Dataset for CDS PMAIP1 of organism Piliocolobus tephrosceles

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9H6M4_PMAIP1-      -caccggggaag--------------ctctcattggacaaaagcgtggtc
A0A8C9H6M4_PMAIP1-      atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccagcgcgggc
                           ** ******              * * **   **    **** ** *

A0A8C9H6M4_PMAIP1-      tctggc----gctgggacctcacagtttcccgggcactca-ccgagt---
A0A8C9H6M4_PMAIP1-      tcaggcaggagcggggactgcagggacggcgagggaccaagccggatttg
                        ** ***    ** *****  **  *    *  ** **  * ***  *   

A0A8C9H6M4_PMAIP1-      gtacttggtagc-tctgcgcgtccgagtagtcgg----tcccggcacccc
A0A8C9H6M4_PMAIP1-      ggattgggatgcagctgcatttcaccagaggcaaaaacctcctctcctcc
                        * * * **  **  ****   **     ** *        **    * **

A0A8C9H6M4_PMAIP1-      tgcccgcgggtctgttggtgttcagctcgcgtcctgcagacgtccgacgc
A0A8C9H6M4_PMAIP1-      tccccacttgcc-------------ctctcctcct-------ccccactt
                        * *** *  * *             *** * ****        ** **  

A0A8C9H6M4_PMAIP1-      gctccagttggagaccgaggttcccgggctctgtagctgagtgggcggcg
A0A8C9H6M4_PMAIP1-      gccc----------------ttcc--------------------gcgggg
                        ** *                ****                    **** *

A0A8C9H6M4_PMAIP1-      gcactggcggagatgcctgggaagaaggcgcgcaagaacgcgcaaccgag
A0A8C9H6M4_PMAIP1-      ccac----------------gaggaacaagtgcaag--------------
                         ***                ** ***   * *****              

A0A8C9H6M4_PMAIP1-      cccagcgcgggctcaggcagagctcgaagtcgagtgtgctactcaactca
A0A8C9H6M4_PMAIP1-      -------------------tagctcgaagtcgagtgtgctactcaactca
                                            ******************************

A0A8C9H6M4_PMAIP1-      ggagatttggagacaaactgaatttccggcagaaacttctgaatctgata
A0A8C9H6M4_PMAIP1-      ggagatttggagacaaactgaatttccggcagaaacttctgaatctgata
                        **************************************************

A0A8C9H6M4_PMAIP1-      gccaaactcttctgctcaggaacctga-----------------------
A0A8C9H6M4_PMAIP1-      gccaaactcttctgctcaggaacctgactgaatcaaaaacttgcataagg
                        ***************************                       

A0A8C9H6M4_PMAIP1-      --------------------------------------------------
A0A8C9H6M4_PMAIP1-      ggactccaaaagagaatttttctcaggaggtgcacatttcatcaatttga
                                                                          

A0A8C9H6M4_PMAIP1-      ----------------------
A0A8C9H6M4_PMAIP1-      agcaagattgcattgtaattgg
                                              

© 1998-2022Legal notice