Dataset for CDS classical BH3-containing proteins of organism Piliocolobus tephrosceles

[Download (right click)] [Edit] [Sequences] [Repertoires]

15 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9H6M4_PMAIP1-      ------------cacc----------------------------------
A0A8C9H6M4_PMAIP1-      -----------atgcc----------------------------------
A0A8C9I5G9_BCL2L11      -----------atggc------aaagcaaccttctgatgtaagttctgag
A0A8C9I5G9_BCL2L11      -----------atggc------aaagcaaccttctgatgtaagttctgag
A0A8C9I5G9_BCL2L11      -----------atggc------aaagcaaccttctgatgtaagttctgag
A0A8C9I5G9_BCL2L11      -----------atggc------aaagcaaccttctgatgtaagttctgag
A0A8C9I5G9_BCL2L11      -----------atggc------aaagcaaccttctgatgtaagttctgag
A0A8C9I5G9_BCL2L11      -----------atggc------aaagcaaccttctgatgtaagttctgag
A0A8C9LTX9_BMF-01       -----------atgga-----------gccatctcg----gtgtgt----
A0A8C9HAT1_BAD-01       -----------atgtt----------ccagatccca----gagttt----
A0A8C9HAT1_BAD-02       -----------atgtt----------ccagatccca----gagttt----
A0A8C9GX27_BBC3-01      atggcccgcgcacgcc---aggagggcagctccccg----gagcccgtag
A0A8C9HKG2_BIK-03       -----------atgtctggagtaagacccatctcca----ga--------
A0A8C9HKG2_BIK-01       -----------atgcc---attcagaccccagtcca----ggattc----
A0A8C9HKG2_BIK-02       -----------atgcc---attcagaccccagtcca----ggattc----
                                                                          

A0A8C9H6M4_PMAIP1-      -------ggggaag--------------ctctcattggacaaaagcgtgg
A0A8C9H6M4_PMAIP1-      -------tgggaagaaggcgcgcaagaacgcgcaaccgagcccagcgcgg
A0A8C9I5G9_BCL2L11      tgtgaccgagaaggtagacaat--------tgcagcctg---cggagagg
A0A8C9I5G9_BCL2L11      tgtgaccgagaaggtagacaat--------tgcagcctg---cggagagg
A0A8C9I5G9_BCL2L11      tgtgaccgagaaggtagacaat--------tgcagcctg---cggagagg
A0A8C9I5G9_BCL2L11      tgtgaccgagaaggtagacaat--------tgcagcctg---cggagagg
A0A8C9I5G9_BCL2L11      tgtgaccgagaaggtagacaat--------tgcagcctg---cggagagg
A0A8C9I5G9_BCL2L11      tgtgaccgagaaggtagacaat--------tgcagcctg---cggagagg
A0A8C9LTX9_BMF-01       ------ggaggagctggaggatgat-gtgttccagccggaggacggagag
A0A8C9HAT1_BAD-01       -gagcctagtgagcaggaagac--------tccagctctgcagagagggg
A0A8C9HAT1_BAD-02       -gagcctagtgagcaggaagac--------tccagctctgcagagagggg
A0A8C9GX27_BBC3-01      agggcctggcccgcgacggcccgcgccccttcccgctcggccgcctggtg
A0A8C9HKG2_BIK-03       --------------gacatattgat--------------------ggaga
A0A8C9HKG2_BIK-01       cgcgctcggggtgcgagaggctgctcccggg---gcggggcggggaggga
A0A8C9HKG2_BIK-02       cgcgctcggggtgcgagaggctgctcccggg---gcggggcggggaggga
                                                                          

A0A8C9H6M4_PMAIP1-      tctctggc----gctgggacctcacagtttcccgggc-------------
A0A8C9H6M4_PMAIP1-      gctcaggcaggagcggggactgcagggacggcgaggg-------------
A0A8C9I5G9_BCL2L11      cct-----------------------------------------------
A0A8C9I5G9_BCL2L11      cct-----------------------------------------------
A0A8C9I5G9_BCL2L11      cct-----------------------------------------------
A0A8C9I5G9_BCL2L11      cct-----------------------------------------------
A0A8C9I5G9_BCL2L11      cct-----------------------------------------------
A0A8C9I5G9_BCL2L11      cct-----------------------------------------------
A0A8C9LTX9_BMF-01       ccgggg--------------------------------------------
A0A8C9HAT1_BAD-01       cctggg--------------------------------------------
A0A8C9HAT1_BAD-02       cctggg--------------------------------------------
A0A8C9GX27_BBC3-01      ccctcggcagtgtcctgcggcctctgcgagcccggcctggctgccgcccc
A0A8C9HKG2_BIK-03       ccctcctgtatg---agcagctcctggaacccctaaccatggaggttctt
A0A8C9HKG2_BIK-01       cccgggcgggga---gggaggggcggggcgcccggacctattaggtccc-
A0A8C9HKG2_BIK-02       cccgggcgggga---gggaggggcggggcgcccggacctattaggtccc-
                         *                                                

A0A8C9H6M4_PMAIP1-      -----actca-ccgagt---gtacttggtagc------tctgcgcgtccg
A0A8C9H6M4_PMAIP1-      -----accaagccggatttgggattgggatgca-----gctgcatttcac
A0A8C9I5G9_BCL2L11      -----ccccagctcaga---------------------cctggggcccct
A0A8C9I5G9_BCL2L11      -----ccccagctcaga---------------------cctggggcccct
A0A8C9I5G9_BCL2L11      -----ccccagctcaga---------------------cctggggcccct
A0A8C9I5G9_BCL2L11      -----ccccagctcaga---------------------cctggggcccct
A0A8C9I5G9_BCL2L11      -----ccccagctcaga---------------------cctggggcccct
A0A8C9I5G9_BCL2L11      -----ccccagctcaga---------------------cctggggcccct
A0A8C9LTX9_BMF-01       -----gcccaacccgggag----ctcgctctctgccgatctgtttgccca
A0A8C9HAT1_BAD-01       -----ccccagcccggtaggggacaggccctcagac--tccgg-------
A0A8C9HAT1_BAD-02       -----ccccagcccggtaggggacaggccctcagac--tccgg-------
A0A8C9GX27_BBC3-01      cgctgcccccgccctgctg----cccgctgcctacc--tctgcgccccca
A0A8C9HKG2_BIK-03       ggtgtgactgaccctgaagaggacctggacc----c--tatggaggactt
A0A8C9HKG2_BIK-01       -gcgccggcagccgggcagtagacacgaagctt--c--tccggtggctca
A0A8C9HKG2_BIK-02       -gcgccggcagccgggcagtagacacgaagctt--c--tccggtggctca
                                   *                             *        

A0A8C9H6M4_PMAIP1-      agtagtcgg----tcccggcacccctgccc--------------------
A0A8C9H6M4_PMAIP1-      cagaggcaaaaacctcctctcctcctcccc--------------------
A0A8C9I5G9_BCL2L11      acc----------tccctacagacagaaccaca-----------------
A0A8C9I5G9_BCL2L11      acc----------tccctacagacagaaccacaa----------------
A0A8C9I5G9_BCL2L11      acc----------tccctacagacagaaccacaaggtaatcccgaaggca
A0A8C9I5G9_BCL2L11      acc----------tccctacagacagaaccaca-----------------
A0A8C9I5G9_BCL2L11      acc----------tccctacagacagaaccacaaggtaatcccgaaggca
A0A8C9I5G9_BCL2L11      acc----------tccctacagacagaaccacaaggtaatcccgaaggca
A0A8C9LTX9_BMF-01       gag----------cctacttgactgccccctca-----------------
A0A8C9HAT1_BAD-01       -------------------caagtatcatc--------------------
A0A8C9HAT1_BAD-02       -------------------caagtatcatc--------------------
A0A8C9GX27_BBC3-01      ccg----------ccccacccgccgtcacc--------------------
A0A8C9HKG2_BIK-03       cga----------tcctttggagtgt-atg--------------------
A0A8C9HKG2_BIK-01       cag----------acgctgccagcatcgcc--------------------
A0A8C9HKG2_BIK-02       cag----------acgctgccagcatcgcc--------------------
                                                                          

A0A8C9H6M4_PMAIP1-      -----------gcgggtctgttggtgttcagctcgcgtcctg--------
A0A8C9H6M4_PMAIP1-      -----------acttgcc-------------ctctcctcct---------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      atcacggaggtgaaggggacagctgcccccacggcagccctc----aggg
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      atcacggaggtgaaggggacagctgcccccacggcagccctc----aggg
A0A8C9I5G9_BCL2L11      atcacggaggtgaaggggacagctgcccccacggcagccctc----aggg
A0A8C9LTX9_BMF-01       -----------gccgacttcagctcttccctctcacccactgctgtggcc
A0A8C9HAT1_BAD-01       -----------gccag-gccccaggcctcctgtgggacgcca----gtca
A0A8C9HAT1_BAD-02       -----------gccag-gccccaggcctcctgtgggacgcca----gtca
A0A8C9GX27_BBC3-01      -----------gccgccctggggggcccccgctggcctgggg----gtcc
A0A8C9HKG2_BIK-03       -----------gagga-------------cagtgacatgttg----g-cc
A0A8C9HKG2_BIK-01       -----------gccgc-------------cagtgacatgttg----g-cc
A0A8C9HKG2_BIK-02       -----------gccgc-------------cagtgacatgttg----g-cc
                                                                          

A0A8C9H6M4_PMAIP1-      ------cagacgtccgacgcgctccagttg--------------------
A0A8C9H6M4_PMAIP1-      ------------ccccacttgccc--------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      cccgctggccccaccggccagccctggcccttttgctaccagatccccgc
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      cccgctggccccaccggccagccctggcccttttgctaccagatccccgc
A0A8C9I5G9_BCL2L11      cccgctggccccaccggccagccctggcccttttgctaccagatccccgc
A0A8C9LTX9_BMF-01       ct------ggccttcgacc--caccagccaggaagacaaggctaccc---
A0A8C9HAT1_BAD-01       ccagcaggagcagccaaccagcagcagccatca-----------------
A0A8C9HAT1_BAD-02       ccagcaggagcagccaaccagcagcagccatcatggagggagagctt---
A0A8C9GX27_BBC3-01      cc-------gcagccggcc----ccgaggcccacgcccgga-----c---
A0A8C9HKG2_BIK-03       ct-------gcagctggcctgcatcggggatga------ga-----t---
A0A8C9HKG2_BIK-01       ct-------gcagctggcctgcatcggggatga------ga-----t---
A0A8C9HKG2_BIK-02       ct-------gcagctggcctgcatcggggatga------ga-----t---
                                                                          

A0A8C9H6M4_PMAIP1-      ---------------gagaccgaggttcccgggctctgtagctgagtggg
A0A8C9H6M4_PMAIP1-      -------------------------ttcc--------------------g
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      ttttcatctttatgagaagatcctccctgctgtctcgatcctccagtggg
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      ttttcatctttatgagaagatcctccctgctgtctcgatcctccagtggg
A0A8C9I5G9_BCL2L11      ttttcatctttatgagaagatcctccctgctgtctcgatcctccagtggg
A0A8C9LTX9_BMF-01       ---------------agaccctcggcccagcctcccccagccaaggtgtc
A0A8C9HAT1_BAD-01       --------------------------------------------------
A0A8C9HAT1_BAD-02       ---------------ggtattctccttctgaatctgaggactctg-----
A0A8C9GX27_BBC3-01      ---------------ggtcctcagcc-ctcgctctcgctggcgga-----
A0A8C9HKG2_BIK-03       ---------------ggacgtgagcctcagggccccgcgcctggc-----
A0A8C9HKG2_BIK-01       ---------------ggacgtgagcctcagggccccgcgcctggc-----
A0A8C9HKG2_BIK-02       ---------------ggacgtgagcctcagggccccgcgcctggc-----
                                                                          

A0A8C9H6M4_PMAIP1-      cggcggcactggcggagatgcctgggaagaaggcgcgcaagaacgcgcaa
A0A8C9H6M4_PMAIP1-      cggggccac----------------gaggaacaagtgcaag---------
A0A8C9I5G9_BCL2L11      ------------------------------agacagg--agccca-gcac
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      tatttctct-------------tttgacacagacagg--agccca-gcac
A0A8C9I5G9_BCL2L11      ------------------------------agacagg--agccca-gcac
A0A8C9I5G9_BCL2L11      tatttctct-------------tttgacacagacagg--agccca-gcac
A0A8C9I5G9_BCL2L11      tatttctct-------------tttgacacagacagg--agccca-gcac
A0A8C9LTX9_BMF-01       atgctgcct-------------tgtggggtaactgaggaacccca-gcga
A0A8C9HAT1_BAD-01       --------------------------------------------------
A0A8C9HAT1_BAD-02       --aaaatcc-------------cagtgcaaggatgct----cgcg-gaag
A0A8C9GX27_BBC3-01      --gcagcac-------------ctggagtcgcccgtg----ccca-gcgc
A0A8C9HKG2_BIK-03       --ccagctc-------------tctgaggtggccatg----caca-g---
A0A8C9HKG2_BIK-01       --ccagctc-------------tctgaggtggccatg----caca-g---
A0A8C9HKG2_BIK-02       --ccagctc-------------tctgaggtggccatg----caca-g---
                                                                          

A0A8C9H6M4_PMAIP1-      ccgagcccagcgcgggctcaggcagagctcgaagtcgagtgtgct-----
A0A8C9H6M4_PMAIP1-      ------------------------tagctcgaagtcgagtgtgct-----
A0A8C9I5G9_BCL2L11      ccatgagttgtgacaaatcaacacaaaccccaagtcctccttgcc-----
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      ccatgagttgtgacaaatcaacacaaaccccaagtcctccttgcc-----
A0A8C9I5G9_BCL2L11      ccatgagttgtgacaaatcaacacaaaccccaagtcctccttgcc-----
A0A8C9I5G9_BCL2L11      ccatgagttgtgacaaatcaacacaaaccccaagtcctccttgcc-----
A0A8C9I5G9_BCL2L11      ccatgagttgtgacaaatcaacacaaaccccaagtcctccttgcc-----
A0A8C9LTX9_BMF-01       ctgttttatggcaatgctggctaccggcttcc--tctc-cctgcc-----
A0A8C9HAT1_BAD-01       --------------------------------------------------
A0A8C9HAT1_BAD-02       ca------tcag---cagggatgtctgcctca--gcca--ctgactcaga
A0A8C9GX27_BBC3-01      cc------cgggggccctggcgggcggtccca--cccaggcggccccggg
A0A8C9HKG2_BIK-03       cc------tggg---tctggc------tttca--tcta--cgacc-----
A0A8C9HKG2_BIK-01       cc------tggg---tctggc------tttca--tcta--cgacc-----
A0A8C9HKG2_BIK-02       cc------tggg---tctggc------tttca--tcta--cgacc-----
                                                                          

A0A8C9H6M4_PMAIP1-      --------------------------------------------------
A0A8C9H6M4_PMAIP1-      --------------------------------------------------
A0A8C9I5G9_BCL2L11      -----------------------aggccttcaaccactatctcagtgcaa
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      -----------------------aggccttcaaccactatctcagtgcaa
A0A8C9I5G9_BCL2L11      -----------------------aggccttcaaccactatctcagtgcaa
A0A8C9I5G9_BCL2L11      -----------------------aggccttcaaccactatctcagtgcaa
A0A8C9I5G9_BCL2L11      -----------------------aggccttcaaccactatctcagtgcaa
A0A8C9LTX9_BMF-01       -----------------------agtttcccggcagtcttgcccatcggg
A0A8C9HAT1_BAD-01       ---------------------------tggaggcgct------------g
A0A8C9HAT1_BAD-02       agcccaacacgcagagaatgta-aagctggaggcgct------------g
A0A8C9GX27_BBC3-01      agtccgcggggaggaggaacagtgggcccgggagatc------------g
A0A8C9HKG2_BIK-03       -----------------------agaccgacgacatc------------a
A0A8C9HKG2_BIK-01       -----------------------agaccgacgacatc------------a
A0A8C9HKG2_BIK-02       -----------------------agaccgacgacatc------------a
                                                                          

A0A8C9H6M4_PMAIP1-      --actcaactcaggagatttggag--------------------------
A0A8C9H6M4_PMAIP1-      --actcaactcaggagatttggag--------------------------
A0A8C9I5G9_BCL2L11      tggtagttatcctagaggatatgggtgatacttcat-tgtg-gtttggat
A0A8C9I5G9_BCL2L11      --gc-----ttccaggaggca-ggccgaacctgcagatatgcgcccgga-
A0A8C9I5G9_BCL2L11      tggc-----ttccaggaggca-ggccgaacctgcagatatgcgcccgga-
A0A8C9I5G9_BCL2L11      tggc-----ttccaggaggca-ggccgaacctgcagatatgcgcccgga-
A0A8C9I5G9_BCL2L11      tggc-----ttccaggaggca-ggccgaacctgcagatatgcgcccgga-
A0A8C9I5G9_BCL2L11      tggc-----ttccaggaggca-ggccgaacctgcagatatgcgcccgga-
A0A8C9LTX9_BMF-01       gagcagccccccgaagggcagtgg------caacatcgagc-------ag
A0A8C9HAT1_BAD-01       ggg-----ctgtggagacccgaagtcgccacagctcctaccccgcgggga
A0A8C9HAT1_BAD-02       ggg-----ctgtggagacccgaagtcgccacagctcctaccccgcgggga
A0A8C9GX27_BBC3-01      gggcccagctgcggcggatggcgg-----acgacctc-aacgcgcagtac
A0A8C9HKG2_BIK-03       gggatgttcttagaagtttcatgg-----acggcttc-accacccttaag
A0A8C9HKG2_BIK-01       gggatgttcttagaagtttcatgg-----acggcttc-accacccttaag
A0A8C9HKG2_BIK-02       gggatgttcttagaagtttcatgg-----acggcttc-accacccttaag
                                               *                          

A0A8C9H6M4_PMAIP1-      ----acaaactgaatttccggcaga-----------------------aa
A0A8C9H6M4_PMAIP1-      ----acaaactgaatttccggcaga-----------------------aa
A0A8C9I5G9_BCL2L11      ttatatttactg--------------------------------------
A0A8C9I5G9_BCL2L11      -gatacggatcg--------------------------------------
A0A8C9I5G9_BCL2L11      -gatacggatcg--------------------------------------
A0A8C9I5G9_BCL2L11      -gatacggatcg--------------------------------------
A0A8C9I5G9_BCL2L11      -gatacggatcg--------------------------------------
A0A8C9I5G9_BCL2L11      -gatacggatcg--------------------------------------
A0A8C9LTX9_BMF-01       aggtacagattg--------------------------------------
A0A8C9HAT1_BAD-01       cggaggaggacgaagggatggagga----------------ggagcccag
A0A8C9HAT1_BAD-02       cggaggaggacgaagggatggagga----------------ggagcccag
A0A8C9GX27_BBC3-01      gagcggcgggtga-gtgctgggggtggggtagacggcaggtgggacttcc
A0A8C9HKG2_BIK-03       gagaacataatgaggttctggagat-------------------------
A0A8C9HKG2_BIK-01       gagaacataatgaggttctggagat-------------------------
A0A8C9HKG2_BIK-02       gagaacataatgaggttctggagat-------------------------
                                   *                                      

A0A8C9H6M4_PMAIP1-      cttctgaatctg-atagccaaactc-------------------------
A0A8C9H6M4_PMAIP1-      cttctgaatctg-atagccaaactc-------------------------
A0A8C9I5G9_BCL2L11      -gcttagatttgtatggccaccacc-------------------------
A0A8C9I5G9_BCL2L11      -cccaagagttg--cggcga--atc-------------------------
A0A8C9I5G9_BCL2L11      -cccaagagttg--cggcga--atc-------------------------
A0A8C9I5G9_BCL2L11      -cccaagagttg--cggcga--atc-------------------------
A0A8C9I5G9_BCL2L11      -cccaagagttg--cggcga--atc-------------------------
A0A8C9I5G9_BCL2L11      -cccaagagttg--cggcga--atc-------------------------
A0A8C9LTX9_BMF-01       -cccgaaagctt--cagtgcattgc-----------------------ag
A0A8C9HAT1_BAD-01       cccct---ttcg--gggccgctcgc-------------------------
A0A8C9HAT1_BAD-02       cccct---ttcg--gggccgctcgc-------------------------
A0A8C9GX27_BBC3-01      cgccggaggagg--gggcggcaggc-------------------------
A0A8C9HKG2_BIK-03       -ccccgaatccc--gggtcccgggt-------------------------
A0A8C9HKG2_BIK-01       -ccccgaatccc--gggtcccgggt-------------------------
A0A8C9HKG2_BIK-02       -ccccgaatccc--gggtcccgggtaagagccttcagattcctgaccctg
                                        *                                 

A0A8C9H6M4_PMAIP1-      ------------------------------ttctgctcag----------
A0A8C9H6M4_PMAIP1-      ------------------------------ttctgctcag----------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9LTX9_BMF-01       accagttccaccggcttcatgtgcagcaacaccagcagaac----cgaaa
A0A8C9HAT1_BAD-01       ----gctccgcgcccc---------ctaacctctgggcagcacagcgata
A0A8C9HAT1_BAD-02       ----gctccgcgcccc---------ctaacctctgggcagcacagcgata
A0A8C9GX27_BBC3-01      ----ggcccccg--ccagatgtgctgcagctgctgccccgcgcggctggg
A0A8C9HKG2_BIK-03       ----gtcccgcgaaca---ggtgctgctggcgctgct-------------
A0A8C9HKG2_BIK-01       ----gtcccgcgaaca---ggtgctgctggcgctgct-------------
A0A8C9HKG2_BIK-02       actggctctgcggccagtgggggctgtcagagctgctcctcagggcgcca
                                                                          

A0A8C9H6M4_PMAIP1-      --------------------------------------------------
A0A8C9H6M4_PMAIP1-      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9LTX9_BMF-01       tcgc----------------------------------------------
A0A8C9HAT1_BAD-01       tggccgc-------------------------------------------
A0A8C9HAT1_BAD-02       tggccgc-------------------------------------------
A0A8C9GX27_BBC3-01      tcgctcc-------------------------------------------
A0A8C9HKG2_BIK-03       --------------------------------------------------
A0A8C9HKG2_BIK-01       --------------------------------------------------
A0A8C9HKG2_BIK-02       cagtccccatcactccctgtcatctgctgtgtcatcgttgtccacatctg
                                                                          

A0A8C9H6M4_PMAIP1-      -------------gaacctga-----------------------------
A0A8C9H6M4_PMAIP1-      -------------gaacctgactgaatcaaaaacttgc------------
A0A8C9I5G9_BCL2L11      -------------acagtcaag----------------------------
A0A8C9I5G9_BCL2L11      -------------ggagacgag----------------------------
A0A8C9I5G9_BCL2L11      -------------ggagacgag----------------------------
A0A8C9I5G9_BCL2L11      -------------ggagacgag----------------------------
A0A8C9I5G9_BCL2L11      -------------ggagacgag----------------------------
A0A8C9I5G9_BCL2L11      -------------ggagacgag----------------------------
A0A8C9LTX9_BMF-01       -----gtgtggtggcagatc------------------------------
A0A8C9HAT1_BAD-01       -----gagctccggaggatgagtgacgagtttgtggactcctttaaggga
A0A8C9HAT1_BAD-02       -----gagctccggaggatga-----------------------------
A0A8C9GX27_BBC3-01      -----gcggacaggcaggtggggggtgagtgggtgggggggatcgcgcgc
A0A8C9HKG2_BIK-03       -------------gctgttg------------------------------
A0A8C9HKG2_BIK-01       -------------gctgttg------------------------------
A0A8C9HKG2_BIK-02       cctggtcccataggcttttgagtttgggattcctgg------ttatgagt
                                                                          

A0A8C9H6M4_PMAIP1-      --------------------------------------------------
A0A8C9H6M4_PMAIP1-      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9LTX9_BMF-01       ----------------------------ctcctcttcctgc---------
A0A8C9HAT1_BAD-01       cttcctcgcccgaagagcgcgggcacagcgacgcagatgcg---------
A0A8C9HAT1_BAD-02       --------------------------------------------------
A0A8C9GX27_BBC3-01      ccgcagagcc----gcccagggactccgcgccgcggctggc---------
A0A8C9HKG2_BIK-03       ------------------------ctggcactgctgctggc---------
A0A8C9HKG2_BIK-01       ------------------------ctggcactgctgctggc---------
A0A8C9HKG2_BIK-02       gcacaaacca----gtgcgtggtcctgggtctccctctggcccgagagcc
                                                                          

A0A8C9H6M4_PMAIP1-      --------------------------------------------------
A0A8C9H6M4_PMAIP1-      -----------------ataaggggactccaaaagaga------------
A0A8C9I5G9_BCL2L11      -----------------atacagaacaactcaaccaca------------
A0A8C9I5G9_BCL2L11      -----------------tttaacgcttactatgcaagg------------
A0A8C9I5G9_BCL2L11      -----------------tttaacgcttactatgcaagg------------
A0A8C9I5G9_BCL2L11      -----------------tttaacgcttactatgcaagg------------
A0A8C9I5G9_BCL2L11      -----------------tttaacgcttactatgcaagg------------
A0A8C9I5G9_BCL2L11      -----------------tttaacgcttactatgcaagg------------
A0A8C9LTX9_BMF-01       -----------------acaaccttgctttgaatggagaagagaacagga
A0A8C9HAT1_BAD-01       ---------------------gcaaagctccagctgga------------
A0A8C9HAT1_BAD-02       --------------------------------------------------
A0A8C9GX27_BBC3-01      -----------------atagtcggagcccgagccagg------------
A0A8C9HKG2_BIK-03       ------------------------gctgctcagcgggg------------
A0A8C9HKG2_BIK-01       ------------------------gctgctcagcgggg------------
A0A8C9HKG2_BIK-02       ttcacctggcagacaggattctcgtctcctcgccagggcagaggccccct
                                                                          

A0A8C9H6M4_PMAIP1-      --------------------------------------------------
A0A8C9H6M4_PMAIP1-      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9I5G9_BCL2L11      --------------------------------------------------
A0A8C9LTX9_BMF-01       acggggcgggccctaggcccttgacctggaatgg----------------
A0A8C9HAT1_BAD-01       ----------cgcgagtcttccagtcctggtgggatcggaacttgggcag
A0A8C9HAT1_BAD-02       --------------------------------------------------
A0A8C9GX27_BBC3-01      -----gccagggccagggccgggaactaggctgccgcggagaccagcggc
A0A8C9HKG2_BIK-03       --------------------------------------------------
A0A8C9HKG2_BIK-01       --------------------------------------------------
A0A8C9HKG2_BIK-02       gagcagccttcctggcagcctggtcccattctgcactgcccaccaccagg
                                                                          

A0A8C9H6M4_PMAIP1-      --------------------------------------------------
A0A8C9H6M4_PMAIP1-      -------------------------------------------------a
A0A8C9I5G9_BCL2L11      ----gggat-----------------------------------------
A0A8C9I5G9_BCL2L11      ----aggttg----------------------------------------
A0A8C9I5G9_BCL2L11      ----agggtatttttgaataattaccaagcagccgaagaccacccacaaa
A0A8C9I5G9_BCL2L11      ----agggtatttttgaataattaccaagcagccgaagaccacccacaaa
A0A8C9I5G9_BCL2L11      ----aggatgtctct-----------------------------------
A0A8C9I5G9_BCL2L11      ----aggtt-----------------------------------------
A0A8C9LTX9_BMF-01       -----gggccgttgtcaaacac----------------------------
A0A8C9HAT1_BAD-01       gggaagctccgccccctcccag----------------------------
A0A8C9HAT1_BAD-02       --------------------------------------------------
A0A8C9GX27_BBC3-01      gcgcccgta-gcccgcggccgcggggact-------------------ga
A0A8C9HKG2_BIK-03       ----------gcctgcacctgc----------------------------
A0A8C9HKG2_BIK-01       ----------gcctgcacctgc----------------------------
A0A8C9HKG2_BIK-02       gcagctgatcgccctcacctgtgtccaccctttgcctgtgtcccacagac
                                                                          

A0A8C9H6M4_PMAIP1-      --------------------------------------------------
A0A8C9H6M4_PMAIP1-      tttttctcaggaggtgcacatttcatcaatttgaagcaagattgcattgt
A0A8C9I5G9_BCL2L11      ------------------------------ttctcatg------------
A0A8C9I5G9_BCL2L11      ------------gcaaaactcctggcatcctccacctg------------
A0A8C9I5G9_BCL2L11      tggttatcttacgactgttgcgttacattgtccgcctggtgtggagaatg
A0A8C9I5G9_BCL2L11      tggttatcttacgactgttgcgttacattgtccgcctggtgtggagaatg
A0A8C9I5G9_BCL2L11      ------------------------------tccacctg------------
A0A8C9I5G9_BCL2L11      ---------------------------------agaga------------
A0A8C9LTX9_BMF-01       ---------------------------tgttgaaggggaggctgatgtct
A0A8C9HAT1_BAD-01       --------------------------------------------------
A0A8C9HAT1_BAD-02       --------------------------------------------------
A0A8C9GX27_BBC3-01      gggcgtcgctgggcggcgcggctcatatatcccgggctatttatagctgg
A0A8C9HKG2_BIK-03       ---------------------------tgctcaag---------------
A0A8C9HKG2_BIK-01       ---------------------------tgctcaag---------------
A0A8C9HKG2_BIK-02       tggcagccgctggcctctttggccatgtcctcagggccactttccccctc
                                                                          

A0A8C9H6M4_PMAIP1-      ------
A0A8C9H6M4_PMAIP1-      aattgg
A0A8C9I5G9_BCL2L11      -----a
A0A8C9I5G9_BCL2L11      -----a
A0A8C9I5G9_BCL2L11      cattga
A0A8C9I5G9_BCL2L11      cattga
A0A8C9I5G9_BCL2L11      -attaa
A0A8C9I5G9_BCL2L11      -aatag
A0A8C9LTX9_BMF-01       ctgtga
A0A8C9HAT1_BAD-01       ---tga
A0A8C9HAT1_BAD-02       ------
A0A8C9GX27_BBC3-01      ---tga
A0A8C9HKG2_BIK-03       ---tga
A0A8C9HKG2_BIK-01       ---tga
A0A8C9HKG2_BIK-02       tcctga
                              

© 1998-2022Legal notice