Dataset for CDS BBC3 of organism Prolemur simus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C9AIW5_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Prolemur simus GN=BBC3 (length=393 residues).
atgaaatttggtgcggggtctgcccgggcatgtccacacgtgcccggggcttccttctcgcgatgggtcccgggccatat
tcgtggtcctcagccatcactctcactggcagagcagcacctggagtcgcccgtccccagcgccccgggggccctggcgg
gcggtcccacccaggcggccccgggagtccggggggaggaggagcagtgggcccgagagatcggggcccagctgcggcgg
atggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagcagagacaccgcccctcgccctggagggt
cctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccctgagatggagcccaattag
>gnl|bcl2dbcds|A0A8C9AIW5_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Prolemur simus GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctgcccgctgcccccgccgcccccgccctgc
tacccgctgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccggccccgaggcccacgcccggacggtcctcagccatcactctcactggcagagcagcacctggagtcgcc
cgtccccagcgccccgggggccctggcgggcggtcccacccaggcggccccgggagtccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcag
cagagacaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagc
ccctgagatggagcccaattag
© 1998-2022Legal notice