Dataset for CDS PMAIP1 of organism Piliocolobus tephrosceles

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C9H6M4_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Piliocolobus tephrosceles GN=PMAIP1 (length=399 residues).
caccggggaagctctcattggacaaaagcgtggtctctggcgctgggacctcacagtttcccgggcactcaccgagtgta
cttggtagctctgcgcgtccgagtagtcggtcccggcacccctgcccgcgggtctgttggtgttcagctcgcgtcctgca
gacgtccgacgcgctccagttggagaccgaggttcccgggctctgtagctgagtgggcggcggcactggcggagatgcct
gggaagaaggcgcgcaagaacgcgcaaccgagcccagcgcgggctcaggcagagctcgaagtcgagtgtgctactcaact
caggagatttggagacaaactgaatttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaacctga
>gnl|bcl2dbcds|A0A8C9H6M4_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Piliocolobus tephrosceles GN=PMAIP1 (length=417 residues).
atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccagcgcgggctcaggcaggagcggggactgcagggacggc
gagggaccaagccggatttgggattgggatgcagctgcatttcaccagaggcaaaaacctcctctcctcctccccacttg
ccctctcctcctccccacttgcccttccgcggggccacgaggaacaagtgcaagtagctcgaagtcgagtgtgctactca
actcaggagatttggagacaaactgaatttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaacct
gactgaatcaaaaacttgcataaggggactccaaaagagaatttttctcaggaggtgcacatttcatcaatttgaagcaa
gattgcattgtaattgg
© 1998-2022Legal notice