Dataset for CDS BAD of organism Pongo abelii

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2J8TYJ3_BAD-01      atggggaccccagagaatccctctcctgctcccacacacgcccaagatgt
A0A2J8TYJ3_BAD-02      atggggaccccagagaatccctctcctgctcccacacacgcccaagatgt
A0A2J8TYJ3_BAD-03      --------------------------------------------------
                                                                         

A0A2J8TYJ3_BAD-01      gaggcagcgaggatcccagagcatgttccagatcccagagtttgagccga
A0A2J8TYJ3_BAD-02      gaggcagcgaggatcccagagcatgttccagatcccagagtttgagccga
A0A2J8TYJ3_BAD-03      ----------------------atgttccagatcccagagtttgagccga
                                             ****************************

A0A2J8TYJ3_BAD-01      gtgagcaggaagactccagctctgcagagaggggcctgggccccagcccc
A0A2J8TYJ3_BAD-02      gtgagcaggaagactccagctctgcagagaggggcctgggccccagcccc
A0A2J8TYJ3_BAD-03      gtgagcaggaagactccagctctgcagagaggggcctgggccccagcccc
                       **************************************************

A0A2J8TYJ3_BAD-01      gcaggggacaggccctcaggctccagcaagcatcatcgccaggccccagg
A0A2J8TYJ3_BAD-02      gcaggggacaggccctcaggctccagcaagcatcatcgccaggccccagg
A0A2J8TYJ3_BAD-03      gcaggggacaggccctcaggctccagcaagcatcatcgccaggccccagg
                       **************************************************

A0A2J8TYJ3_BAD-01      cctcctgcgggacgccagtcaccagcaggagcagccaaccagcagcagcc
A0A2J8TYJ3_BAD-02      cctcctgcgggacgccagtcaccagcaggagcagccaaccagcagcagcc
A0A2J8TYJ3_BAD-03      cctcctgcgggacgccagtcaccagcaggagcagccaaccagcagcagcc
                       **************************************************

A0A2J8TYJ3_BAD-01      atcatggagggagaacttggtattctccttcttgggaatctgaggactct
A0A2J8TYJ3_BAD-02      atca----------------------------------------------
A0A2J8TYJ3_BAD-03      atca----------------------------------------------
                       ****                                              

A0A2J8TYJ3_BAD-01      gaaaatcccagtgcagggatgctcgcggaagcatcagcagggatgtccgc
A0A2J8TYJ3_BAD-02      --------------------------------------------------
A0A2J8TYJ3_BAD-03      --------------------------------------------------
                                                                         

A0A2J8TYJ3_BAD-01      cccagccgctgactcagaagcccaacacgcagagaatgtaaagctggagg
A0A2J8TYJ3_BAD-02      --------------------------------------------tggagg
A0A2J8TYJ3_BAD-03      --------------------------------------------tggagg
                                                                   ******

A0A2J8TYJ3_BAD-01      cgctggggctgtggagatccggagtcgccacagctcctaccccgcgggga
A0A2J8TYJ3_BAD-02      cgctggggctgtggagatccggagtcgccacagctcctaccccgcgggga
A0A2J8TYJ3_BAD-03      cgctggggctgtggagatccggagtcgccacagctcctaccccgcgggga
                       **************************************************

A0A2J8TYJ3_BAD-01      cggaggacgacgaagggatgggggaggagcccagcccctttcggggccgt
A0A2J8TYJ3_BAD-02      cggaggacgacgaagggatgggggaggagcccagcccctttcggggccgt
A0A2J8TYJ3_BAD-03      cggaggacgacgaagggatgggggaggagcccagcccctttcggggccgt
                       **************************************************

A0A2J8TYJ3_BAD-01      tcgcgctcggcgccccccaatctctgggcagcacagcgctatggccgcga
A0A2J8TYJ3_BAD-02      tcgcgctcggcgccccccaatctctgggcagcacagcgctatggccgcga
A0A2J8TYJ3_BAD-03      tcgcgctcggcgccccccaatctctgggcagcacagcgctatggccgcga
                       **************************************************

A0A2J8TYJ3_BAD-01      gctccggaggatga------------------------------------
A0A2J8TYJ3_BAD-02      gctccggaggatgagtgacgagtttgtggactcctttaagaagggacttc
A0A2J8TYJ3_BAD-03      gctccggaggatgagtgacgagtttgtggactcctttaagaagggacttc
                       **************                                    

A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-02      ctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaagctccagc
A0A2J8TYJ3_BAD-03      ctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaagctccagc
                                                                         

A0A2J8TYJ3_BAD-01      --------------------------------------------------
A0A2J8TYJ3_BAD-02      tggacgcgagtcttccaatcctggtgggatcggaacttgggcaggggaag
A0A2J8TYJ3_BAD-03      tggacgcgagtcttccaatcctggtgggatcggaacttgggcaggggaag
                                                                         

A0A2J8TYJ3_BAD-01      -------------------
A0A2J8TYJ3_BAD-02      ctccgccccctcccagtga
A0A2J8TYJ3_BAD-03      ctccgccccctcccagtga
                                          

© 1998-2022Legal notice