Dataset for CDS classical BH3-containing proteins of organism Piliocolobus tephrosceles

[Download (right click)] [Alignment] [Repertoires]

15 sequence(s)

>gnl|bcl2dbcds|A0A8C9GX27_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Piliocolobus tephrosceles GN=BBC3 (length=810 residues).
atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgccgcccccgctgcccccgccctgc
tgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccggccccgaggcccacgcccggacggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcc
cgtgcccagcgccccgggggccctggcgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcgggtgagtgctgggggt
ggggtagacggcaggtgggacttcccgccggaggagggggcggcaggcggcccccgccagatgtgctgcagctgctgccc
cgcgcggctgggtcgctccgcggacaggcaggtggggggtgagtgggtgggggggatcgcgcgcccgcagagccgcccag
ggactccgcgccgcggctggcatagtcggagcccgagccagggccagggccagggccgggaactaggctgccgcggagac
cagcggcgcgcccgtagcccgcggccgcggggactgagggcgtcgctgggcggcgcggctcatatatcccgggctattta
tagctggtga
>gnl|bcl2dbcds|A0A8C9H6M4_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Piliocolobus tephrosceles GN=PMAIP1 (length=399 residues).
caccggggaagctctcattggacaaaagcgtggtctctggcgctgggacctcacagtttcccgggcactcaccgagtgta
cttggtagctctgcgcgtccgagtagtcggtcccggcacccctgcccgcgggtctgttggtgttcagctcgcgtcctgca
gacgtccgacgcgctccagttggagaccgaggttcccgggctctgtagctgagtgggcggcggcactggcggagatgcct
gggaagaaggcgcgcaagaacgcgcaaccgagcccagcgcgggctcaggcagagctcgaagtcgagtgtgctactcaact
caggagatttggagacaaactgaatttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaacctga
>gnl|bcl2dbcds|A0A8C9H6M4_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Piliocolobus tephrosceles GN=PMAIP1 (length=417 residues).
atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccagcgcgggctcaggcaggagcggggactgcagggacggc
gagggaccaagccggatttgggattgggatgcagctgcatttcaccagaggcaaaaacctcctctcctcctccccacttg
ccctctcctcctccccacttgcccttccgcggggccacgaggaacaagtgcaagtagctcgaagtcgagtgtgctactca
actcaggagatttggagacaaactgaatttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaacct
gactgaatcaaaaacttgcataaggggactccaaaagagaatttttctcaggaggtgcacatttcatcaatttgaagcaa
gattgcattgtaattgg
>gnl|bcl2dbcds|A0A8C9HAT1_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Piliocolobus tephrosceles GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcccggt
aggggacaggccctcagactccggcaagtatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagacccgaagtcgccacagctcctaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccctaacctctgggcagc
acagcgatatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A8C9HAT1_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Piliocolobus tephrosceles GN=BAD (length=489 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcccggt
aggggacaggccctcagactccggcaagtatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagagcttggtattctccttctgaatctgaggactctgaaaatcccagtgca
aggatgctcgcggaagcatcagcagggatgtctgcctcagccactgactcagaagcccaacacgcagagaatgtaaagct
ggaggcgctggggctgtggagacccgaagtcgccacagctcctaccccgcggggacggaggaggacgaagggatggagga
ggagcccagcccctttcggggccgctcgcgctccgcgccccctaacctctgggcagcacagcgatatggccgcgagctcc
ggaggatga
>gnl|bcl2dbcds|A0A8C9HKG2_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Piliocolobus tephrosceles GN=BIK (length=516 residues).
atgccattcagaccccagtccaggattccgcgctcggggtgcgagaggctgctcccggggcggggcggggagggacccgg
gcggggagggaggggcggggcgcccggacctattaggtcccgcgccggcagccgggcagtagacacgaagcttctccggt
ggctcacagacgctgccagcatcgccgccgccagtgacatgttggccctgcagctggcctgcatcggggatgagatggac
gtgagcctcagggccccgcgcctggcccagctctctgaggtggccatgcacagcctgggtctggctttcatctacgacca
gaccgacgacatcagggatgttcttagaagtttcatggacggcttcaccacccttaaggagaacataatgaggttctgga
gatccccgaatcccgggtcccgggtgtcccgcgaacaggtgctgctggcgctgctgctgttgctggcactgctgctggcg
ctgctcagcgggggcctgcacctgctgctcaagtga
>gnl|bcl2dbcds|A0A8C9HKG2_BIK-02 BCL2-interacting killer gene OS=[Eukaryota] Piliocolobus tephrosceles GN=BIK (length=846 residues).
atgccattcagaccccagtccaggattccgcgctcggggtgcgagaggctgctcccggggcggggcggggagggacccgg
gcggggagggaggggcggggcgcccggacctattaggtcccgcgccggcagccgggcagtagacacgaagcttctccggt
ggctcacagacgctgccagcatcgccgccgccagtgacatgttggccctgcagctggcctgcatcggggatgagatggac
gtgagcctcagggccccgcgcctggcccagctctctgaggtggccatgcacagcctgggtctggctttcatctacgacca
gaccgacgacatcagggatgttcttagaagtttcatggacggcttcaccacccttaaggagaacataatgaggttctgga
gatccccgaatcccgggtcccgggtaagagccttcagattcctgaccctgactggctctgcggccagtgggggctgtcag
agctgctcctcagggcgccacagtccccatcactccctgtcatctgctgtgtcatcgttgtccacatctgcctggtccca
taggcttttgagtttgggattcctggttatgagtgcacaaaccagtgcgtggtcctgggtctccctctggcccgagagcc
ttcacctggcagacaggattctcgtctcctcgccagggcagaggccccctgagcagccttcctggcagcctggtcccatt
ctgcactgcccaccaccagggcagctgatcgccctcacctgtgtccaccctttgcctgtgtcccacagactggcagccgc
tggcctctttggccatgtcctcagggccactttccccctctcctga
>gnl|bcl2dbcds|A0A8C9HKG2_BIK-03 BCL2-interacting killer gene OS=[Eukaryota] Piliocolobus tephrosceles GN=BIK (length=483 residues).
atgtctggagtaagacccatctccagagacatattgatggagaccctcctgtatgagcagctcctggaacccctaaccat
ggaggttcttggtgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttggagtgtatggaggaca
gtgacatgttggccctgcagctggcctgcatcggggatgagatggacgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctgggtctggctttcatctacgaccagaccgacgacatcagggatgttcttagaagttt
catggacggcttcaccacccttaaggagaacataatgaggttctggagatccccgaatcccgggtcccgggtgtcccgcg
aacaggtgctgctggcgctgctgctgttgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctcaag
tga
>gnl|bcl2dbcds|A0A8C9I5G9_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Piliocolobus tephrosceles GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggccgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgtt
gcgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A8C9I5G9_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Piliocolobus tephrosceles GN=BCL2L11 (length=417 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcaggccgaacctgca
gatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggt
atttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtccgcctgg
tgtggagaatgcattga
>gnl|bcl2dbcds|A0A8C9I5G9_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Piliocolobus tephrosceles GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggccgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggatgtctcttccacctgattaa
>gnl|bcl2dbcds|A0A8C9I5G9_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Piliocolobus tephrosceles GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggccgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A8C9I5G9_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Piliocolobus tephrosceles GN=BCL2L11 (length=258 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaagcttccaggaggcaggccgaacctgcagatatgcgcc
cggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggaggttggcaaaactc
ctggcatcctccacctga
>gnl|bcl2dbcds|A0A8C9I5G9_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Piliocolobus tephrosceles GN=BCL2L11 (length=339 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagttatcctagaggatatgggtgat
acttcattgtggtttggatttatatttactggcttagatttgtatggccaccaccacagtcaagatacagaacaactcaa
ccacagggatttctcatga
>gnl|bcl2dbcds|A0A8C9LTX9_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Piliocolobus tephrosceles GN=BMF (length=615 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggagagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtaactgaggaaccccagcgactgttttatggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcgggccctaggcccttgac
ctggaatgggggccgttgtcaaacactgttgaaggggaggctgatgtctctgtga
© 1998-2022Legal notice