------------acagagatccaagagg------agtgtgcccttca
A0A8C9DED2_PMAIP1-      ---------------acagagatccaagagg------agtgtgcccttca
A0A8C8ZU60_BCL2L11      tttcaggctgaacctgcagatatgcgcccggagatatggatcgcgcagga
A0A8C8ZU60_BCL2L11      tttcaggctgaacctgcagatatgcgcccggagatatggatcgcgcagga
A0A8C8ZU60_BCL2L11      tttcaggctgaacctgcagatatgcgcccggagatatggatcgcgcagga
A0A8C8ZU60_BCL2L11      tttcaggctgaacctgcagatatgcgcccggagatatggatcgcgcagga
A0A8C8ZKT5_BIK-01       ----agggagaacgtggccaggctctggaggtcactcag----ccccagg
A0A8C8ZAV1_BMF-01       cctgctgaagggcagtggcaacatcgagcagaggtacagattgcccgaaa
A0A8C8YJE2_BAD-01       -----ggaggatgagcgacgagttcgaggactccttcaagggac-----t
A0A8C9AQA8_HRK-01       ------------------------------------ctgtgcgc-----g
A0A8C9AIW5_BBC3-01      cggggggaggaggagcagtgggcccgagaga----tcggggccc-----a
A0A8C9AIW5_BBC3-02      cggggggaggaggagcagtgggcccgagaga----tcggggccc-----a
                                                                   *      

A0A8C9AR60_PMAIP1-      actcaggagaattggagacaaa---------------ctgcatttccagc
A0A8C8ZIH1_PMAIP1-      actcaggagaattggagacaaa---------------ctgcgtttccagc
A0A8C9DED2_PMAIP1-      actcaggagaattggagacaaa---------------ctgcatttccagc
A0A8C8ZU60_BCL2L11      gttgcggcgtattggagatgagtttaac---------gcttattacccaa
A0A8C8ZU60_BCL2L11      gttgcggcgtattggagatgagtttaac---------gcttattacccaa
A0A8C8ZU60_BCL2L11      gttgcggcgtattggagatgagtttaac---------gcttattacccaa
A0A8C8ZU60_BCL2L11      gttgcggcgtattggagatgagtttaac---------gcttattacccaa
A0A8C8ZKT5_BIK-01       ccctcggtgt---------------------------gccccgtcccggc
A0A8C8ZAV1_BMF-01       gcttcagcgcattgcagaccagttccaccggcttcatgtgcagcaacacc
A0A8C8YJE2_BAD-01       tcctcgcccgaaga-----------------------gcgcgggcacagc
A0A8C9AQA8_HRK-01       gccgc-gcaggtggcg---------------------gcgc--------t
A0A8C9AIW5_BBC3-01      gctgcggcggatggcggacgacctcaac---------gcgcagtacgagc
A0A8C9AIW5_BBC3-02      gctgcggcggatggcggacgacctcaac---------gcgcagtacgagc
                                                                          

A0A8C9AR60_PMAIP1-      a-----------------------------------------------ga
A0A8C8ZIH1_PMAIP1-      a-----------------------------------------------ga
A0A8C9DED2_PMAIP1-      a-----------------------------------------------ga
A0A8C8ZU60_BCL2L11      ggagg-----------------------ct--------------------
A0A8C8ZU60_BCL2L11      ggagg-----------------------tt------------------ag
A0A8C8ZU60_BCL2L11      ggagg-----------------------gtatttttgaataattaccaag
A0A8C8ZU60_BCL2L11      ggagg-----------------------gtatttttgaataattaccaag
A0A8C8ZKT5_BIK-01       ------------------------------------------------gt
A0A8C8ZAV1_BMF-01       agcagaaccaaaatcgcgt-----------------------------gt
A0A8C8YJE2_BAD-01       gacgcagatacggcagagttccagctggacacgcgtcattcagtcctggt
A0A8C9AQA8_HRK-01       ggcgg---------------------------------------cctgg-
A0A8C9AIW5_BBC3-01      ggcggagaca----agaggagcagc-agagacaccgcccctcgccctgga
A0A8C9AIW5_BBC3-02      ggcggagaca----agaggagcagc-agagacaccgcccctcgccctgga
                                                                          

A0A8C9AR60_PMAIP1-      aacttctgaatct-----------gatagccaaacttctcc-gctcagga
A0A8C8ZIH1_PMAIP1-      aacttctgaatct-----------gatagccaaacttctcc-gctcagga
A0A8C9DED2_PMAIP1-      aacttctgaatct-----------gatagccaaacttctcc-gctcagga
A0A8C8ZU60_BCL2L11      -ggcaaaacccctggtaccccccatatga---------------------
A0A8C8ZU60_BCL2L11      ag---------------------aaatag---------------------
A0A8C8ZU60_BCL2L11      aggctgaagacct-----ccctcaaatggttatcttacgactgttacgtt
A0A8C8ZU60_BCL2L11      aggctgaagacct-----ccctcaaatggttatcttacgactgttacgtt
A0A8C8ZKT5_BIK-01       gggagcaggtgct-----ggtgctgctgctggtgctgctgctgggcaggg
A0A8C8ZAV1_BMF-01       ggtggcagatcct-----cctcttcctacacaaccttgctttgaacggag
A0A8C8YJE2_BAD-01       gggatcggaacgt-----gggca--ggggaggctctgccccctcccagtg
A0A8C9AQA8_HRK-01       ----------------------------------ctgctc---------g
A0A8C9AIW5_BBC3-01      gggtcctgtacaa-----tctcatcatgggactcctgcccttacccaggg
A0A8C9AIW5_BBC3-02      gggtcctgtacaa-----tctcatcatgggactcctgcccttacccaggg
                                                                          

A0A8C9AR60_PMAIP1-      acctga--------------------------
A0A8C8ZIH1_PMAIP1-      acctga--------------------------
A0A8C9DED2_PMAIP1-      acctga--------------------------
A0A8C8ZU60_BCL2L11      --------------------------------
A0A8C8ZU60_BCL2L11      --------------------------------
A0A8C8ZU60_BCL2L11      accttgtccgcctggtgtgggggaggcattga
A0A8C8ZU60_BCL2L11      accttgtccgcctggtgtgggggaggcattga
A0A8C8ZKT5_BIK-01       gcctgcacc---------tgctgctcaagtga
A0A8C8ZAV1_BMF-01       aagagaacaggaacggggcaggtcccaggtga
A0A8C8YJE2_BAD-01       a-------------------------------
A0A8C9AQA8_HRK-01       gc-------------aggcggaacttg--tag
A0A8C9AIW5_BBC3-01      gccacagagcccctgagatggagcccaattag
A0A8C9AIW5_BBC3-02      gccacagagcccctgagatggagcccaattag
                                                        

© 1998-2022Legal notice