Dataset for CDS BBC3 of organism Prolemur simus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9AIW5_BBC3-01      atga----------------------------------------------
A0A8C9AIW5_BBC3-02      atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcct
                        ***                                               

A0A8C9AIW5_BBC3-01      --------------------------------------------------
A0A8C9AIW5_BBC3-02      ggcccgcgacggcccgcgccccttcccgctcggccgcctggtgccctcgg
                                                                          

A0A8C9AIW5_BBC3-01      -aatttggtgcggggtctgc---ccgggcatgtccac-------------
A0A8C9AIW5_BBC3-02      cagtgtcctgcggcctctgcgagcccggcctgcccgctgcccccgccgcc
                         * * *  *****  *****   ** *** ** ** *             

A0A8C9AIW5_BBC3-01      --------------------------acgtgccc----------------
A0A8C9AIW5_BBC3-02      cccgccctgctacccgctgcctacctctgcgcccccaccgccccgcccgc
                                                    * ****                

A0A8C9AIW5_BBC3-01      -----------------ggggcttcc-------------ttctcgcgatg
A0A8C9AIW5_BBC3-02      cgtcaccgccgccctggggggcccccgctggcctgggggtccccgcagcc
                                         *****  **             * * ***    

A0A8C9AIW5_BBC3-01      ggtcccggg--ccatattcg--tggtcctcagccatcactctcactggca
A0A8C9AIW5_BBC3-02      ggccccgaggcccacgcccggacggtcctcagccatcactctcactggca
                        ** **** *  ***    **   ***************************

A0A8C9AIW5_BBC3-01      gagcagcacctggagtcgcccgtccccagcgccccgggggccctggcggg
A0A8C9AIW5_BBC3-02      gagcagcacctggagtcgcccgtccccagcgccccgggggccctggcggg
                        **************************************************

A0A8C9AIW5_BBC3-01      cggtcccacccaggcggccccgggagtccggggggaggaggagcagtggg
A0A8C9AIW5_BBC3-02      cggtcccacccaggcggccccgggagtccggggggaggaggagcagtggg
                        **************************************************

A0A8C9AIW5_BBC3-01      cccgagagatcggggcccagctgcggcggatggcggacgacctcaacgcg
A0A8C9AIW5_BBC3-02      cccgagagatcggggcccagctgcggcggatggcggacgacctcaacgcg
                        **************************************************

A0A8C9AIW5_BBC3-01      cagtacgagcggcggagacaagaggagcagcagagacaccgcccctcgcc
A0A8C9AIW5_BBC3-02      cagtacgagcggcggagacaagaggagcagcagagacaccgcccctcgcc
                        **************************************************

A0A8C9AIW5_BBC3-01      ctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggg
A0A8C9AIW5_BBC3-02      ctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggg
                        **************************************************

A0A8C9AIW5_BBC3-01      gccacagagcccctgagatggagcccaattag
A0A8C9AIW5_BBC3-02      gccacagagcccctgagatggagcccaattag
                        ********************************

© 1998-2022Legal notice