Dataset for CDS classical BH3-containing proteins of organism Pongo abelii

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H2NWG2_PMAIP1-01       -------------------------------------------atgcctg
A0A2J8T301_BMF-01      atggagccatctcagtgtgtgg---------------------aggagct
H2P4N6_BIK-01          -------------------------------------------atg-tct
A0A2J8TYJ3_BAD-01      atggggaccccagagaatccctctcctgctcccacacacgcccaagatgt
A0A2J8TYJ3_BAD-02      atggggaccccagagaatccctctcctgctcccacacacgcccaagatgt
A0A2J8TYJ3_BAD-03      --------------------------------------------------
H2NIS8_HRK-01          -------------------------------------------atg----
H2NZD3_BBC3-01         -------------------------------------------atgaaat
H2NZD3_BBC3-02         -------------------------------------------atgaaat
                                                                         

H2NWG2_PMAIP1-01       gaaagaaggcg----cgcaagaacgctca-----------accgagcccc
A0A2J8T301_BMF-01      ggaggatgatgtgttccaa--------ccagaggatgggg----agccgg
H2P4N6_BIK-01          gaagtaagacctatctccagagacatcct----gatggagaccctcctgt
A0A2J8TYJ3_BAD-01      gaggcagcgaggatcccagagcatgttccagatcccagagtttgagccga
A0A2J8TYJ3_BAD-02      gaggcagcgaggatcccagagcatgttccagatcccagagtttgagccga
A0A2J8TYJ3_BAD-03      ----------------------atgttccagatcccagagtttgagccga
H2NIS8_HRK-01          -------------tgcccgtgt---cccc---------------tgcacc
H2NZD3_BBC3-01         ttggcatggggtctgcccaggcatgtcca---------------tgccag
H2NZD3_BBC3-02         ttggcatggggtctgcccaggcatgtcca---------------tgccag
                                                  *                  *   

H2NWG2_PMAIP1-01       gcgcggg------------ctccagcaggagcaggtacggcgggtacggc
A0A2J8T301_BMF-01      ggacccaatccggaagcttgctctctgctgacctgtttgcccagagccta
H2P4N6_BIK-01          atgagcagctcctggaacccccgaccatggaggttcttggcgtga-----
A0A2J8TYJ3_BAD-01      gtgagca------ggaagactccagc-------tctgcagagaggg--gc
A0A2J8TYJ3_BAD-02      gtgagca------ggaagactccagc-------tctgcagagaggg--gc
A0A2J8TYJ3_BAD-03      gtgagca------ggaagactccagc-------tctgcagagaggg--gc
H2NIS8_HRK-01          gcgaccg------cggccccccggccgtgtgcgcctgcagcgcgggtcgc
H2NZD3_BBC3-01         gtgccca------gggcttct------------tctgcgacgtgggtccc
H2NZD3_BBC3-02         gtgccca------gggcttct------------tctgcgacgtgggtccc
                                                                  *      

H2NWG2_PMAIP1-01       gag----------------------------ggaccaagccggatttggg
A0A2J8T301_BMF-01      ctg----------------------------gactgccccctcagccgac
H2P4N6_BIK-01          ctg-----------------------------------actctgaag---
A0A2J8TYJ3_BAD-01      ctg----------------------------ggccccagccccgcagggg
A0A2J8TYJ3_BAD-02      ctg----------------------------ggccccagccccgcagggg
A0A2J8TYJ3_BAD-03      ctg----------------------------ggccccagccccgcagggg
H2NIS8_HRK-01          ctg-----------------------------------------------
H2NZD3_BBC3-01         ctgccagatttgtggccccagggagcgccatggcccgcgcacggcaggag
H2NZD3_BBC3-02         ctgccagatttgt-------------------------------------
                         *                                               

H2NWG2_PMAIP1-01       attgggatgcagctgcgtttcaccag------------------------
A0A2J8T301_BMF-01      ttcagctcttccctctcacccactgctg----------------------
H2P4N6_BIK-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      acaggccctcaggctccagcaagcatcatcgcc-----------------
A0A2J8TYJ3_BAD-02      acaggccctcaggctccagcaagcatcatcgcc-----------------
A0A2J8TYJ3_BAD-03      acaggccctcaggctccagcaagcatcatcgcc-----------------
H2NIS8_HRK-01          --------------------------------------------------
H2NZD3_BBC3-01         ggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccc
H2NZD3_BBC3-02         --------------------------------------------------
                                                                         

H2NWG2_PMAIP1-01       --------------------------------------------------
A0A2J8T301_BMF-01      --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
H2NIS8_HRK-01          --------------------------------------------------
H2NZD3_BBC3-01         cttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctctgcg
H2NZD3_BBC3-02         --------------------------------------------------
                                                                         

H2NWG2_PMAIP1-01       --------------------------------------------------
A0A2J8T301_BMF-01      --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
H2NIS8_HRK-01          --------------------------------------------------
H2NZD3_BBC3-01         agcccggcctggccgccgcccccgccgcccccgccctgctgcccgctgcc
H2NZD3_BBC3-02         --------------------------------------------------
                                                                         

H2NWG2_PMAIP1-01       --------------------------------------------------
A0A2J8T301_BMF-01      --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
H2NIS8_HRK-01          --------------------------------------------------
H2NZD3_BBC3-01         tacctctgcgcccccaccgccccacccgccgtcaccgccgccctgggggg
H2NZD3_BBC3-02         --------------------------------------------------
                                                                         

H2NWG2_PMAIP1-01       --------------------------------------------------
A0A2J8T301_BMF-01      --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
H2NIS8_HRK-01          --------------------------------------------------
H2NZD3_BBC3-01         cccccgctggccggggggtccccgcagccggccccgaggcccgcgcccgg
H2NZD3_BBC3-02         --------------------------------------------------
                                                                         

H2NWG2_PMAIP1-01       --gggcaaaaagctcctttc----------ctcctcgc------------
A0A2J8T301_BMF-01      --tggccctggccttcgacc-----------caccagccaggaagacaaa
H2P4N6_BIK-01          --aggacctggaccctatggaggacttcagtcctttgg------------
A0A2J8TYJ3_BAD-01      --aggccccaggcctcctgcgggacgccagtcaccagcaggagcagccaa
A0A2J8TYJ3_BAD-02      --aggccccaggcctcctgcgggacgccagtcaccagcaggagcagccaa
A0A2J8TYJ3_BAD-03      --aggccccaggcctcctgcgggacgccagtcaccagcaggagcagccaa
H2NIS8_HRK-01          --gggc---------tgcgc----------tcgtccgc-cgcgcagctca
H2NZD3_BBC3-01         acggtcctcagccctcgctc----------tcgctggc-ggagcag--ca
H2NZD3_BBC3-02         --ggtcctcagccctcgctc----------tcgctggc-ggagcag--ca
                          *                                *             

H2NWG2_PMAIP1-01       ----cacttgccct------------------------------------
A0A2J8T301_BMF-01      gctacccagaccctca----------------------------------
H2P4N6_BIK-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      ccagcagcagccatcatggagggagaacttggtattctccttcttgggaa
A0A2J8TYJ3_BAD-02      ccagcagcagccatca----------------------------------
A0A2J8TYJ3_BAD-03      ccagcagcagccatca----------------------------------
H2NIS8_HRK-01          cc----gccgcccg-g----------------------------------
H2NZD3_BBC3-01         cctggagtcgcccgtg----------------------------------
H2NZD3_BBC3-02         cctggagtcgcccgtg----------------------------------
                                                                         

H2NWG2_PMAIP1-01       --------------------------------------------------
A0A2J8T301_BMF-01      --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      tctgaggactctgaaaatcccagtgcagggatgctcgcggaagcatcagc
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
H2NIS8_HRK-01          --------------------------------------------------
H2NZD3_BBC3-01         --------------------------------------------------
H2NZD3_BBC3-02         --------------------------------------------------
                                                                         

H2NWG2_PMAIP1-01       --------------------------------------------------
A0A2J8T301_BMF-01      --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      agggatgtccgccccagccgctgactcagaagcccaacacgcagagaatg
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
H2NIS8_HRK-01          --------------------------------------------------
H2NZD3_BBC3-01         --------------------------------------------------
H2NZD3_BBC3-02         --------------------------------------------------
                                                                         

H2NWG2_PMAIP1-01       -----------gccccggg-gccacgaggaacaagtgcaaatagctggaa
A0A2J8T301_BMF-01      -----gcccagcctcccccagccaaggtgtcatgct-------gccttgt
H2P4N6_BIK-01          --------agtgcatggagggcagtgacgcgttg---------gccttgc
A0A2J8TYJ3_BAD-01      taaagctggaggcgctggg-gctgtggagatccggagtc----gcca---
A0A2J8TYJ3_BAD-02      ------tggaggcgctggg-gctgtggagatccggagtc----gcca---
A0A2J8TYJ3_BAD-03      ------tggaggcgctggg-gctgtggagatccggagtc----gcca---
H2NIS8_HRK-01          -----ctcaaggcgctagg-----cgacgagctgcaccagcgcaccatgt
H2NZD3_BBC3-01         -----cccagcgccccgggggctctggcgggcggtccca----ccca---
H2NZD3_BBC3-02         -----cccagcgccccgggggctctggcgggcggtccca----ccca---
                                   *            *  *               *     

H2NWG2_PMAIP1-01       gtcgagtgtgctactcaactcaggagatttggagac--------------
A0A2J8T301_BMF-01      ggggtgactgaggaaccccagcgactct------------tttatggcaa
H2P4N6_BIK-01          ggctggcctg-----catcggggacgagatggacgtgagcctcagggccc
A0A2J8TYJ3_BAD-01      --cagctcct--accccgcggggacgga--ggacgacgaagggatggggg
A0A2J8TYJ3_BAD-02      --cagctcct--accccgcggggacgga--ggacgacgaagggatggggg
A0A2J8TYJ3_BAD-03      --cagctcct--accccgcggggacgga--ggacgacgaagggatggggg
H2NIS8_HRK-01          ggcggcgccg------cgcgcggagccg--ga------------gggcgc
H2NZD3_BBC3-01         ggcggccccgggagtccgcggggaggag--gaacagtgggcccgggagat
H2NZD3_BBC3-02         ggcggccccgggagtccgcggggaggag--gaacagtgggcccgggagat
                                         *   *                           

H2NWG2_PMAIP1-01       ------aaactgaacttccggcagaaacttctgaatctgatatccaaact
A0A2J8T301_BMF-01      tgctggctaccggcttcctctccctgccagt--ttcccggcagtcttgcc
H2P4N6_BIK-01          cgcgccgggcccagctccccgaggtggc---catgcacagc---ctgggt
A0A2J8TYJ3_BAD-01      ag----gagcccagcccctttcggggccgttcgcgctcggcgccc---cc
A0A2J8TYJ3_BAD-02      ag----gagcccagcccctttcggggccgttcgcgctcggcgccc---cc
A0A2J8TYJ3_BAD-03      ag----gagcccagcccctttcggggccgttcgcgctcggcgccc---cc
H2NIS8_HRK-01          cg----gcgcccagc---------------gcgctcccaacctactggcc
H2NZD3_BBC3-01         cg----gggcccagctgcggcggatggcggacgacctcaacgcgcag---
H2NZD3_BBC3-02         cg----gggcccagctgcggcggatggcggacgacctcaacgcgcag---
                                *                                  *     

H2NWG2_PMAIP1-01       cttctgctcaggaac-----------------------------------
A0A2J8T301_BMF-01      ta----ctggggagcagccccctgaagggcagtggcaacatcgagcagag
H2P4N6_BIK-01          ctggctttcatctacgaccagactgaggacatcagggatgttc-------
A0A2J8TYJ3_BAD-01      caatctctgggcagc----------------acagcgctatgg-------
A0A2J8TYJ3_BAD-02      caatctctgggcagc----------------acagcgctatgg-------
A0A2J8TYJ3_BAD-03      caatctctgggcagc----------------acagcgctatgg-------
H2NIS8_HRK-01          ctggctgtgcgcggccgcgcaggtggcggcgctggcggcctgg-------
H2NZD3_BBC3-01         -----tacgagcggcggagacaagaggagcagcagcggcaccg-------
H2NZD3_BBC3-02         -----tacgagcggcggagacaagaggagcagcagcggcaccg-------
                                     *                                   

H2NWG2_PMAIP1-01       -----------ctgactgcatcaaaaacttg-------------------
A0A2J8T301_BMF-01      gtacagattgcccgaaagcttcagtgcattg-------------------
H2P4N6_BIK-01          -----------ttagaagtttcacgg------------------------
A0A2J8TYJ3_BAD-01      -----------ccgcgagctccggaggatga-------------------
A0A2J8TYJ3_BAD-02      -----------ccgcgagctccggaggatgagtgacgagtttgtggactc
A0A2J8TYJ3_BAD-03      -----------ccgcgagctccggaggatgagtgacgagtttgtggactc
H2NIS8_HRK-01          -----------ctgctcggc------------------------------
H2NZD3_BBC3-01         -----------cccctcgccctggagggtcc------------tgtacaa
H2NZD3_BBC3-02         -----------cccctcgccctggagggtcc------------tgtacaa
                                        *                                

H2NWG2_PMAIP1-01       ---catgaggggactccttcaaaagagttttctcaggaggtgcacatttc
A0A2J8T301_BMF-01      ---cagaccagttccaccgg------cttcatgtg---------cagcaa
H2P4N6_BIK-01          -------acggtttcaccac------ccttaagga---------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-02      ctttaagaagggacttcctc------gcccgaagagcgcgggcacagcaa
A0A2J8TYJ3_BAD-03      ctttaagaagggacttcctc------gcccgaagagcgcgggcacagcaa
H2NIS8_HRK-01          --------------------------------------------------
H2NZD3_BBC3-01         tctcatcatgggactcctgc------ccttacccaggggccacagagccc
H2NZD3_BBC3-02         tctcatcatgggactcctgc------ccttacccaggggccacagagccc
                                                                         

H2NWG2_PMAIP1-01       atcaatttgaagaaagactgcattgtcattgg------------------
A0A2J8T301_BMF-01      caccagcagaaccgaaatcg------------------------------
H2P4N6_BIK-01          ---aaacataatgaggttctggagctccctgaaccccgggtcctgggtgt
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-02      cgcagatgcggcaaagctccagctggacgcgagtcttccaatcctggtgg
A0A2J8TYJ3_BAD-03      cgcagatgcggcaaagctccagctggacgcgagtcttccaatcctggtgg
H2NIS8_HRK-01          ---aggcggaacttg--tag------------------------------
H2NZD3_BBC3-01         ccgagatggagcccaattaggtgcctgcacccgcccggtggacgtcaggg
H2NZD3_BBC3-02         ccgagatggagcccaattag------------------------------
                                                                         

H2NWG2_PMAIP1-01       --------------------------------------------------
A0A2J8T301_BMF-01      ----------cgtgtggtggcagatcctcctcttcctgcacaaccttgct
H2P4N6_BIK-01          cccgcgaacaggtgctgctggcgctgctgctgttgctgctcagcgggggc
A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-02      gatcggaacttgggcaggggaagctccgccccctcccagtga--------
A0A2J8TYJ3_BAD-03      gatcggaacttgggcaggggaagctccgccccctcccagtga--------
H2NIS8_HRK-01          --------------------------------------------------
H2NZD3_BBC3-01         actcggggggcaggcccctcccacctcctgacaccctggccagcgcgggg
H2NZD3_BBC3-02         --------------------------------------------------
                                                                         

H2NWG2_PMAIP1-01       ------------------------------------------
A0A2J8T301_BMF-01      ttgaatggagaagagaacaggaacggggcaggccctaggtga
H2P4N6_BIK-01          ctgcac---------------------ctgctgctcaagtga
A0A2J8TYJ3_BAD-01      ------------------------------------------
A0A2J8TYJ3_BAD-02      ------------------------------------------
A0A2J8TYJ3_BAD-03      ------------------------------------------
H2NIS8_HRK-01          ------------------------------------------
H2NZD3_BBC3-01         gacttt---------------------ctctgcaccatgtag
H2NZD3_BBC3-02         ------------------------------------------
                                                                 

© 1998-2022Legal notice