Dataset for CDS BIK of organism Piliocolobus tephrosceles

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C9HKG2_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Piliocolobus tephrosceles GN=BIK (length=516 residues).
atgccattcagaccccagtccaggattccgcgctcggggtgcgagaggctgctcccggggcggggcggggagggacccgg
gcggggagggaggggcggggcgcccggacctattaggtcccgcgccggcagccgggcagtagacacgaagcttctccggt
ggctcacagacgctgccagcatcgccgccgccagtgacatgttggccctgcagctggcctgcatcggggatgagatggac
gtgagcctcagggccccgcgcctggcccagctctctgaggtggccatgcacagcctgggtctggctttcatctacgacca
gaccgacgacatcagggatgttcttagaagtttcatggacggcttcaccacccttaaggagaacataatgaggttctgga
gatccccgaatcccgggtcccgggtgtcccgcgaacaggtgctgctggcgctgctgctgttgctggcactgctgctggcg
ctgctcagcgggggcctgcacctgctgctcaagtga
>gnl|bcl2dbcds|A0A8C9HKG2_BIK-02 BCL2-interacting killer gene OS=[Eukaryota] Piliocolobus tephrosceles GN=BIK (length=846 residues).
atgccattcagaccccagtccaggattccgcgctcggggtgcgagaggctgctcccggggcggggcggggagggacccgg
gcggggagggaggggcggggcgcccggacctattaggtcccgcgccggcagccgggcagtagacacgaagcttctccggt
ggctcacagacgctgccagcatcgccgccgccagtgacatgttggccctgcagctggcctgcatcggggatgagatggac
gtgagcctcagggccccgcgcctggcccagctctctgaggtggccatgcacagcctgggtctggctttcatctacgacca
gaccgacgacatcagggatgttcttagaagtttcatggacggcttcaccacccttaaggagaacataatgaggttctgga
gatccccgaatcccgggtcccgggtaagagccttcagattcctgaccctgactggctctgcggccagtgggggctgtcag
agctgctcctcagggcgccacagtccccatcactccctgtcatctgctgtgtcatcgttgtccacatctgcctggtccca
taggcttttgagtttgggattcctggttatgagtgcacaaaccagtgcgtggtcctgggtctccctctggcccgagagcc
ttcacctggcagacaggattctcgtctcctcgccagggcagaggccccctgagcagccttcctggcagcctggtcccatt
ctgcactgcccaccaccagggcagctgatcgccctcacctgtgtccaccctttgcctgtgtcccacagactggcagccgc
tggcctctttggccatgtcctcagggccactttccccctctcctga
>gnl|bcl2dbcds|A0A8C9HKG2_BIK-03 BCL2-interacting killer gene OS=[Eukaryota] Piliocolobus tephrosceles GN=BIK (length=483 residues).
atgtctggagtaagacccatctccagagacatattgatggagaccctcctgtatgagcagctcctggaacccctaaccat
ggaggttcttggtgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttggagtgtatggaggaca
gtgacatgttggccctgcagctggcctgcatcggggatgagatggacgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctgggtctggctttcatctacgaccagaccgacgacatcagggatgttcttagaagttt
catggacggcttcaccacccttaaggagaacataatgaggttctggagatccccgaatcccgggtcccgggtgtcccgcg
aacaggtgctgctggcgctgctgctgttgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctcaag
tga
© 1998-2022Legal notice