Dataset for CDS BAD of organism Pongo abelii

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A2J8TYJ3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pongo abelii GN=BAD (length=564 residues).
atggggaccccagagaatccctctcctgctcccacacacgcccaagatgtgaggcagcgaggatcccagagcatgttcca
gatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgcaggggaca
ggccctcaggctccagcaagcatcatcgccaggccccaggcctcctgcgggacgccagtcaccagcaggagcagccaacc
agcagcagccatcatggagggagaacttggtattctccttcttgggaatctgaggactctgaaaatcccagtgcagggat
gctcgcggaagcatcagcagggatgtccgccccagccgctgactcagaagcccaacacgcagagaatgtaaagctggagg
cgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacggaggacgacgaagggatgggggaggagc
ccagcccctttcggggccgttcgcgctcggcgccccccaatctctgggcagcacagcgctatggccgcgagctccggagg
atga
>gnl|bcl2dbcds|A0A2J8TYJ3_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pongo abelii GN=BAD (length=579 residues).
atggggaccccagagaatccctctcctgctcccacacacgcccaagatgtgaggcagcgaggatcccagagcatgttcca
gatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgcaggggaca
ggccctcaggctccagcaagcatcatcgccaggccccaggcctcctgcgggacgccagtcaccagcaggagcagccaacc
agcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacggaggacga
cgaagggatgggggaggagcccagcccctttcggggccgttcgcgctcggcgccccccaatctctgggcagcacagcgct
atggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaagagcgcgggc
acagcaacgcagatgcggcaaagctccagctggacgcgagtcttccaatcctggtgggatcggaacttgggcaggggaag
ctccgccccctcccagtga
>gnl|bcl2dbcds|A0A2J8TYJ3_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pongo abelii GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacaggccctcaggctccagcaagcatcatcgccaggccccaggcctcctgcgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacg
gaggacgacgaagggatgggggaggagcccagcccctttcggggccgttcgcgctcggcgccccccaatctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcttccaatcctggtgggatcggaacttgggc
aggggaagctccgccccctcccagtga
© 1998-2022Legal notice