Dataset for CDS classical BH3-containing proteins of organism Pongo abelii

[Download (right click)] [Alignment] [Repertoires]

9 sequence(s)

>gnl|bcl2dbcds|A0A2J8T301_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Pongo abelii GN=BMF (length=555 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggggagccggggacccaatccgg
aagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaagctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcctactggggagcagccccctgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcaggccctaggtga
>gnl|bcl2dbcds|A0A2J8TYJ3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pongo abelii GN=BAD (length=564 residues).
atggggaccccagagaatccctctcctgctcccacacacgcccaagatgtgaggcagcgaggatcccagagcatgttcca
gatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgcaggggaca
ggccctcaggctccagcaagcatcatcgccaggccccaggcctcctgcgggacgccagtcaccagcaggagcagccaacc
agcagcagccatcatggagggagaacttggtattctccttcttgggaatctgaggactctgaaaatcccagtgcagggat
gctcgcggaagcatcagcagggatgtccgccccagccgctgactcagaagcccaacacgcagagaatgtaaagctggagg
cgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacggaggacgacgaagggatgggggaggagc
ccagcccctttcggggccgttcgcgctcggcgccccccaatctctgggcagcacagcgctatggccgcgagctccggagg
atga
>gnl|bcl2dbcds|A0A2J8TYJ3_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pongo abelii GN=BAD (length=579 residues).
atggggaccccagagaatccctctcctgctcccacacacgcccaagatgtgaggcagcgaggatcccagagcatgttcca
gatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgcaggggaca
ggccctcaggctccagcaagcatcatcgccaggccccaggcctcctgcgggacgccagtcaccagcaggagcagccaacc
agcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacggaggacga
cgaagggatgggggaggagcccagcccctttcggggccgttcgcgctcggcgccccccaatctctgggcagcacagcgct
atggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaagagcgcgggc
acagcaacgcagatgcggcaaagctccagctggacgcgagtcttccaatcctggtgggatcggaacttgggcaggggaag
ctccgccccctcccagtga
>gnl|bcl2dbcds|A0A2J8TYJ3_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pongo abelii GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacaggccctcaggctccagcaagcatcatcgccaggccccaggcctcctgcgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacg
gaggacgacgaagggatgggggaggagcccagcccctttcggggccgttcgcgctcggcgccccccaatctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcttccaatcctggtgggatcggaacttgggc
aggggaagctccgccccctcccagtga
>gnl|bcl2dbcds|H2NIS8_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Pongo abelii GN=HRK (length=276 residues).
atgtgcccgtgtcccctgcaccgcgaccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccagcgcgctcccaacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|H2NWG2_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Pongo abelii GN=PMAIP1 (length=396 residues).
atgcctggaaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggctccagcaggagcaggtacggcgggtacggc
gagggaccaagccggatttgggattgggatgcagctgcgtttcaccaggggcaaaaagctcctttcctcctcgccacttg
ccctgccccggggccacgaggaacaagtgcaaatagctggaagtcgagtgtgctactcaactcaggagatttggagacaa
actgaacttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaacctgactgcatcaaaaacttgcat
gaggggactccttcaaaagagttttctcaggaggtgcacatttcatcaatttgaagaaagactgcattgtcattgg
>gnl|bcl2dbcds|H2NZD3_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Pongo abelii GN=BBC3 (length=786 residues).
atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggcttcttctgcgacgtgggtcccctgcca
gatttgtggccccagggagcgccatggcccgcgcacggcaggagggcagctccccggagcccgtagagggcctggcccgc
gacggcccgcgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggccgc
cgcccccgccgcccccgccctgctgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctgg
ggggcccccgctggccggggggtccccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctctcgctg
gcggagcagcacctggagtcgcccgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagt
ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacg
agcggcggagacaagaggagcagcagcggcaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctg
cccttacccaggggccacagagcccccgagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|H2NZD3_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Pongo abelii GN=BBC3 (length=396 residues).
atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggcttcttctgcgacgtgggtcccctgcca
gatttgtggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggctctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagcagcggcaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccccgagatggagcccaattag
>gnl|bcl2dbcds|H2P4N6_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Pongo abelii GN=BIK (length=465 residues).
atgtctgaagtaagacctatctccagagacatcctgatggagaccctcctgtatgagcagctcctggaacccccgaccat
ggaggttcttggcgtgactgactctgaagaggacctggaccctatggaggacttcagtcctttggagtgcatggagggca
gtgacgcgttggccttgcggctggcctgcatcggggacgagatggacgtgagcctcagggccccgcgccgggcccagctc
cccgaggtggccatgcacagcctgggtctggctttcatctacgaccagactgaggacatcagggatgttcttagaagttt
cacggacggtttcaccacccttaaggaaaacataatgaggttctggagctccctgaaccccgggtcctgggtgtcccgcg
aacaggtgctgctggcgctgctgctgttgctgctcagcgggggcctgcacctgctgctcaagtga
© 1998-2022Legal notice